Composite silk fiber containing spider silk protein and preparation method thereof
Through CRISPR/Cas12a genome editing technology, the MaSp-c gene of the spider-shaped kettle-shaped cervical silk protein was introduced into the silk fibre light chain gene position of the silk fibre in the silkworm, solving the problem of low expression level of recombinant spider silk protein in the prior art, and achieving efficient production of composite silk fibers with excellent mechanical properties.
Patent Information
- Application Number
- CN202510377231.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-28
- Publication Date
- 2025-07-01
AI Technical Summary
It is difficult to obtain large quantities of genetically engineered spider silk fibers with excellent mechanical properties in the prior art, mainly due to the low expression level of recombinant spider silk proteins and the complex production process.
Through genome editing technology, the MaSp-c gene of the spider large pot-shaped glandular silk protein is introduced into the silk fibre light chain gene position of the silkworm in the silkworm to replace the original gene to form a complex silk fiber containing the spider silk protein.
The content and mechanical properties of spider silk protein in composite silk fibers are improved, the production process is simplified, the cost is reduced, and the large-scale production of silk fibers with excellent mechanical properties is achieved.
Smart Images

Figure CN120230797A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of genome editing, and in particular to a composite silk fiber containing spider silk protein and a preparation method thereof. Background Art
[0002] Spider silk is renowned for its exceptional comprehensive mechanical properties. Its dragline silk boasts a perfect combination of breaking strength, Young's modulus, toughness, and elongation at break, making it the fiber with the best overall mechanical properties found in nature. Its strength even exceeds that of steel and Kevlar fibers at comparable mass. Consequently, spider silk fibers have garnered significant research interest in cutting-edge fields such as medicine and the military. However, spiders are territorial, carnivorous, and cannibalistic, and harvesting spider silk is difficult and extremely low in yield. While numerous innovative applications of spider silk have been achieved in high-strength military materials and low-toxic, highly biocompatible, and biodegradable medical materials, limited production has hindered the practical application of these discoveries.
[0003] To date, researchers have successfully expressed spider silk protein gene sequences in heterologous cells or hosts through genetic engineering techniques. However, recombinant spider silk proteins expressed through this strategy cannot autonomously assemble into silk fibers. Therefore, recombinant spider silk proteins must be purified and processed into silk fibers through artificial spinning techniques. However, due to the limited maturity of related technologies such as heterologous expression, purification of expression products, and artificial spinning, it is currently difficult to obtain large quantities of genetically engineered spider silk fibers with excellent mechanical properties.
[0004] Spinning silk and spinning cocoons is a natural habit of the silkworm. After over 5,000 years of domestication, the silkworm's ability to synthesize silk protein has reached near perfection. Silk protein is primarily composed of sericin and fibroin. Silk fibers are primarily composed of fibroin heavy chain (350 kDa), fibroin light chain (25.8 kDa), and P25 protein (25.7 kDa) in a molar ratio of 6:6:1. The mechanical properties of silk protein are primarily determined by the high molecular weight and highly repetitive amino acid sequence of the fibroin heavy chain. The primary structure of spider silk protein bears significant resemblance to that of silkworm fibroin. The silkworm's silk secretion system is very similar to that of spiders, making it considered the most promising vehicle for the commercial production of recombinant spider silk protein.
[0005] The prior art discloses a method for improving silk properties in silkworms by expressing a spider botryoid silk protein gene. Specifically, a spider silk protein gene sequence consisting of 1-8 consecutive repeats of botryoid silk from black widow spiders or orbicularis spiders is cloned into a transgenic vector based on the piggyBac transposon to construct a recombinant plasmid, pBac-ACSP. This plasmid is mixed with a helper plasmid expressing a transposase and introduced into newly laid silkworm eggs via microinjection. The piggyBac transposon mediates the integration of an expression cassette for the secretory botryoid silk protein gene into the silkworm genome, where it is stably inherited and expressed. This results in the development of transgenic silkworms that secrete and express the spider botryoid silk protein. This method for improving silk properties in silkworms by expressing the spider botryoid silk protein gene has been developed. Currently disclosed methods for expressing spider silk protein genes in transgenic silkworms mostly employ similar technical solutions. However, the spidroin gene expression cassette, which is based on the piggyBac transposon, is often integrated into the silkworm genome at TTAA sites, resulting in a high degree of randomness. Furthermore, because the silkworm's native fibroin gene is not replaced by the spidroin gene, the expression level of the spidroin gene is low. Overall, this technical solution is gradually being phased out.
[0006] Zinc-finger nucleases (ZFNs) and transcription activator-like (TAL) effector nucleases (TALENs) have also been explored for the creation of genome-edited silkworms. ZFNs have been used to successfully construct silkworm mutants in which the silk fibroin heavy chain gene is inactivated. Furthermore, it has been shown that the silk fibroin heavy chain of the silkworm is not essential for the cocoon, suggesting the possibility of replacing the silkworm silk fibroin heavy chain gene with a spider silk protein gene to produce chimeric spider-silkworm silk fibers. Using TALEN-mediated targeted homologous recombination repair, a spider silk protein gene expression cassette was successfully used to replace the silkworm silk fibroin heavy chain or light chain gene locus, resulting in the production of spider-silkworm chimeric silk fibers. Due to their cumbersome nature, genome editing systems based on ZFNs and TALENs have been replaced by the CRISPR / Cas system. Using the CRISPR / Cas9 system, an artificial spider silk gene (10 kb) has been inserted into the intron region of the silk fibroin heavy chain gene of the silkworm, Bombyx mori. This has resulted in the production of chimeric silk fibers with properties similar to those of natural spider silk. CRISPR / Cas9-mediated genome editing has replaced the silk fibroin heavy chain gene with the full-length gene for the native spider subampullar gland silk protein (150 kDa), resulting in high-strength and ultra-tough chimeric silk fibers. However, the silkworm strain used for this technique is a polymorphic, non-practical variety with generally poor economic traits (cocoon production, cocoon layer percentage, total cocoon weight, and silk length), making it impractical.
[0007] Methods for introducing foreign genes into silkworms play a crucial role in producing transgenic silkworms. A widely used strategy involves microinjection of newly laid eggs (3-4 hours after laying) from non-diapause silkworms. This method is technically mature and offers high genetic conversion rates. However, the economic traits of non-diapause silkworms are poor, severely impacting the economic value of transgenic silkworms. Currently, commercially available varieties are all bivoltine, diapause-prone varieties. Eggs laid are protected at 24-25 degrees Celsius for approximately 20 hours and then released from diapause by hydrochloric acid treatment. However, microinjection of newly laid eggs from silkworms kills them due to the hydrochloric acid treatment. Therefore, newly laid eggs from commercial varieties obtained by conventional techniques are not suitable for microinjection. Techniques such as pulsed-field electrophoresis, pressure osmosis, electroporation, gene gun injection, sperm-mediated gene transfer, recombinant virus-mediated gene transfer, and gonadal injection have been used in the development of transgenic silkworm varieties. However, due to low efficiency and poor reproducibility, they have not been widely adopted by professionals in the field. Hydrochloric acid treatment of silkworm eggs from practical silkworm varieties 2.5 hours after laying results in high rates of egg mortality and poor hatchability, leading to extremely low transgenic efficiency after microinjection. Low-temperature and combined incubation treatments can relieve diapause in some offspring eggs, but due to their long technical cycles and limited timeliness, these strategies remain unacceptable to most professionals in the field. Therefore, genetically modifying practical silkworm varieties remains a challenge. Summary of the Invention
[0008] The purpose of the present invention is to provide a composite silk fiber containing spider silk protein and a preparation method thereof, which is a method for producing composite silk fibers containing spider silk protein using a practical variety of silkworms and its products, specifically a method for preparing composite silk fibers of spider ampullate silk protein and silkworm silk protein using a practical variety of silkworms based on genome editing and homologous recombination repair.
[0009] In order to achieve the above object, the technical solution adopted by the present invention is: A method for preparing composite silk fibers containing spider silk protein comprises the following steps: (1) The gene targeting vector pUC57-MaSp-c and the plasmid expressing the nuclease were introduced into the first-laid eggs of the practical silkworm, which were then hatched and raised to moths. The eggs were then mated with wild-type practical silkworms to obtain moth-shaped silkworm eggs. (2) Amplify the DNA of the parent moths in the moth circle silkworm eggs and screen for eggs produced by moths carrying the MaSp-c gene; then accelerate the eggs produced by moths carrying the MaSp-c gene to green, hatch, and mate with the moths in the same moth circle to lay eggs; (3) Then, the DNA of the moth obtained in step (2) is amplified, the amplified product is sequenced and verified, and eggs produced by mating of gene-targeted silkworm moths whose male and female parents are both pure lines are selected for succession; (4) The eggs or successive eggs of step (3) are hatched and raised to the upper cocoon to obtain composite silk fibers containing spider silk protein.
[0010] A method for constructing a genome-edited silkworm comprises the following steps: (1) The gene targeting vector pUC57-MaSp-c and the plasmid expressing the nuclease were introduced into the first-laid eggs of the practical silkworm, which were then hatched and raised to moths. The eggs were then mated with wild-type practical silkworms to obtain moth-shaped silkworm eggs. (2) Amplify the DNA of the parent moths in the moth circle silkworm eggs and screen for eggs produced by moths carrying the MaSp-c gene; then accelerate the eggs produced by moths carrying the MaSp-c gene to green, hatch, and mate with the moths in the same moth circle to lay eggs; (3) Then, the DNA of the moth obtained in step (2) is amplified, the amplified product is sequenced and verified, and eggs produced by mating of gene-targeted silkworm moths whose male and female parents are both pure lines are selected for succession; (4) The eggs or successive eggs of step (3) are hatched to obtain genome-edited silkworms.
[0011] A method for constructing genome-edited silkworm eggs, comprising the following steps: (1) The gene targeting vector pUC57-MaSp-c and the plasmid expressing the nuclease were introduced into the first-laid eggs of the practical silkworm, which were then hatched and raised to moths. The eggs were then mated with wild-type practical silkworms to obtain moth-shaped silkworm eggs. (2) Amplify the DNA of the parent moths in the moth circle silkworm eggs and screen for eggs produced by moths carrying the MaSp-c gene; then accelerate the eggs produced by moths carrying the MaSp-c gene to green, hatch, and mate with the moths in the same moth circle to lay eggs; (3) Then, the DNA of the moth obtained in step (2) is amplified, and the amplified product is sequenced and verified. The eggs or successive eggs produced by mating of gene-targeted silkworm moths whose male and female parents are both pure lines are selected as genome-edited silkworm eggs.
[0012] In the present invention, pUC57-MaSp-c uses the sequences flanking the silk fibroin light chain gene as homology arms. An expression cassette encoding the golden web-weaving spider's major ampullate gland silk protein gene sequence, controlled by the silk fibroin light chain gene promoter, and a fluorescent protein gene controlled by the 3×P3 promoter are cloned between the left and right homology arms. Furthermore, an expression cassette for a gRNA targeting the silk fibroin light chain gene, controlled by the Bombyx mori U6 promoter, is cloned downstream of the right homology arm. As an example, the DNA sequence of pUC57-MaSp-c is SEQ ID NO: 1.
[0013] In the present invention, the gene targeting vector pUC57-MaSp-c and the plasmid expressing nuclease are introduced into the first-laid eggs of the practical variety of silkworm treated with corona, and then hatched; or the gene targeting vector pUC57-MaSp-c and the plasmid expressing nuclease are introduced into the first-laid eggs of the practical variety of silkworm, and then corona treated and then hatched.
[0014] Preferably, the temperature of the corona treatment is 24-25° C., the voltage is 10-12 kV, and the time is 3-5 minutes; the newly laid eggs are eggs laid within 8 hours.
[0015] In the present invention, the plasmid expressing the nuclease is a plasmid expressing the Cas12a nuclease.
[0016] In the present invention, the method of introducing the first-time eggs of the practical variety of silkworm is a conventional technique, which can be achieved by conventional injection methods, such as microinjection.
[0017] In the present invention, in step (2), during amplification, the specific primers are a primer pair for amplifying the web spider major ampullate gland silk protein gene, a primer pair for amplifying the fluorescent protein gene, a primer pair for detecting the left insertion site of the exogenous DNA, and a primer pair for detecting the right insertion site of the exogenous DNA; in step (3), during amplification, the specific primer pair is a primer pair for detecting whether the obtained silkworm is a pure line genome-edited silkworm.
[0018] Specifically, the method for preparing composite silk fibers containing spider silk protein, the method for constructing genome-edited silkworms, or the method for constructing genome-edited silkworm eggs disclosed in the present invention comprises the following steps: (1) Construction of gene targeting vector pUC57-MaSp-c; (2) The gene targeting vector pUC57-MaSp-c was mixed with the plasmid piggyCPF1 expressing the Cas12a nuclease, and then introduced into the first-laid eggs of the practical variety of silkworm by injection, followed by corona treatment, or directly introduced into the first-laid eggs of the corona-treated silkworm and then hatched; (3) After the silkworm eggs are hatched, they are raised until they become moths, and then mated with wild domestic species to obtain moth-circled silkworm eggs; (4) Using specific primers to amplify the DNA of the parent moth in the moth circle silkworm eggs and screen for eggs produced by genome-edited silkworm moths; (5) Eggs produced by mating of genome-edited silkworm moths are incubated and then reared normally until they become moths, and then mated and laid eggs in the same moth area; then, specific primers are used to amplify the moth's DNA, and the amplified products are sequenced and verified. Eggs produced by mating of gene-targeted silkworm moths whose male and female parents are pure lines are selected for succession, and the eggs or succession eggs are genome-edited silkworm eggs; (6) After the eggs or successive eggs obtained in step (5) are hatched, the genome-edited silkworms are obtained, and they are conventionally reared to cocoons to obtain spider silkworm composite silk fibers.
[0019] In the above step (2), the plasmid pUC57-MaSp-c and the plasmid piggyCPF1 expressing the nuclease Cas12a are introduced into the eggs of the silkworm moth within 4 hours at 24-25°C by injection, and then corona treatment is performed, or the plasmid pUC57-MaSp-c and the plasmid piggyCPF1 expressing the nuclease Cas12a are introduced into the eggs of the silkworm moth within 4 hours at 24-25°C, protected for 18-20 hours at 24-25°C, and corona treatment is performed for 3-5 minutes at 10-12kV and an inter-pole distance of 8mm; or the plasmid pUC57-MaSp-c and the plasmid piggyCPF1 expressing the nuclease Cas12a are introduced into the eggs of the silkworm moth within 2 ... and corona treatment is performed for 3-5 minutes at 10-12kV and an inter-pole distance of 8mm. mm, corona treatment for 3-5 minutes, and then the pUC57-MaSp-c plasmid and the plasmid piggyCPF1 expressing the nuclease Cas12a were introduced by injection; protection was a conventional technique, for example, the silkworm eggs after the above treatment were protected at 24-25 degrees and 18 hours of light per day until the silkworm eggs turned blue, and then protected in the dark at 24-25 degrees until the day of hatching, and hatched in the early morning of the day of hatching.
[0020] The present invention discloses composite silk fibers containing spider silk protein prepared according to the above-mentioned method for preparing composite silk fibers containing spider silk protein; genome-edited silkworms constructed according to the above-mentioned method for constructing genome-edited silkworms; and genome-edited silkworm eggs constructed according to the above-mentioned method for constructing genome-edited silkworm eggs.
[0021] The present invention discloses the use of the genome-edited silkworm or the genome-edited silkworm egg in preparing composite silk fibers containing spider silk protein, or in preparing composite silk fibers containing spider silk protein with improved mechanical properties.
[0022] The present invention discloses the application of the composite silk fiber containing spider silk protein in improving the mechanical strength of silk fibers.
[0023] The present invention discloses the use of a gene targeting vector pUC57-MaSp-c in preparing composite silk fibers containing spider silk proteins from a practical silkworm variety, or in constructing a genome-editing practical silkworm variety, or in constructing eggs from a genome-editing practical silkworm variety. Specifically, during the application process, newly laid eggs from the practical silkworm variety are subjected to corona treatment.
[0024] Pure-line target silkworms can be used as breeding material and hybridized with existing varieties. Through conventional breeding, silk production and / or disease resistance can be further improved.
[0025] Using practical silkworm varieties as transgenic objects, the above technical solution can obtain genome-edited silkworms in which the MaSp-c gene replaces the silk fibroin light chain gene, and composite silk fibers of spider major ampulla silk protein MaSp-c and silkworm silk fibroin heavy chain protein prepared based on the genome-edited silkworms. Due to the application of the above technical solution, the present invention has the following advantages over the prior art: (1) Directly genetically modifying practical silkworm varieties to improve economic traits: Due to technical bottlenecks, traditional silkworm genetic modification methods mostly target non-diapause silkworms. The economic traits of non-diapause silkworms are extremely poor, which seriously affects the economic value of transgenic silkworms. Non-diapause transgenic silkworms can be hybridized with existing practical varieties and continuously backcrossed to improve economic traits, but it is often difficult to completely overcome the defects of the non-diapause silkworm system in the short term. The application of the technical solution of the present invention can fundamentally solve the defects of non-diapause transgenic silkworms without affecting other excellent traits of practical silkworm varieties, greatly shortening the breeding cycle.
[0026] (2) Improving the content and mechanical properties of spider silk protein in composite silk fibers: Based on piggyBac transposon-mediated transgenesis, the insertion site of the exogenous gene tends to be at the TTAA site of the silkworm genome, which is relatively random. In addition, since the silkworm's own fibroin gene has not been replaced by the spider silk protein gene, the expression level of the spider silk protein gene is low. The composite silk fibers obtained by this technical solution have a low content of spider silk protein (2-5%). In particular, the present invention is different from previous studies that have replaced the silk fibroin heavy chain gene with the spider silk gene. The present invention innovatively replaces the silk fibroin light chain gene with the spider silk gene. In the composite silk fibers produced by the technology of the present invention, the silk fibroin light chain protein of the silkworm is replaced by MaSp-c, thereby significantly improving the content of spider silk protein in the composite silk and the mechanical properties of the composite silk fibers.
[0027] (3) The use of novel CRISPR / Cas12a technology can reduce off-target effects and improve genome editing efficiency: Currently, there are very few research reports on improving the mechanical properties of silk fibers through genome editing and genome repair. There is one article on the use of TALEN-mediated homology-directed repair technology, one article on directional insertion based on CRISPR / Cas9 genome editing, and one article on homology-directed repair based on CRISPR / Cas9 genome editing. Genome editing technology based on TALEN technology has been eliminated due to its cumbersome technology and high off-target rate; CRISPR / Cas9 technology has been gradually replaced by a new generation of technology due to its high off-target frequency. The present invention adopts novel CRISPR / Cas12a technology, and the designed U6-gDNA array element expresses gRNA array that can simultaneously target different regions of a genome, effectively reducing the off-target frequency and improving editing efficiency. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Figure 1 Schematic diagram of the structure and targeting strategy of pUC-MaSp-c in Example 1; the flanking sequence of the silk fibroin light chain gene of Bombyx mori is used as the homology arm, and the codon-optimized full-length golden silk weaving spider large ampulla silk protein MaSp-c gene expression cassette and 3×P3 promoter-controlled DsRed gene expression cassette controlled by the silk fibroin light chain gene promoter are inserted in the middle. A U6 promoter-controlled gDNA array is designed downstream of the homologous right arm, and its transcription product gRNA can target different regions of the silk fibroin light chain genome. After the plasmid is introduced into the silkworm egg, the light chain locus is cut under the action of Cas12a through the CRISPR-Cas12a genome editing system, and the MaSp-c gene expression cassette and the DsRed gene expression cassette replace the light chain locus through homologous recombination.
[0029] Figure 2 This is a schematic diagram of the corona device used in Example 1. Two steel plates (1.5 mm thick) were fixed parallel to an insulator post, with a 2 cm gap between them. A polarizing needle (1.2 cm long, 2 mm diameter) was attached to the underside of the upper plate. During corona treatment, the upper and lower plates were connected to the positive and negative terminals of a power supply, respectively.
[0030] Figure 3 The electrophoresis and sequencing of MaSp-c in 5 G0 generation silk moths in Example 1 are shown in the figure above. The primers are Light-cF and Light-cR. The upper figure shows the electrophoresis of PCR products: lane M, standard molecular weight DNA; lane NC, wild-type silk moths without genetic modification; lanes 1-5, G0 generation G0 1 、G0 2 、G0 3 、G0 4 、G0 5 The figure below shows the sequencing of the PCR product, which is a partial sequence of the MaSp-c gene.
[0031] Figure 4 This is an electropherogram of PCR analysis of gene-targeted silkworms in Example 1. Lane M, DNA marker; Lane NC, untransgenic wild-type Suhao silkworms; Lanes 1 and 2, PCR amplification products from G0-generation female and G1-generation male silkworms from the same cohort using the LF and LR primer pairs, respectively. The product has a molecular weight of 2455 bp.
[0032] Figure 5PCR identification of the gene-targeted silkworms in Example 1 and sequencing verification of the PCR products. Top: Electrophoresis of the PCR products. Lane Marker: DNA marker; Lane NC: untreated control; Lanes 1 and 2: PCR amplification of DNA from G0 generation female and G1 generation male silkworms from the same moth cohort using the LF and LR primer pairs, respectively. The amplified product served as a template for further amplification using the L-2-F and L-2-R primers, respectively. The molecular weight of the PCR product was 672 bp. Bottom: Sequencing of the PCR product.
[0033] Figure 6 Western blot analysis of MaSp-c in the silk fibroin protein from Example 1. Lane M, protein marker; Lane NC, normal Soho silk fibroin; Lane GMO, genome-edited silk fibroin. Primary antibodies were MaSp-c and P25 antibodies (rabbit anti-1:1000), and secondary antibodies were HRP-conjugated goat anti-mouse IgG (1:5000).
[0034] Figure 7 These are the stress-strain curves of genome-edited silk and control group silk.
[0035] Figure 8 The electrophoresis diagram of the DsRed gene detected by PCR in four G0 generation silkworms and the sequencing diagram of the PCR products in Example 2 are shown. The primers are DsRed-F and DsRed-R. The upper figure is the electrophoresis diagram of the PCR products. Lane M, standard molecular weight DNA; Lane NC, wild-type silkworm moths from Zhong Ye that have not been genetically modified; Lanes 1-4, G0 generation G0 1 、G0 2 、G0 3 、G0 4 The figure below shows the sequencing of the PCR product, which is a partial sequence of the DsRed gene.
[0036] Figure 9PCR detection of 2 G1 silk moth DNAs in Example 2 and sequencing diagram of PCR products. The DNA of the G1 generation silk moth was PCR amplified using LF and LR primer pairs, and a PCR product of 2455bp was recovered and used as a template. PCR was performed using CF and CR primer pairs, and the PCR product was electrophoresed on 1% agarose gel to recover a 1457bp band for sequencing verification. The upper figure is an electrophoresis diagram of the 1457bp PCR product. Lane M: DNA Marker; Lane NC, non-transgenic Zhong Ye silkworm; Lanes 1 and 2, respectively, PCR amplification of the DNA of the G1 generation female and male silk moths of the same moth circle of the G0 generation using LF and LR primer pairs, using the amplified product as a template, and then amplified using CF and CR primer pairs, respectively. The molecular weight of the PCR product is 1457bp. The lower figure is a sequencing diagram of the PCR product, which is the 3' end of the left homology arm and a partial sequence of the silk fibroin light chain promoter.
[0037] Figure 10 In Example 2, PCR was used to detect the upstream sequence of the insertion site of the left homologous arm. The DNA of the G1 generation silk moth was amplified by PCR using the LF and LR primer pairs, and a PCR product of 2455bp was recovered and used as a template. PCR was performed using the LF and LeftK-R primer pairs to amplify a specific band of 416bp. The sequencing results showed that the band was the homologous left arm targeting site and its upstream genomic sequence. The upper figure is an electrophoresis detection diagram of the PCR product using the LF and LeftK-R primer pairs. Lane Marker, DNA Marker; Lane NC, non-transgenic Zhong Ye silkworm; Lanes 1 and 2, respectively, were PCR amplified using the LF and LR primer pairs from the same moth circle of the G0 generation and the G1 generation female and male silk moths. The amplified product was used as a template and then amplified using the LF and LeftK-R primer pairs. The molecular weight of the PCR product was 416bp. The lower figure is a sequencing diagram of the 416bp PCR product. DETAILED DESCRIPTION
[0038] Transgenic silkworms are the most direct and effective means of improving and innovating silkworm varieties using molecular targets. However, establishing an efficient method for releasing diapause in silkworm eggs, suitable for transgene microinjection, remains a key technical challenge. Currently, hydrochloric acid treatment of silkworm eggs 2.5 hours after laying results in high mortality rates, poor hatchability, and extremely low transgenic efficiency after microinjection. Low-temperature and combined accelerator treatments can release diapause in some offspring eggs, but due to their lengthy technical cycles and limited timeliness, these strategies remain unacceptable to most professionals in the field.
[0039] The present invention relates to a method for producing composite silk fibers containing spider silk proteins using a practical variety of silkworms, specifically a method for producing composite silk fibers containing spider major ampulla silk protein MaSp-c and silkworm silk protein using a practical variety of silkworms based on genome editing and homologous repair technology. At 24-25°C, eggs laid by a practical variety of silk moths within 2 hours are treated with a 10-12kV continuous corona for 3-5 minutes, and then injected with a pUC57-MaSp-c plasmid and a plasmid expressing the nuclease Cas12a, pCase12a; or eggs laid within 4 hours are injected with a pUC57-MaSp-c plasmid and a plasmid expressing the nuclease Cas12a, protected at 24-25°C for 18-20 hours, and treated with a 10-12kV continuous electric shock for 3-5 minutes. After the eggs hatch, they are reared and subcultured, and through molecular biological screening and identification, a genome-edited silkworm is obtained in which the expression cassette of the spider major ampulla silk protein MaSp-c gene sequence replaces the expression cassette of the silk fibroin light chain gene. After the genome-edited silkworms are reared and cocooned, conventional reeling is performed to produce composite silk containing the golden web spider's major ampullate gland silk protein. This method can produce silk containing the golden web spider's major ampullate gland silk protein MaSp-c, which can be used to manufacture various textile silk products and biomaterials requiring diverse silk proteins. The resulting genome-edited silkworms can also be used to breed new silkworm varieties through conventional crossbreeding.
[0040] The present invention discloses a method for producing composite silk fibers containing spider silk protein using a practical variety of silkworms, comprising the following steps: (1) Construction of gene targeting vector pUC57-MaSp-c; (2) The gene targeting vector pUC57-MaSp-c was mixed with the plasmid piggyCPF1 expressing the Cas12a nuclease, and then introduced into the first-laid eggs of the practical silkworm species by injection, followed by corona treatment, or directly introduced into the first-laid eggs of the corona-treated silkworm and then hatched. Preferably, the plasmid expressing Cas12a nuclease is the plasmid piggyCPF1 expressing Cas12a nuclease (see CN202310944134.8); the preferred practical silkworm varieties can be Suhao, Zhong 2016, Zhong Ye, Ri 2016, Jingsong, Haoyue, etc.; preferably, at 24-25°C, the eggs laid by the practical variety silk moth within 4 hours are introduced by injection with pUC57-MaSp-c plasmid and plasmid piggyCPF1 expressing nuclease Cas12a, protected at 24-25°C for 18-20 hours, with 10-12kV and an inter-pole distance of 8mm, and continuously corona treated for 3-5 minutes; or at 24-25°C, the egg circle laid by the practical variety silk moth within 2 hours is treated with 10-12kV and an inter-pole distance of 8 mm, corona treatment for 3-5 minutes, and then the pUC57-MaSp-c plasmid and the piggyCPF1 plasmid expressing the nuclease Cas12a were introduced by injection; the silkworm eggs after the above treatment were protected at 24-25℃ until hatching; (3) After the silkworm eggs hatch, they are raised until they become moths, and the male and female mate to obtain the moth-shaped silkworm eggs; (4) using specific primers to amplify the DNA of the parent moth in the moth circle silkworm eggs and screen the eggs produced by the gene-targeted silkworm moths; (5) Eggs produced by mating of gene-targeted silkworm moths whose parents are gene-targeted are incubated and then reared normally until they become moths, and then mate and lay eggs in the same moth area; then, specific primers are used to amplify the moth's DNA, and the amplified products are sequenced and verified, and eggs produced by mating of gene-targeted silkworm moths whose male and female parents are pure lines are selected for succession; (6) After the eggs obtained in step (5) are hatched, they are reared in a conventional manner until they are placed on a cocoon, thereby obtaining spider-silkworm composite silk fibers.
[0041] The composite silk fibers containing spider silk protein prepared by the present invention are spider-silkworm composite silk fibers, preferably composite silk fibers of spider major ampulla silk protein MaSp-c (GenBank accession number: PRD18936.1) and silkworm fibroin heavy chain protein; the spider silk protein can also be minor ampulla silk protein.
[0042] In the present invention, the constructed gene targeting vector pUC57-MaSp-c has the following characteristics: the flanking sequence of the silk fibroin light chain gene is used as the homology arm, and the gene sequence expression cassette encoding the golden silk weaving spider major ampulla gland silk protein (MaSp-c) controlled by the silk fibroin light chain gene promoter (preferably using Bombyx mori sericin) is expressed. serA fluorescent protein gene (preferably a red fluorescent protein (DsRed) gene) controlled by the 3×P3 promoter (GenBank accession number: AB299446.1) is cloned between the left and right homology arms. A gRNA expression cassette targeting the silk fibroin light chain gene, controlled by the Bombyx mori U6 promoter, is cloned downstream of the right homology arm. Preferably, the DNA sequence of the constructed gene targeting vector pUC57-MaSp-c is SEQ ID NO: 1.
[0043] In SEQ ID NO: 1, in the pUC57-MaSp-c plasmid, 1 to 431 nt is the pUC vector backbone sequence; 432-2015 nt is the left arm (containing the silk fibroin light chain gene promoter), 2016-2066 nt is the signal peptide sequence of the silk fibroin light chain gene, which is preferably a sequence optimized according to the Bombyx mori codon; 2067-4730 nt is the codon-optimized MaSp-c gene (excluding the 81 nt at the 5' end of the MaSp-c gene (encoding the MaSp-c signal peptide) and the 337 nt tailing signal of Ser3). nt 3731-4981 represents the 3×P3 promoter, nt 5017-5697 represents the DsRed gene coding sequence, nt 5706-5938 represents the SV40 polyadenylation signal (GenBank accession number: MH541846.1), nt 5939-7740 represents the homologous right arm sequence, nt 7741-8202 represents the U6 promoter sequence, nt 8203-8529 represents the gDNA array targeting the silk light chain genomic sequence, TCACTGTATTGATTGATGGTC and AGAAACTGTAATCGAATTGAA represent the template strand targeting site sequences, and TGCAAGTCAAGCATCAGCGGT, TCAATCAACTCGTCATCAACC, and GCCAGCAGTGACTCTAGGTAA represent the sense strand targeting site sequences, and nt 8530-10808 represents the pUC vector backbone sequence.
[0044] The sequence of SEQ ID NO: 1 can be fully chemically synthesized or a combination of chemical synthesis and PCR amplification, specifically conventional techniques. Preferably, the length of the left and right homologous arms is greater than 1 kb, and the lengths of the left and right homologous arms can be the lengths indicated in SEQ ID NO: 1. The 3×P3 promoter sequence can also be replaced with other promoters active in Bombyx mori, such as the actin A3 promoter or the immediate early promoter of baculovirus. The red fluorescent protein (DsRed) gene can also be replaced with other fluorescent protein genes, such as the green fluorescent protein (GFP) gene. The aforementioned tailing signal can also be the tailing signal of other genes. Vectors other than pUC can also be used as the backbone sequence of the vector pUC57-MaSp-c, such as the pBlueScript SK vector.
[0045] In the present invention, the gene targeting vector pUC57-MaSp-c is mixed with the plasmid piggyCPF1, which expresses the Cas12a nuclease, and then injected into eggs of a practical silkworm species. The DNA sequence of the plasmid piggyCPF1 is the same as that shown in the applicant's previous invention patent (application number 202310944134.8). The Bombyx mori actin A3 promoter in this sequence, which controls Cas12a expression, can be replaced with other promoters active in Bombyx mori, such as the baculovirus immediate early promoter. In this protocol, the plasmid piggyCPF1, which expresses the Cas12a nuclease, can be directly replaced with commercially available recombinant Cas12a protein or in vitro-transcribed Cas12a mRNA.
[0046] In the present invention, the silkworm eggs selected are eggs of practical varieties. The gene targeting vector pUC57-MaSp-c in the present invention can also be used to inject newly laid eggs of polyvoltine non-diapause silkworms (silkworm eggs that have just been laid and protected at room temperature for 2 to 8 hours).
[0047] In the present invention, in step (4), the specific primers are a primer pair for amplifying the web spider's major ampulla silk protein MaSp-c gene, a primer pair for amplifying the fluorescent protein gene, and a primer pair for detecting the left insertion site of the exogenous DNA. Preferably, the specific primers are the primer pair Light-cF and Light-cR for amplifying a partial sequence (406 bp) of the web spider's major ampulla silk protein MaSp-c gene, whose sequences correspond to SEQ ID NO: 2 and SEQ ID NO: 3; the primer pair DsRed-F and dsRed-R for amplifying a partial sequence (360 bp) of the fluorescent protein gene, whose sequences correspond to SEQ ID NO: 4 and SEQ ID NO: 5. The primer pair CF and CR for amplifying a partial left arm and a partial MaSp-c sequence (1457 bp) corresponds to SEQ ID NO: 6 and SEQ ID NO: 7. The primer pair for amplifying the sequence upstream of the left homologous arm (upstream of the left integration site) to the 5'-end of MaSp-c (2455 bp) was LF and LR, whose sequences correspond to SEQ ID NO: 8 and SEQ ID NO: 9; the primer pair for amplifying the light chain promoter and partial sequence of the MaSp-c gene (672 bp) was L-2-F and L-2-R, whose sequences correspond to SEQ ID NO: 10 and SEQ ID NO: 11; and the primer pair for amplifying the sequence upstream of the left homologous arm (upstream of the left integration site) to the partial sequence of the left homologous arm (416 bp) was LF and LeftK-R, whose sequences correspond to SEQ ID NO: 8 and SEQ ID NO: 12.
[0048] For example, the Light-cF and Light-cR primer pairs specifically amplified a 406bp sequence, indicating that a specific band representing the MaSp-c fragment was detected in the genomic DNA. The DsRed-F and dsRed-R primer pairs specifically amplified a 306bp sequence, indicating that a specific band representing the DsRed gene fragment was detected in the genomic DNA. When the 2455bp PCR product of the LF and LR primer pairs was used as a template, amplification with the CF and CR primer pairs, or the L-2-F and L-2-R primer pairs, amplified specific bands of 1457bp and 672bp, respectively, indicating that the left side of the expression cassette for the spider silk protein MaSp-c gene has been integrated into the Bombyx mori genome as designed. The offspring of the parent silkworm moth whose PCR amplification results met the above characteristics are the moth eggs required by the present invention. To further confirm the accuracy of the PCR products, the PCR products were cloned into a vector and Sanger sequencing was performed for verification.
[0049] In addition to the above identification methods, other specific primers can be designed based on the theoretical target region and the theoretical sequence of the exogenous DNA fragment integrated into the silkworm genome. PCR amplification and Sanger sequencing of the product can be performed. If the DsRed gene in pUC-MaSp-c is replaced with the GFP gene, a specific band representing the GFP gene fragment will be screened out. If the 3×P3 promoter in pUC-MaSp-c is replaced with the baculovirus immediate early promoter, a specific band representing the immediate early promoter will be screened out.
[0050] In the present invention, in step (5), the specific primer pair is a primer pair for detecting whether the obtained silkworm is a pure line genome-edited silkworm. Specifically, the specific primer PCR is used to detect the silkworm DNA, and the PCR product is verified by Sanger sequencing. The eggs produced by the mating of the genome-edited silkworm moth whose parents are genome-edited are retained. After being accelerated to green, they are raised normally. After they have emerged as moths, they are mated in the same moth area. Then, PCR detection is performed, and the PCR product is Sanger sequencing to identify the corresponding silkworm moth. The eggs produced by the mating of the genome-edited silkworm moth whose male and female parents are both pure lines are selected for succession. Specific primers FIBL-F and FIBL-R are designed, and their sequences are SEQ ID NO: 13 and SEQ ID NO: 14, respectively. PCR detection and Sanger sequencing are performed on the offspring of the mating in the same moth area. If a specific band of 567 bp can be amplified, the detected object is a non-pure line targeted silkworm; if a specific band of 567 bp cannot be amplified, the detected object is a pure line targeted silkworm. Because the silk light chain gene base of pure gene-edited silkworms is replaced by exogenous gene expression or the silk light chain gene is no longer expressed, other primers can be designed based on the silk light chain gene sequence for PCR and RT-qPCR verification; Western blot can also be used to detect whether silk light chain protein is expressed for verification; it can also be verified by whole genome sequencing.
[0051] In the present invention, in step (6), after the silkworm eggs obtained in step (5) are hatched, they are conventionally raised to mature silkworms, moved to a cocoon brooder, cocooned, harvested, and reeled to obtain composite silk containing spider major ampullate silk protein MaSp-c. Measurements show that the average elongation at break, average breaking strength, Young's modulus, and breaking potential of the obtained composite silk are significantly improved. Mechanical properties are significantly improved.
[0052] The specific methods involved in the present invention are conventional, including cloning, PCR, Western blot, silkworm egg injection, incubation, rearing to pupation, and silk reeling. The testing methods involved are also conventional techniques. Except for the designed sequences and vectors, all raw materials and reagents involved are conventional products. The practical varieties of silkworm moth (cultivars: Suhao and Zhongye) are commonly used in current silkworm production and possess the general characteristics of silkworms. The present invention is further described below with reference to the accompanying figures and examples.
[0053] Example 1: Gene-edited silkworms with MaSp-c gene replacing silk fibroin light chain gene and spider-silkworm composite silk fibers containing MaSp-c were prepared using the practical variety Suhao silkworm as the transgenic object. (1) Construction of pUC-MaSp-c plasmid: The sequence of SEQ ID NO: 1 was synthesized by conventional methods. The synthesis process was conventional technology. The structure of the pUC-MaSp-c plasmid and the technical principle of the present invention are as follows Figure 1 As shown in the figure, the flanking sequences of the silk fibroin light chain gene of Bombyx mori serve as homology arms, with a codon-optimized full-length golden web-weaving spider major ampullate gland silk protein MaSp-c gene expression cassette controlled by the silk gene promoter and a DsRed gene expression cassette controlled by the 3×P3 promoter inserted in the middle. A gDNA array controlled by the U6 promoter is inserted downstream of the right homology arm, and its transcribed gRNA can target different regions of the silk fibroin light chain gene.
[0054] After the plasmid is mixed with the cas12a expression plasmid and introduced into silkworm eggs, the expressed Cas12a cuts the silk light chain gene locus through the CRISPR-Cas12a genome editing system, and further replaces the silk light chain gene locus with the MaSp-c expression cassette and the DsRed gene expression cassette through homologous recombination; (2) Construction of plasmid piggyCPF1 expressing Cas12a nuclease: constructed according to the technical solution previously disclosed by the applicant (Example 8 of application No. CN202310944134.8), which is a conventional technology; (3) Silkworm egg corona treatment: At 24-25℃, silkworm eggs of the practical species Bombyx mori (species: Soho, wild type) laid within 2 hours are corona treated. The corona device and related parameters are as follows: Figure 2 As shown, two steel plates (1.5 mm thick) are fixed parallel to an insulator column, with a spacing of 2 cm between them. A polarizing needle (1.2 cm long, 2 mm diameter) is fixed to the underside of the upper plate. During corona treatment, the upper and lower plates are connected to the positive and negative terminals of a power supply, respectively. During corona treatment, a 1.5 cm diameter egg ring is placed directly below the polarizing needle and corona treated at 11 kV for 4 minutes. (4) Microinjection: A mixture of pUC-MaSp-c and piggyCPF1 was microinjected, with 10 nL injected into each egg (pUC-MaSp-c: 30 ng; piggyCPF1: 10 ng), for a total of 883 silkworm eggs; the solvent was sterile deionized water; (5) Acceleration, breeding and seed production: Silkworm eggs were accelerated at 24-25℃, with a hatching rate of 9.27%. The silkworms were reared conventionally until they formed cocoons, pupa and moths, and a total of 11 moths were obtained. They were mated with wild-type Suhao silkworms and a total of 5 G1 generation moth circle silkworm eggs were obtained (named: G1 1 、G1 2 、G1 3 、G1 4 、G1 5 ), whose parents are G0 generation silkworm moths (named G0 1 、G0 2 、G0 3 、G0 4 、G0 5 ); (6) Extraction of silkworm genomic DNA: Extract G0 with phenol and chloroform 1 、G0 2 、G0 3 、G0 4 、G0 5 DNA of parent moths from five moth circles was used and the DNA concentration was adjusted to 1 μg / μL; (7) PCR detection of MaSp-c: Using the DNA from step (6) as a template, PCR amplification was performed using the Light-cF and Light-cR primer pairs. The amplification conditions were: pre-denaturation at 95°C for 5 minutes, denaturation at 95°C for 50 seconds, annealing at 55°C for 50 seconds, extension at 72°C for 30 seconds, 35 cycles of amplification, and then incubation at 72°C for 10 minutes. The PCR products were electrophoresed on a 1% agarose gel. The results were as follows: Figure 3 As shown, a specific band (406 bp) representing MaSp-c was detected in the DNA of three silk moths, and sequencing results of the PCR products confirmed that the fragment was a partial sequence of MaSp-c; (8) Preparation of G1 generation and PCR detection: The moths that showed positive MaSp-c in the parent were detected by PCR. After hatching, they were raised normally until they formed cocoons, pupated and emerged as moths. Male and female moths in the same moth area mated and laid eggs to obtain G2 generation silkworm eggs. The male and female moths of the parents were preserved, i.e., G1 generation silkworms. DNA of G1 generation silkworms was extracted and PCR amplified using LF and LR primers. The amplification conditions were pre-denaturation at 95℃ for 5 minutes, denaturation at 95℃ for 50 seconds, annealing at 55℃ for 50 seconds, extension at 72℃ for 2.5 minutes, and amplification for 35 cycles. Then, the PCR products were electrophoresed on 1% agarose gel. The results were as follows: Figure 4 The PCR product (2455 bp) was recovered and used as a template for PCR with the primer pair L-2-F and L-2-R. The amplification conditions were pre-denaturation at 95°C for 5 minutes, followed by denaturation at 95°C for 50 seconds, annealing at 55°C for 50 seconds, and extension at 72°C for 40 seconds for 35 cycles. The amplification was then incubated at 72°C for 10 minutes. The PCR product was electrophoresed on a 1% agarose gel, and a 672 bp band was recovered. Sequencing confirmed that the sequence was a partial sequence of the MaSp-c gene controlled by the silk fibroin light chain promoter ( Figure 5 ); (9) Preparation of pure lines of genome-edited silkworms and PCR detection: After the G2 generation silkworm eggs corresponding to the two parental silkworm moths of the G1 generation tested positive for DNA, they were incubated and raised normally until they formed cocoons, pupated, and emerged as moths. The male and female moths in the same moth area mated and laid eggs to obtain G3 generation silkworm eggs, and their parental male and female moths, i.e., G2 generation silkworm moths, were preserved. Similarly, G4 and G5 generation silkworm eggs and the corresponding G3 and G4 generation silkworm moths were obtained in turn. DNA of the parental male and female moths preserved in each generation was tested. If the male and female parental DNA can amplify specific bands (406 bp) using Light-cF and Light-cR primers, and the 567 bp representative of the fibroin light chain gene partial sequence fragment cannot be amplified using FIBL-F and FIBL-R primers, it indicates that the offspring corresponding to the parental moths are pure lines of genome-edited silkworms.
[0055] The scheme for identifying and screening transgenic silkworms of the present invention is to first identify whether the MaSp-c gene is present in the silkworm genome, then identify whether the MaSp-c gene has replaced the silk light chain gene locus of the silkworm as designed, and finally identify whether the obtained genome-edited silkworm is a pure line: that is, the silk light chain genes of the silkworm on the two homologous chromosomes are both replaced by the MaSp-c gene.
[0056] (10) Detection of MaSp-c in genome-edited silkworm cocoons: Gene-edited silkworm cocoons (obtained from G5 generation silkworm eggs hatched and reared conventionally) were degummed with 0.5% sodium bicarbonate as usual, dissolved in a ternary solution (calcium chloride: ethanol: water = 1:2:8) at 65°C for 30 minutes, centrifuged at 8000 rpm for 10 minutes, and the supernatant was dialyzed with deionized water for 72 hours. The dialyzed solution was centrifuged at 8000 rpm for 10 minutes, and the supernatant (silk fibroin solution) was collected. After SDS-PAGE separation, Western blotting was performed using MaSp-c antibodies and P25 antibodies. Specific signal bands of P25 (25 kDa) and MaSp-C (56 kDa) that were consistent with the theoretical molecular weight were detected simultaneously, while no specific signal of MaSp-c was detected in the control silkworm (wild Suhao variety silkworm). Figure 6 ), demonstrating that the expressed MaSp-g enters the cocoon to form composite silk.
[0057] (11) Preparation of spider silk protein MaSp-c and Bombyx mori silk protein composite silk fibers: Genome-edited pure lines of Bombyx mori were raised as usual until they matured, and the mature silkworms were moved to a cocoon maker and cocooned at 25°C. The cocoons were harvested after 7 days. The cocoons were dried and stored. Before reeling, the dried cocoons were degummed and reeled to obtain spider silk protein MaSp-c-Bombyx mori silk protein composite silk fibers.
[0058] (12) Mechanical properties test of composite silk fibers of spider silk protein MaSp-c and silkworm silk protein: Ten G5 generation silk cocoons were randomly selected and degummed, and then the single fiber mechanical properties were tested. The results showed that the average maximum stress of silkworm-spider chimeric silk fibers was 692.18 MPa, which was 71.33% higher than that of the non-transgenic control group, and the average maximum elastic strain was 28.71%, which was 16.71% higher than that of the control group ( Figure 7 The diameter of the composite fiber is 10.06 μm, the Young's modulus is 9.10 GPa, and the breaking potential energy is 134.63 MJ / m 3 , compared with the non-GMO control group, they decreased by 20.72%, increased by 49.18%, and rose by 105.01%, respectively.
[0059] Brief description of the preparation of silk from the non-transgenic control group: Wild-type Suhao silkworms mated and laid eggs, which were then hatched by conventional incubation and reared normally until they spun cocoons, pupated, and emerged as moths. Cocoons were selected for single fiber mechanical properties testing and served as a parallel control group.
[0060] Compared with the applicant's previous method of preparing spider silkworm composite silk fibers by gene-targeting silkworms, the average maximum stress of the present invention is significantly improved. In particular, the previous method replaced the silk fibroin heavy chain gene of the silkworm with spider silk MaSp-g, and the variety was not practical. The present invention adopts a new technical idea and replaces the silk fibroin light chain gene with the spider silk Masp-c gene, and the variety is practical. The present invention solves the problem that the existing technology cannot or is difficult to produce and apply.
[0061] Example 2: Gene-edited silkworms with the MaSp-c gene replacing the silk fibroin light chain gene were prepared using the practical variety Zhongye silkworm as the transgenic target. (1) Construction of pUC-MaSp-c plasmid: same as step (1) in Example 1; (2) Construction of plasmid piggyCPF1 expressing Cas12a nuclease: same as step (2) of Example 1; (3) Microinjection and corona treatment of silkworm eggs: At 24-25°C, eggs laid by the practical variety Zhongye silkworm within 4 hours were microinjected with the pUC57-MaSp-c plasmid and the plasmid piggyCPF1 expressing the nuclease Cas12a. The eggs were protected at 24-25°C for 18-20 hours, and then corona treated for 4 minutes at 12 kV and an 8 mm inter-electrode distance. The treated silkworm eggs were protected at 24-25°C until hatching; the corona treatment was carried out according to step (3) of Example 1, and the microinjection was carried out according to step (4) of Example 1. (4) Accelerating the growth of silkworms, raising them, and producing seeds: referring to step (5) of Example 1, wild-type Zhongye silkworm moths were selected for mating, and a total of 4 G1 generation silkworm eggs were obtained; (5) Extraction of silkworm moth genomic DNA: refer to step (6) of Example 1; (6) PCR detection of DsRed: Using the DNA from step (5) as a template, PCR amplification was performed using the primer pair DsRed-F and DsRed-R. The amplification conditions were: pre-denaturation at 95°C for 5 minutes, denaturation at 95°C for 50 seconds, annealing at 55°C for 50 seconds, extension at 72°C for 30 seconds, 35 cycles of amplification, and then incubation at 72°C for 10 minutes. The PCR product was electrophoresed on a 1% agarose gel. The results were as follows: Figure 8 As shown in the figure, a specific band (306 bp) representing DsRed was detected in the DNA of three silk moths, and sequencing results of the PCR products confirmed that the fragment was a partial sequence of DsRed; (7) Preparation of G1 generation and PCR detection: Moths whose parental DsRed is positive by PCR detection are hatched and reared normally until they form cocoons, pupate, and emerge as moths. Male and female moths in the same moth area mate and lay eggs to obtain G2 generation silkworm eggs. The parental male and female moths, i.e., G1 generation silkworms, are preserved. DNA of G1 generation silkworms is extracted and PCR amplified using the LF and LR primer pairs. PCR amplification and electrophoresis detection are performed according to the conditions of step (8) of Example 1. The PCR product (2455 bp) was recovered and used as a template for PCR with the CF and CR primer pairs. The amplification conditions were pre-denaturation at 95°C for 5 minutes, followed by denaturation at 95°C for 50 seconds, annealing at 55°C for 50 seconds, and extension at 72°C for 1.5 minutes for 35 cycles. Subsequently, the product was incubated at 72°C for 10 minutes. The PCR product was electrophoresed on a 1% agarose gel, and a 1457 bp band was recovered. Sequencing verification confirmed that the sequence was the 3' end of the left homology arm and a partial sequence of the silk light chain promoter ( Figure 9 ); Using the recovered 2455bp PCR product as a template, PCR was performed using the LF and LeftK-R primer pairs, which amplified a 416bp specific band. Sequencing results showed that the band was the homologous left arm target site and its upstream genomic sequence ( Figure 10 ); (8) Preparation of pure lines of genome-edited silkworms and PCR detection: refer to step (9) of Example 1; (9) Detection of MaSp-c in genome-edited silkworm cocoons: refer to step (10) of Example 1; (10) Preparation of spider silk protein MaSp-c silk protein composite silk fibers: refer to step (11) of Example 1.
[0062] The specific sequences used in the present invention are as follows.
[0063] SEQ ID NO: 1 >pUC57-MaSp-c SEQ ID NO: 2(Light-c-F) TCAATCGAAGCTCCAGGCT SEQ ID NO: 3(Light-c-R) TCTTCCAGCACCCTGGTTTC SEQ ID NO: 4(DsRed-F) CTCGCCCGGGGATCTAATTC SEQ ID NO: 5(DsRed-R) CTCGATCTCGAACTCGTGGC SEQ ID NO: 6(C-F) CTCAACTTTCCCGAGACGCT SEQ ID NO: 7(C-R) CGGCAGCGATTTCAGCCATT SEQ ID NO: 8(L-F) AAACTAGCTGTACCCGTCCG SEQ ID NO: 9(L-R) GGCTTCATTGAGGAAAGCGT SEQ ID NO: 10(L-2-F) AGTGGGCAACTTCATTCTGT SEQ ID NO: 11(L-2-R) GGCTTCATTGAGGAAAGCGT SEQ ID NO:12 (LeftK-R) CTTCAACTCATACCCCAGCC SEQ ID NO: 13(FIBL-F) AGGAAGGCCGTGATCCAATG SEQ ID NO: 14(FIBL-R) AGTTAAGGACGGGGAGACGA The present invention provides a method for producing composite silk fibers of spider ampulla silk protein MaSp-c and Bombyx mori silk protein using a practical silkworm variety based on genome editing and homologous repair technology. At 24-25 degrees Celsius, eggs laid by a practical silk moth within 2 hours are treated with a 10-12kV continuous corona for 3-5 minutes, and then injected with a pUC57-MaSp-c plasmid and a plasmid expressing the nuclease Cas12a, pCase12a. Alternatively, eggs laid within 4 hours are injected with a pUC57-MaSp-c plasmid and a plasmid expressing the nuclease Cas12a, protected at 24-25 degrees Celsius for 18-20 hours, and treated with a 10-12kV continuous electric shock for 3-5 minutes. After hatching, the eggs are reared and subcultured, and through molecular biological screening and identification, a genome-edited silkworm is obtained in which the expression cassette of the spider ampulla silk protein MaSp-c gene sequence replaces the Bombyx mori silk fibroin light chain gene expression cassette. After the genome-edited silkworms are reared and cocooned, conventional reeling is performed to produce composite silk containing the golden web spider's major ampullate gland silk protein. This method can produce silk containing the golden web spider's major ampullate gland silk protein MaSp-c, which can be used to manufacture various textile silk products and biomaterials requiring diverse silk proteins. The resulting genome-edited silkworms can also be used to breed new silkworm varieties through conventional crossbreeding.
Claims
1. A method for preparing composite silk fibers containing spider silk protein, characterized in that: The following steps are involved: (1) Introducing the gene targeting vector pUC57-MaSp-c and the plasmid expressing the nuclease into the first-laid eggs of the practical silkworm species, which are then hatched and raised until they become moths, and then mated with wild-type practical silkworm species to obtain moth-shaped silkworm eggs; (2) Amplifying the DNA of the parent moths in the moth circle silkworm eggs, and screening for eggs laid by silkworm moths carrying the MaSp-c gene; then accelerating the eggs laid by silkworm moths carrying the MaSp-c gene to green, and then mating and laying eggs in the same moth circle; (3) Then, the DNA of the moth in step (2) is amplified, and the amplified product is sequenced and verified, and the eggs produced by the mating of the gene-targeted silkworm moths whose male and female parents are both pure lines are selected for succession; (4) The eggs or successive eggs of step (3) are incubated and raised to cocoons to obtain composite silk fibers containing spider silk protein.
2. A method for constructing a genome-edited silkworm, characterized in that: The following steps are involved: (1) Introducing the gene targeting vector pUC57-MaSp-c and the plasmid expressing the nuclease into the first-laid eggs of the practical silkworm species, which are then hatched and raised until they become moths, and then mated with wild-type practical silkworm species to obtain moth-shaped silkworm eggs; (2) Amplifying the DNA of the parent moths in the moth circle silkworm eggs, and screening for eggs laid by silkworm moths carrying the MaSp-c gene; then accelerating the eggs laid by silkworm moths carrying the MaSp-c gene to green, and then mating and laying eggs in the same moth circle; (3) Then, the DNA of the moth in step (2) is amplified, and the amplified product is sequenced and verified, and the eggs produced by the mating of the gene-targeted silkworm moths whose male and female parents are both pure lines are selected for succession; (4) The eggs or successive eggs of step (3) are hatched to obtain genome-edited silkworms.
3. A method for constructing genome-edited silkworm eggs, characterized in that: The following steps are involved: (1) Introducing the gene targeting vector pUC57-MaSp-c and the plasmid expressing the nuclease into the first-laid eggs of the practical silkworm species, which are then hatched and raised until they become moths, and then mated with wild-type practical silkworm species to obtain moth-shaped silkworm eggs; (2) Amplifying the DNA of the parent moths in the moth circle silkworm eggs, and screening for eggs laid by silkworm moths carrying the MaSp-c gene; then accelerating the eggs laid by silkworm moths carrying the MaSp-c gene to green, and then mating and laying eggs in the same moth circle; (3) Then, the DNA of the moth obtained in step (2) is amplified, and the amplified product is sequenced and verified. The eggs or successive eggs produced by mating of gene-targeted silkworm moths whose male and female parents are both pure lines are selected as genome-edited silkworm eggs.
4. The method according to claim 1, claim 2 or claim 3, characterized in that: pUC57-MaSp-c uses the flanking sequences of the silk light chain gene as homology arms, and clones the gene sequence expression cassette encoding the golden silk-weaving spider large ampullate gland silk protein controlled by the silk light chain gene promoter and the fluorescent protein gene controlled by the 3×P3 promoter between the left and right homology arms, and clones the gRNA expression cassette targeting the silk light chain gene controlled by the silkworm U6 promoter downstream of the right homology arm.
5. The method according to claim 1, claim 2 or claim 3, characterized in that: The gene targeting vector pUC57-MaSp-c and the plasmid expressing the nuclease are introduced into the first laid eggs of the practical variety of silkworm treated with corona, and then hatched; or the gene targeting vector pUC57-MaSp-c and the plasmid expressing the nuclease are introduced into the first laid eggs of the practical variety of silkworm, and then corona treated and then hatched.
6. The method according to claim 1, claim 2 or claim 3, characterized in that: In step (2), during amplification, the specific primers are a primer pair for amplifying the web spider major ampullate gland silk protein gene, a primer pair for amplifying the fluorescent protein gene, a primer pair for detecting the left insertion site of the exogenous DNA, and a primer pair for detecting the right insertion site of the exogenous DNA; in step (3), during amplification, the specific primer pair is a primer pair for detecting whether the obtained silkworm is a pure line genome edited silkworm.
7. The composite silk fiber containing spider silk protein prepared by the preparation method of the composite silk fiber containing spider silk protein according to claim 1; the genome-edited silkworm constructed by the construction method of the genome-edited silkworm according to claim 2; the genome-edited silkworm egg constructed by the construction method of the genome-edited silkworm egg according to claim 3.
8. Use of the genome-edited silkworm or genome-edited silkworm eggs according to claim 7 in the preparation of composite silk fibers containing spider silk protein.
9. Use of the gene targeting vector pUC57-MaSp-c in preparing composite silk fibers containing spider silk proteins by using practical silkworm varieties, or in constructing genome-editing practical silkworm varieties, or in constructing genome-editing practical silkworm varieties eggs.
10. The use according to claim 9, characterized in that: During the application process, the first laid eggs of practical varieties of silkworms are treated with corona.
Citation Information
Patent Citations
Method for preparing spider bombyx mori composite silk fiber based on gene targeting bombyx mori
CN117025672A