A SNP marker related to duroc pig breed identification and application thereof

Abstract

The present application relates to a SNP marker related to Duroc pig breed identification and application thereof. The molecular marker contains a sequence shown as SEQ ID NO. 1, which contains a nucleotide site rs327637000 at 44090690 bp of chromosome 8 of the international pig genome 11.1 version reference sequence, and the polymorphism at the site is G / T, wherein the TT genotype is Duroc pig, the TG genotype is Duroc long and large three-way pig, and the GG genotype is long and large two-way pig. The SNP marker provided by the present application can simply and efficiently identify Duroc, Duroc long and large three-way pig and long and large two-way pig, and is convenient for breeders to trace breeding background. The present application provides a new technical means for pig breed identification, and has important application value and social benefits.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and genetic breeding, specifically to a SNP marker related to Duroc pig breed identification and its application. Background Technology

[0002] The most widely raised pig breeds in the current livestock industry are Duroc, Duroc Landrace, and Large White three-way crossbred pigs (i.e., the offspring of Duroc, Landrace, and Large White three-way crossbred pigs) and Large White two-way crossbred pigs (i.e., the offspring of Landrace and Large White two-way crossbred pigs). Among them, Duroc pigs are known for their fast growth rate, robust physique, and strong resistance to disease, and are widely used as terminal sires in my country's commercial pig breeding system.

[0003] In animal husbandry, different pig breeds exhibit significant differences in growth rate, meat quality, and reproductive capacity. Therefore, accurately identifying pig breeds is crucial for developing scientific breeding strategies, optimizing farming structures, and improving economic efficiency. Secondly, Duroc, Duroc-Landrace-Landrace-Greater White crossbreds, and Landrace-Greater White crossbreds, as important economic pig breeds, occupy a pivotal position in the pig farming industry. However, with the expansion of farming scale and the widespread use of interbreeding, errors or even loss of pedigree records frequently occur in production. Pig breed identification is a key link in ensuring farming efficiency and genetic stability. Traditional pig breed identification methods mainly rely on morphological characteristics and physiological indicators, such as body size, coat color, ear shape, and growth rate. However, these methods are easily affected by various factors such as environment, feeding conditions, and growth and development stages, leading to inaccurate and unstable identification results. Furthermore, traditional methods often fail to effectively distinguish between young pigs or breeds with similar physical characteristics. Incorrect identification slows down the genetic progress of the population, resulting in greater breeding losses than missing pedigree records. Therefore, it is particularly important to develop an accurate, stable, and efficient method for identifying pig breeds, especially for pigs that are widely raised.

[0004] With the rapid development of molecular biology techniques, molecular marker technology based on single nucleotide polymorphisms (SNPs) has gradually become a new method for pig breed identification. SNPs refer to DNA sequence polymorphisms caused by variations in a single nucleotide at the genomic level, possessing advantages such as large numbers, wide distribution, and good genetic stability. Accurate pig breed identification can be achieved by detecting the genotype of specific SNP loci. In the pig genome, there are breed-related SNP loci, and significant genotypic differences exist between different breeds. Using SNP markers provides a new technical means for pig breed identification, with significant application value and social benefits. Existing research has not yet discovered SNP loci with completely different genotypes in Duroc, Duroc-Landrace-Large White crossbred, and Large White crossbred pigs. Therefore, breed identification can only be performed using a large number (more than 1000) of SNP loci with certain differences combined with statistical models. Therefore, there is an urgent need to develop SNP markers and identification methods related to the identification of Duroc, Duroc-Landrace-Large White crossbred, and Large White crossbred pig breeds. Summary of the Invention

[0005] To address the above issues, this invention proposes SNP markers related to Duroc pig breed identification and their applications.

[0006] This invention provides an SNP molecular marker related to Duroc pig breed identification. The molecular marker contains the sequence shown in SEQ ID NO.1, which contains the rs327637000 nucleotide site located at 44090690 bp on chromosome 8 of the international pig genome version 11.1 reference sequence. The polymorphism at this site is G / T, where the TT genotype is Duroc pig, the TG genotype is Duroc-Landrace-Landrace-Greater White crossbred pig, and the GG genotype is Greater White crossbred pig.

[0007] The present invention also provides a PCR primer pair for detecting the above-mentioned SNP molecular markers, wherein the PCR primer pair includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.3.

[0008] The present invention also provides a KASP primer pair for detecting the above-mentioned SNP molecular markers, wherein the nucleotide sequence of the forward primer for detecting Allele T is shown in SEQ ID NO.4, the nucleotide sequence of the forward primer for detecting Allele G is shown in SEQ ID NO.5, and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.6.

[0009] The present invention also provides a kit for detecting the above-mentioned SNP molecular markers, wherein the kit contains the primer pair as described in claim 2 or 3.

[0010] The SNP molecular markers provided by this invention are applied in pig breeding.

[0011] The beneficial effects of this invention are as follows:

[0012] The SNP markers provided by this invention can easily and efficiently identify Duroc, Duroc-Landrace-Large White crossbred, and Large White crossbred pigs. Duroc pigs have the TT genotype at this locus, Duroc-Landrace-Large White crossbred pigs have the TG genotype, and Large White crossbred pigs have the GG genotype. This SNP marker can efficiently identify Duroc, Duroc-Landrace-Large White crossbred, and Large White crossbred pigs, correct missing or incorrectly recorded pedigree data, and accurately distinguish between Duroc, Duroc-Landrace-Large White crossbred, and Large White crossbred pigs with indistinct phenotypic differences, facilitating breeder tracing of breeding backgrounds. This invention provides a new approach to developing an accurate, stable, and efficient method for pig breed identification. This invention has a wide range of applications, unaffected by whether pigs have been sold, died, or whether correct pedigree records are available. The molecular markers and primers developed based on the SNPs of this invention can be used for rapid, high-throughput SNP detection; the breed of a sample can be determined simply by testing the genotype. Currently, machine learning algorithms require more than 1000 loci to distinguish genetically similar breeds, while this invention only requires testing one locus, significantly reducing testing costs. This invention provides a new technical means for pig breed identification, which has important application value and social benefits.

[0013] In addition, this invention provides a method for detecting the above-mentioned molecular markers using KASP primers. This detection method does not require the synthesis of specific fluorescent probes for each SNP site. Instead, it is based on its unique ARM PCR principle, which allows all site detections to be amplified using universal fluorescent primers. This greatly reduces reagent costs and has high accuracy, providing a simple, accurate, and low-cost method for detecting the molecular markers of this invention. Attached Figure Description

[0014] Figure 1 This is a statistical chart showing the accuracy of bloodline ratio prediction in Example 2;

[0015] Figure 2 This is a gel electrophoresis image of the amplified fragment at rs327637000 site at 44090690bp on pig chromosome 8 in Example 3;

[0016] Figure 3 The sequencing results are for the rs327637000 site at 44090690bp on chromosomes 6 and 8 of pigs in Example 3.

[0017] Figure 4 The results of breed identification of the pigs to be tested using the SNP locus are shown in Example 4. Detailed Implementation

[0018] The present invention will be further described below with reference to the embodiments.

[0019] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, all reagents used in this method are of analytical grade or higher.

[0020] Example 1:

[0021] Pig breeds exhibit certain differences in traits such as litter size and age at 100 kg weight. Quantitative traits are influenced by multiple genes, and differences between breeds may be caused by only a few genotypes among a large number of trait-related genes. Therefore, only by selecting loci from a large pool of loci can we identify those relevant to breed identification. The 100K liquid-phase microarray for pigs developed by Shijiazhuang Borui Biotechnology Co., Ltd. contains 18,800 loci associated with economically relevant traits, evenly distributed across each chromosome. Since trait-related loci are randomly distributed on chromosomes, this microarray maximizes the inclusion or linkage of trait-related loci. Therefore, the 100K liquid-phase microarray for pigs developed by Shijiazhuang Borui Biotechnology Co., Ltd. was used to perform genotyping on 1,649 Duroc pigs, 1,437 Large White crossbred pigs, and 1,211 Duroc Large White crossbred pigs from 17 pig farms in six provinces of China: Xinjiang, Hebei, Sichuan, Anhui, Hunan, and Guangdong. The Boredi pig liquid phase 100K chip contains 84,889 sites and can be used for analysis such as GS, GWAS, selection signal analysis, and breed identification. The design principle is as follows: 1) Select 18,800 SNPs located in the QTL region related to economic traits of pigs from the QTLdb library. The traits include: number of piglets born, age at 100KG weight, backfat thickness at 100KG, feed conversion ratio, etc.

[0022] 2) SNP loci are evenly distributed on chromosomes, enabling them to capture QTLs associated with economic traits to the greatest extent possible;

[0023] 3) The minimum allele frequency of the SNP locus in the population composed of Duroc, Changbai and Dabai is greater than 0.35.

[0024] In this embodiment, the genotypes of 1649 Duroc, 1437 Large White crossbred, and 1211 Duroc Large White crossbred pigs from 17 pig farms in 6 provinces (Xinjiang, Hebei, Sichuan, Anhui, Hunan, and Guangdong) of China were tested using a 100K liquid chromatography-mass spectrometry (LC-MS) chip. Based on Plink, samples with SNP detection rates below 0.9, multiple alleles, and individual detection rates below 0.9 were removed. Then, the genotype frequencies of each locus for the three breeds were calculated using Python. It was found that at the rs327637000 locus at 44090690 bp on chromosome 8, the genotype of Duroc was TT, 99.58% of the Large White crossbred pigs had the genotype GG, and 99.42% of the Duroc Large White crossbred pigs had the genotype GT.

[0025] Example 2: Validation of the SNP sites obtained in Example 1:

[0026] This embodiment uses the random forest (RF) method to verify whether the SNP sites obtained in Example 1 can be used to distinguish between Duroc, Large White crossbred pigs, and Duroc Large White crossbred pigs.

[0027] This embodiment constructs a training set of 8499 pigs, including 2530 Large White pigs, 1672 Landrace pigs, 1649 Duroc pigs, 1437 Landrace-Landrace crossbred pigs, and 1211 Duroc-Landrace-Landrace three-way crossbred pigs, for training the RF model and evaluating the importance of each point. We perform one-hot recoding of genotype information (called one-hot features) and pedigree-based recoding of breed information before inputting them into the RF model for training, obtaining the importance values ​​of each one-hot feature for breed identification.

[0028] like Figure 1 As shown, a certain proportion of one-hot features are sequentially selected and input into a multilayer perceptron model for breed prediction, and the absolute coefficient (R²) between the predicted pedigree ratio and the true pedigree ratio is calculated. 2 It was found that when the top 0.07% of one-hot features were selected, the accuracy of pedigree ratio prediction was the highest, that is, the accuracy of variety identification was the highest. Therefore, it is believed that the loci to which these one-hot features belong are the most important loci for variety identification information, totaling 191.

[0029] Statistical analysis of the genotype frequencies of the 191 selected loci revealed that the SNP locus at 8_44090690 (ranked first in importance) can be used to distinguish Duroc, Landrace-Landrace-Diploma crossbred pigs, and Duroc-Landrace-Diploma ...

[0030] Example 3: Construction of the SNP locus genotype detection method:

[0031] Using the pig genome version 11.1 reference sequence and chromosome 8 DNA sequence as templates, primers were designed: upstream primer A1 and downstream primer A2, with the primer sequences as follows:

[0032] Upstream primer A1 (SEQ ID NO.2): 5'-GCTGTAACTCCCGGTACATCA-3'

[0033] Downstream primer A2 (SEQ ID NO.3): 5'-TCTTTAGCCTGCAAGGCCTATT-3'

[0034] DNA extraction, PCR amplification, and sequencing:

[0035] Genomic DNA was extracted from the tissues of the pigs to be tested and used as a DNA template for PCR amplification. The total reaction volume was 20 μL, including 1 μL of DNA template, 0.4 μL each of the upstream primer A1 and downstream primer A2 (concentration of 10 μmol / L), 10 μL of PCR Mix reagent, and 7.2 μL of double-distilled water. PCR amplification reaction conditions:

[0036]

[0037] The PCR products were detected by electrophoresis on a 1% agarose gel. The amplified target fragment containing the rs327637000 locus at 44090690 bp on chromosome 8 was approximately 986 bp in size. (See electrophoresis image below.) Figure 2 The remaining amplification products were sequenced. The specific nucleotide sequence of this amplified fragment is shown in SEQ ID NO.1. A polymorphic site exists within this fragment, specifically at position 800 bp in SEQ ID NO.1, where K is either T or G. The genotype sequencing data for the rs327637000 site at 44090690 bp on chromosome 8 is shown in the image. Figure 3 ,in Figure 3-1 and Figure 3-2 It is a TG three-way crossbred pig. Figure 3-3 and Figure 3-4 For TT Duroc pigs, Figure 3 -5 and Figure 3 -6 refers to GG large-sized two-way crossbred pigs.

[0038] Example 4: Breed identification of the tested pigs using the SNP loci:

[0039] 4.1 First, primer sequence design is performed:

[0040] KASP primer pairs were designed targeting the G / T polymorphic site of the amplified fragment in Example 3 for the specific detection of this polymorphic site. The nucleotide sequence of the designed KASP primer pairs is as follows:

[0041] The forward HEX-tagged primer B1 (SEQ ID NO.4) used to detect Allele T is shown below.

[0042] SEQ ID NO.4:GAAGGTCGGAGTCAACGGATTTGTCCACAGCTCTTCAGTCT

[0043] The forward FAM-labeled primer B2 (SEQ ID NO.5) used to detect Allele G is shown below.

[0044] SEQ ID NO.5:GAAGGTGACCAAGTTCATGCTTGTCCACAGCTCTTCAGTCG;

[0045] The universal reverse primer C (SEQ ID NO.6) is shown below.

[0046] SEQ ID NO.6 (Universal Reverse Primer C):TCTCCTGTGTTTGACCTTGC.

[0047] The above primers were synthesized by Sangon Biotech Co., Ltd. Each primer pair in the KASP primer pair was diluted to 10 μmol / L and mixed thoroughly at a primer volume ratio of 12:12:30 for later use.

[0048] 4.2 Secondly, quality control was performed on the extracted genomic DNA:

[0049] Genomic DNA was extracted from the pigs to be tested (20 Duroc pigs, 20 Large White crossbred pigs, and 20 Duroc Large White crossbred pigs were randomly selected as test pigs to verify the accuracy of the method). A DNA extraction kit was used. The quality of the extracted genomic DNA was tested by 1% agarose gel electrophoresis and Nanodrop 2100. The qualified DNA requirements were: (1) Agarose gel electrophoresis showed a single DNA band without obvious diffusion. (2) Nanodrop 2100 detection showed A260 / 280 between 1.8 and 2.0; A260 / 230 between 1.8 and 2.0; and no obvious light absorption at 270 nm. Based on the KASP detection technology of LGC Company in the UK and the conversion of genome size, the amount of DNA used was calculated to be 10-20 ng / sample. The extracted genomic DNA was diluted to a concentration of 10-20 ng / μL as a DNA template for later use.

[0050] 4.3 Genotyping:

[0051] First, add 1.5 μL of the diluted DNA template (10-20 ng / μL) and the blank control (No template control, NTC, sterile water) to the 96-well reaction plate respectively, and dry at 60℃ for 30 min to make the DNA into dry powder for later use.

[0052] Each primer in the above KASP primer pairs was diluted to 10 μmol / L and mixed in a volume ratio of 12:12:30 to prepare the primer mixture. 1×Master mix (KBS-1016-011) and the primer mixture were added to each well. After mixing, the mixtures were sealed and PCR amplification was performed using a Bio-Rad CFX 96. The specific procedure was as follows:

[0053]

[0054] Examine the fluorescence signal and interpret the genotype. Specific results are as follows: Figure 4 As shown in the figure, each dot represents a sample of the test material. The blue square near the top left corner indicates that the locus is homozygous for the genotype "TT"; the green triangle near the center indicates that the locus is heterozygous for the genotype "TG"; the orange dot near the bottom right corner indicates that the locus is homozygous for the genotype "GG"; and the black square represents NTC, which is a blank control without added DNA. The breed can be deduced from the genotype at each locus: TT genotype corresponds to Duroc pigs, TG genotype corresponds to Duroc-Landrace-Landrace three-way crossbred pigs, and GG genotype corresponds to Landrace-Landrace two-way crossbred pigs. The results show that of the 60 pigs tested in this example, 20 were identified as Duroc pigs, 20 as Landrace-Landrace two-way crossbred pigs, and 20 as Duroc-Landrace-Landrace three-way crossbred pigs, with an accuracy rate of 100%.

[0055] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from the spirit or essential characteristics of the invention. Therefore, the embodiments should be considered in all respects as exemplary and non-limiting, and the scope of the invention is defined by the appended claims rather than the foregoing description. Thus, it is intended that all variations falling within the meaning and scope of equivalents of the claims be included within the present invention.

[0056] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This narrative style is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. The application of a primer pair for detecting SNP molecular markers in the identification of Duroc pig breeds, characterized in that, The SNP molecular marker is the rs327637000 nucleotide site located at 44090690 bp on chromosome 8 of the international pig genome version 11.1 reference sequence. The application involves extracting genomic DNA from the pigs to be tested, diluting the extracted genomic DNA as a DNA template, performing PCR amplification on the DNA template using the primer pair, and interpreting the SNP molecular marker genotype. The TT genotype is for Duroc pigs, the TG genotype is for Duroc-Landrace-Landrace-Diplodocus crossbred pigs, and the GG genotype is for Landrace-Landrace-Diplodocus crossbred pigs.

2. The application of the primer pair for detecting SNP molecular markers according to claim 1 in the identification of Duroc pig breeds, characterized in that, In the primer pair: the nucleotide sequence of the forward primer for detecting Allele T is shown in SEQ ID NO.4, the nucleotide sequence of the forward primer for detecting Allele G is shown in SEQ ID NO.5, and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.

6.

3. The application of a kit for detecting SNP molecular markers in the identification of Duroc pig breeds, characterized in that, The kit contains the primer pair as described in claim 2; the SNP molecular marker is the rs327637000 nucleotide site located at 44090690 bp on chromosome 8 of the international pig genome version 11.1 reference sequence. The application involves extracting genomic DNA from the pig to be tested, diluting the extracted genomic DNA as a DNA template, performing PCR amplification on the DNA template using the primer pair, and interpreting the SNP molecular marker genotype. The TT genotype is for Duroc pigs, the TG genotype is for Duroc-Landrace-Landrace-Great Wall crossbred pigs, and the GG genotype is for Landrace-Landrace-Great Wall crossbred pigs.

Images