A primer set for detecting important drug resistance and virulence genes in multidrug-resistant pathogens and its applications.
By designing 104 primer pairs and using the MGISEQ-200 sequencing platform, we achieved efficient and specific amplification and detection of multiple important drug resistance genes and virulence genes, solving the problem of simultaneous detection of multidrug-resistant pathogens in existing technologies and meeting the needs of public health security.
Patent Information
- Application Number
- CN202510406045.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-01
- Publication Date
- 2026-01-30
- Estimated Expiration
- 2045-04-01
AI Technical Summary
Existing technologies are insufficient for the simultaneous and efficient detection of drug resistance and virulence genes carried by multiple important priority multidrug-resistant pathogens, especially in environmental samples. Furthermore, traditional methods have significant limitations and cannot meet the needs of public health and safety.
A primer set, comprising 104 primer pairs, was designed for targeted amplification of various important drug resistance and virulence genes. Combined with the MGISEQ-200 sequencing platform from Shenzhen BGI Manufacturing Co., Ltd., multiplex PCR amplification, purification, and sequencing were performed to achieve high-throughput targeted detection.
It enables efficient and specific amplification and detection of a variety of important drug resistance and virulence genes, accurately captures target genes from various samples, assesses environmental risks, and guides preventive and clinical treatment medications.
Smart Images

Figure CN120230871B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of high-throughput targeted sequencing technology, and in particular to a set of primers for detecting important drug resistance genes and virulence genes in multidrug-resistant pathogens and their applications. Background Technology
[0002] High-throughput sequencing technologies mainly include metagenomic next-generation sequencing (mNGS), targeted next-generation sequencing (tNGS), and whole-genome sequencing (WGS). tNGS improves detection sensitivity and accuracy by targeting and enriching target genes, and can be divided into multiplex PCR amplification (abbreviated as amplification method) and probe capture method. Multiplex PCR amplification uses specially designed primers to perform ultramultiplex PCR to enrich the target nucleotide sequences of target pathogens. tNGS detection technology based on amplification can rapidly obtain detailed sequence information of target genes in a sample within a short time. This technology does not rely on traditional bacterial separation methods, is applicable to various sample types, and has a wide range of applications. It is a highly targeted method that is more economical and efficient.
[0003] Sequencing is a common method for detecting drug resistance / virulence genes in various samples. However, due to the limitations of conventional mNGS data volume for detecting drug resistance genes, random sequencing protocols can only reliably detect drug resistance / virulence genes at high concentrations. In such cases, tNGS is a good alternative. Currently, tNGS is used clinically for the detection of drug resistance and virulence genes, but there is still no design for the simultaneous detection of important drug resistance and virulence genes carried by several high-priority multidrug-resistant pathogens.
[0004] Currently, numerous types of drug resistance and virulence genes have been discovered, some of which pose a higher risk and threaten animal and even human health. According to literature, drug resistance genes can be assessed for risk levels based on three characteristics: ① the degree of enrichment in the human-related environment (i.e., human environmental richness); ② gene transferability; and ③ the presence of the ESKAPE pathogen (i.e., pathogenicity). These risks are classified into levels I-IV, with level I being the highest risk, primarily consisting of drug resistance genes carried by several important priority pathogens listed in the World Health Organization's (WHO) 2024 Priority Bacterial Pathogens List.
[0005] Priority drug resistance genes mainly involve the following pathogens and their drug resistance characteristics:
[0006] 1. Critical group mainly involves the following four pathogens and their drug resistance characteristics: (1) Enterobacteriaceae ( Enterobacterales (2) Enterobacteriaceae ( ) , resistance to third-generation cephalosporins; Enterobacterales (3) Acinetobacter baumannii ( ), carbapenem resistance; Acinetobacter baumannii (4) Mycobacterium tuberculosis ( ), carbapenem resistance; Mycobacterium tuberculosis Rifampicin resistance.
[0007] 2. High priority mainly involves the following 7 pathogens and their drug resistance characteristics: (1) Salmonella typhi ( Salmonella Typhi ), fluoroquinolone resistance; (2) Shigella spp. ( Shigella spp.), fluoroquinolone resistance; (3) Enterococcus faecalis ( Enterococcus faecium (4) Pseudomonas aeruginosa ( Pseudomonas aeruginosa (5) Non-typhoidal Salmonella ( ), carbapenem resistance; Non-typhoidal Salmonella ), fluoroquinolone resistance; (6) Neisseria gonorrhoeae ( Neisseria gonorrhoeae (7) Staphylococcus aureus ( ), resistance to third-generation cephalosporins and / or fluoroquinolones; Staphylococcus aureus Methicillin resistance.
[0008] 3. The moderate priority mainly involves the following four pathogens and their drug resistance characteristics: (1) Group A streptococci ( Group A streptococci (2) Streptococcus pneumoniae ( ), macrolide resistance; Streptococcus pneumoniae (3) Haemophilus influenzae ( ), macrolide resistance; Haemophilus influenzae (4) Group B streptococci ( ), ampicillin resistant; Group B streptococci ), penicillin resistance.
[0009] The emergence and spread of these drug-resistant pathogens pose a certain threat to public health and safety. In addition, highly virulent Klebsiella pneumoniae (… hvKp This is a novel variant of Klebsiella pneumoniae that emerged in the 1980s. It is a purely pathogenic bacterium that can cause fatal infections in healthy individuals. hvKP The strain is sensitive to most antimicrobial agents, but in recent years, the ST11 type of carbapenem-resistant Klebsiella pneumoniae, which is highly toxic, multidrug resistant, and highly transmissible, has emerged. CR-hvKp The discovery of this substance proves that high toxicity and high drug resistance can coexist, posing a certain threat to animal and human health.
[0010] Based on the aforementioned technical problems, and in order to better assess the risk of priority multidrug-resistant pathogens in the environment and provide a basis for clinical treatment of patients or diseased animals, this invention designs a set of primers for simultaneously detecting multiple important drug resistance genes and virulence genes carried by multidrug-resistant pathogens such as third-generation cephalosporin-resistant Enterobacteriaceae, carbapenem-resistant Enterobacteriaceae, carbapenem-resistant Acinetobacter baumannii, rifampicin-resistant Mycobacterium tuberculosis, and highly virulent Klebsiella pneumoniae in various samples. The primers are applied based on the MGISEQ-200 sequencing platform of Shenzhen BGI Manufacturing Co., Ltd.
[0011] The primer set of this invention can simultaneously target and amplify multiple important drug resistance genes and virulence genes in metagenomic samples from various environments, such as soil and intestinal feces, and metagenomic samples from various pathogens, such as bronchoalveolar lavage fluid, nasal / pharyngeal swabs, and pathogen tissues. Then, the primers are used to detect and identify the genes and perform subtyping of some genes through sequencing technology. This allows for the prediction and assessment of environmental risks and further guidance for preventive and clinical treatment. Summary of the Invention
[0012] The purpose of this invention is to provide a set of targeted sequencing primers for the simultaneous detection of multiple drug resistance genes and virulence genes carried by multidrug-resistant pathogens in various samples, including third-generation cephalosporin-resistant Enterobacteriaceae, carbapenem-resistant Enterobacteriaceae, carbapenem-resistant Acinetobacter baumannii, rifampicin-resistant Mycobacterium tuberculosis, fluoroquinolone-resistant Salmonella typhi, fluoroquinolone-resistant Shigella, vancomycin-resistant Enterococcus faecalis, and carbapenem-resistant Enterococcus faecium. The study examines the various drug-resistant genes carried by multidrug-resistant pathogens, including *Pseudomonas aeruginosa*, fluoroquinolone-resistant non-typhoidal *Salmonella*, third-generation cephalosporin and / or fluoroquinolone-resistant *Neisseria gonorrhoeae*, methicillin-resistant *Staphylococcus aureus*, macrolide-resistant group A streptococci, macrolide-resistant *Streptococcus pneumoniae*, ampicillin-resistant *Haemophilus influenzae*, penicillin-resistant group B streptococci, and highly virulent *Klebsiella pneumoniae*, as well as important virulence genes carried by highly virulent *Klebsiella pneumoniae*.
[0013] This invention provides a primer combination for detecting drug resistance genes and virulence genes in multidrug-resistant pathogens, consisting of the following primer pairs:
[0014] Table 1
[0015]
[0016] As shown in SEQ ID NO: 1~208.
[0017] Preferably, the 5' end of each Primer 1 in the primer combination is added with the sequence “GACATGGCTACGATCCGACTT”, and the 5' end of each Primer 2 is added with the sequence “CGCTTGGCCTCCGACTT”; as shown in SEQ ID NO: 209~210.
[0018] The present invention also provides the application of the primer combination described above in the preparation of detection reagents for detecting drug resistance genes and virulence genes of multidrug-resistant pathogens.
[0019] The present invention also provides a kit for detecting drug resistance genes and virulence genes of multidrug-resistant pathogens, including the primer combination described above.
[0020] This invention also provides a method for detecting drug resistance genes and virulence genes in multidrug-resistant pathogens, comprising the following steps:
[0021] (1) Extract DNA from the sample to be tested;
[0022] (2) The obtained DNA sample was amplified by multiplex PCR using the primer combination described above;
[0023] (3) The amplification products obtained in step (2) are purified, library constructed, and sequenced;
[0024] (4) Perform bioinformatics analysis on the sequencing results obtained in step (3).
[0025] Preferably, the sample to be tested in step (1) is an environmental sample or a pathological sample. The environmental sample is soil or intestinal feces; the pathological sample is bronchoalveolar lavage fluid, nasal swab, pharyngeal swab or pathological tissue.
[0026] Preferably, the sequencing platform in step (3) is MGISEQ-200, and the sequencing strategy is FCL, PE100.
[0027] Preferably, the multiplex PCR amplification system in step (2) is as follows: PCR Enzyme Mix 12.5 μL, PCR CleanEnzyme 0.5 μL, primer pool 2 μL, DNA template 10 μL, and water to make up to 25 μL.
[0028] Preferably, the program for multiplex PCR amplification in step (2) is as follows: 105℃ hot cap, 37℃ for 5 min, 95℃ for 10 min; 95℃ for 20 s, 64℃ for 1 min, 60℃ for 1 min, 72℃ for 30 s, 13 cycles; store at 12℃.
[0029] This invention also provides a method for assessing the risk of multidrug-resistant pathogens in the environment, comprising the following steps:
[0030] a. Using the aforementioned detection method, detect drug resistance genes and virulence genes in environmental samples;
[0031] b. Assess the risk of multidrug-resistant pathogens in the environment based on the types and abundance of detected genes.
[0032] Compared with the prior art, the present invention has the following beneficial effects:
[0033] The drug resistance genes detected in this invention include aminoglycoside resistance genes. aac(3)-II , aac(3)-VI , aadB , aadE , aph(3')-III , rmtF , rmtG 7 types; bacitracin resistance genes bacA One type; β-lactam antibiotic resistance gene bla Z, bla CMY , bla CTX-M-1 , bla CTX-M-2 , bla CTX-M-129 , bla GES-11 , bla IMP-1 , bla KPC , mecA , mecR1 , bla NDM , bla OXA-1 , bla OXA-23 , bla OXA-51 , bla OXA-58 , bla SHV , bla TEM , bla VEB-3 , bla VIM-1 , bla MOX , bla DHA , bla ACC , bla ACT-1 , bla FOX ,bla ADC 25 types; chloramphenicol resistance genes catA , catB , cmlA , floR Four types; colistin resistance genes mcr-1 , mcr-3 , mcr-8 Three types; MLSB-type drug resistance genes ermB , ermC , ermT , lnuA , lnuB , mphA , mphB , msrA Eight types of multidrug-resistant drugs mepA , mdtE , mdtL , norA , TolC Five types; quinolone resistance genes qnrA , qnrB , qnrS Three types; tetracycline resistance genes tetL , tetM Two types; trimethoprim resistance genes dfrA1 , dfrA5 , dfrA12 , dfrA14 , dfrA15 , dfrA17 , dfrA25 , dfrB1 Eight types; vancomycin resistance genes vanA , vanB , vanC , vanD , vanG , vanM , vanR , vanS , vanY , vanH , vanX , vanZ 12 types; rifampicin resistance genes arr-3 , rpoB Two types. The virulence genes of highly virulent Klebsiella pneumoniae detected include... rmpA , rmpA2 , iucA , iucB , iucC , iucD , iroB , iroC , peg344 Nine types were identified. Ultimately, the study encompassed 12 categories and 80 important drug resistance genes, as well as nine highly virulent Klebsiella pneumoniae virulence genes, totaling 89 genes. bla KPCand bla NDM The primer amplification region of the gene basically covers the full length of the gene sequence, and the SNP of the gene is monitored to add the distinction between different subtypes on the basis of identification. rpoB The rifampicin resistance-determining region (RRDR) was selected as the amplification region for the gene, and monitoring was performed. rpoB The mutation status of the gene is used to more accurately determine whether rifampicin resistance has occurred. One or more primer pairs are designed based on the length and characteristics of the gene.
[0034] This invention provides a total of 104 pairs of primers, with each pair of primers corresponding to amplicon fragments ranging in size from 100 to 200 bp, which can efficiently and specifically target and amplify the drug resistance genes and virulence genes involved in the invention.
[0035] This invention aims to analyze the distribution and genetic evolution characteristics of important drug resistance genes carried by multidrug-resistant pathogens using targeted resequencing technology, while simultaneously monitoring the virulence genes of highly virulent Klebsiella pneumoniae. It does not rely on traditional bacterial segmentation methods, is applicable to various sample types, and covers a wide range of aspects, closely linking drug resistance / virulence genes, priority pathogens carrying related genes, and multiple factors such as the environment and patients / infected animals. This detection protocol is beneficial for predicting and analyzing the drug resistance and virulence characteristics of multidrug-resistant pathogens in different environments, and has significant public health implications.
[0036] This invention establishes a high-throughput targeted amplification sequencing detection and analysis method for multiple drug resistance genes and virulence genes carried by multidrug-resistant pathogens. This method has advantages such as speed, efficiency, strong targeting, and high specificity. It is suitable for analyzing the prevalence and differential distribution of multiple important drug resistance genes and virulence genes carried by metagenomic samples from various environments or pathogenic materials. Based on this analysis, it can assess the risk of related environments and further guide preventative and clinical treatment medications. Attached Figure Description
[0037] Figure 1 This is a distribution map of the drug resistance genes and virulence genes carried by the multidrug-resistant pathogens involved in this invention.
[0038] Figure 2 The flowchart below shows the high-throughput targeted sequencing detection process used in this embodiment of the invention (refer to the MGISEQ-200 sequencing instruction manual from BGI Manufacturing Co., Ltd., Shenzhen, China).
[0039] Figure 3 The graph shows the quality assessment results of MGISEQ-200 sequencing of the sample from Example 4.
[0040] Figure 4This is a graph showing the abundance of drug resistance genes and virulence genes detected in 8 samples sequenced in Example 4. Detailed Implementation
[0041] Table 2 Main Reagents and Instruments
[0042]
[0043] Example 1: Establishment of a targeted detection method for drug resistance genes and virulence genes in multidrug-resistant pathogens.
[0044] Referring to the World Health Organization's (WHO) 2024 Priority Pathogen List, priority pathogens were selected, and targeted detection methods were established for important drug resistance and virulence genes carried by multidrug-resistant pathogens, including third-generation cephalosporin-resistant Enterobacteriaceae, carbapenem-resistant Enterobacteriaceae, carbapenem-resistant Acinetobacter baumannii, rifampicin-resistant Mycobacterium tuberculosis, and highly virulent Klebsiella pneumoniae. The final results covered 80 important drug resistance genes and 9 virulence genes (Table 3), and complete gene sequences were downloaded from NCBI, establishing a specialized database of important drug resistance and virulence gene sequences for multidrug-resistant pathogens.
[0045] Table 3 Genes and their accession numbers
[0046]
[0047] To ensure optimal amplification efficiency and best combination effect, the amplification length of each primer pair was controlled between 100 and 200 bp during design. Based on important information such as sequence length and genetic characteristics of different genes, and after repeated comparisons and analyses, except for β-lactam resistance genes... bla KPC , bla NDM For each of the 78 drug resistance genes identified, a pair of primers was designed to amplify the conserved regions of the genes; bla KPC and bla NDM For each of the two drug resistance genes, four pairs of primers were designed to amplify the regions, essentially covering the full-length sequence of the gene. This involved SNP detection and monitoring of different subtypes for both drug resistance genes, identifying their subtypes simultaneously with the detection. Furthermore, rpoB This gene design uses a primer pair primarily covering the rifampicin resistance-determining region (RRDR) to effectively monitor rifampicin resistance. Nine virulence genes are included. rmpA2Except for one primer pair for each gene, 2-3 primer pairs were designed for all other genes. The amplified regions were located in different parts of the gene, allowing for the analysis of epidemiological characteristics while identifying the gene. A total of 104 primer pairs were designed (as shown in Table 1), with an average amplified length of 138.74 bp. There were no homologous amplified regions between the primers, and there was no overlap between them.
[0048] The primer set was used on the MGISEQ-200 sequencing platform of Shenzhen BGI Genomics Co., Ltd. Synthesized by Shenzhen BGI Genomics Co., Ltd., adapter and other base sequences were added to the primer set in conjunction with the company's specific barcode sequence. Specifically, the 5' end of each Primer 1 primer was supplemented with the sequence "GACATGGCTACGATCCGACTT", and the 5' end of each Primer 2 primer was supplemented with the sequence "CGCTTGGCCTCCGACTT", which does not conflict with the content of this invention. The final primer set constitutes the "Primer Pool for Drug Resistance Genes and Virulence Genes of Multidrug-Resistant Pathogens" used in the following examples, hereinafter referred to as the primer pool.
[0049] Example 2 Enrichment of target regions in aquaculture environment samples
[0050] The primer pool for drug resistance genes and virulence genes of multidrug-resistant pathogens designed in Example 1 was applied to the detection of samples from the breeding environment. The samples were bedding samples from dairy farms in the Beijing area. Specific numbering is shown in Table 4.
[0051] I. Microbial DNA Extraction from Samples
[0052] Microbial DNA was extracted from fecal samples using a fecal DNA mini-extraction kit, ensuring a total extracted microbial DNA volume of at least 10 μL. Nanodrop was then used for genome quality control to ensure successful extraction.
[0053] Table 4 Sample Information
[0054]
[0055] II. Amplification of the target region
[0056] Using microbial DNA extracted from a single sample as a template, the first round of PCR amplification was performed using the primer pool designed and synthesized in Example 1 above. The reaction reagents used were PCR Enzyme Mix and PCRClean Enzyme from the ATOPlex DNA multiplex PCR amplification module. The reaction system is shown in Table 5, and the reaction procedure is shown in Table 6.
[0057] Table 5 First-round PCR reaction system
[0058]
[0059] Table 6. First-round PCR reaction procedure
[0060]
[0061] III. Purification of Amplification Products
[0062] After the first round of PCR reactions, PCR product purification is required. The reagents used include DNA Clean Beads from the MGIEAsy DNA Purification Magnetic Bead Kit and TE buffer. Additionally, 80% ethanol is needed. Note that the sample number, PCR reaction number, and PCR product purification number should correspond; that is, one sample corresponds to one PCR reaction and one PCR product purification.
[0063] The specific steps are as follows: Purify the first round of 25 μL PCR product using 30 μL DNA Clean Beads. Transfer both to a 1.5 mL centrifuge tube and gently pipette to mix thoroughly. Incubate at room temperature for 5 min. After incubation, briefly centrifuge to collect the liquid on the tube wall. Place the 1.5 mL centrifuge tube on a magnetic rack and let it stand for 4 min until the liquid is clear. Carefully aspirate and discard the supernatant using a pipette. Keep the 1.5 mL centrifuge tube on the magnetic rack, add 200 μL of 80% ethanol to rinse the magnetic beads and tube wall, let it stand for 30 s, then carefully aspirate and discard the supernatant. Repeat this process once more, ensuring the tube is completely dry the second time. Keep the 1.5 mL centrifuge tube on the magnetic rack, open the cap, and let it dry at room temperature until the surface of the magnetic beads is no longer reflective and cracked. Remove the 1.5 mL centrifuge tube, add 6.5 μL of TE Buffer for DNA elution, gently pipette to mix thoroughly, and then incubate at room temperature for 5 min. Briefly centrifuge. This step does not remove the magnetic beads.
[0064] After this round of PCR amplification and product purification, a specific product enriched for the target region was obtained, which contains magnetic beads. This product can be stored at -20℃ for a long time.
[0065] Example 3: Construction and application of sequencing libraries on the MGISEQ-200 platform
[0066] To ensure that the specific products enriched with the target region obtained in Example 2 can be sequenced on the MGISEQ-200 platform, and to ensure that different samples can be correctly identified during the sequencing process, the following steps are performed: connecting the adapter and barcode of the target region, routine circularization of the library, DNB preparation, and sequencing.
[0067] 1. Connection between the adapter and barcode in the target area
[0068] The specific product (containing magnetic beads) enriched in the target region obtained in Example 2 was used as a template for a second round of PCR amplification. After amplification, the amplified product still needed to be purified. The second round of amplification required the use of customized specific splint oligos provided by Shenzhen BGI Genomics Co., Ltd., and the addition of barcodes that could be separated by the MGISEQ-200 platform. The customized specific splint oligos specifically binds to the primer pool of this invention.
[0069] The reaction reagents used in the second round of PCR were the PCR Enzyme Mix, PCR Clean Enzyme, and Additive from the ATOPlex DNA Multiplex PCR Amplification Module. The reaction system is shown in Table 7, and the reaction procedure is shown in Table 8.
[0070] Table 7 Second round PCR reaction system
[0071]
[0072] Table 8. Second Round PCR Reaction Procedure
[0073]
[0074] The purification reagents used for the second round of PCR products include DNA CleanBeads from the MGIEAsy DNA Purification Magnetic Bead Kit and TE buffer, and 80% ethanol is also required. At this stage, one purified product is used per sample, and it must correspond to the added barcode.
[0075] The specific steps are as follows: Purify 25 μL of the second-round PCR product using 25 μL DNA Clean Beads. Transfer both to a 1.5 mL centrifuge tube and gently pipette to mix thoroughly. Incubate at room temperature for 5 min. After incubation, briefly centrifuge to collect the liquid on the tube wall. Place the 1.5 mL centrifuge tube on a magnetic rack and let it stand for 4 min until the liquid is clear. Carefully aspirate and discard the supernatant with a pipette. Keep the 1.5 mL centrifuge tube on the magnetic rack and add 200 μL of freshly prepared 80% ethanol to rinse the magnetic beads and tube wall. Let it stand for 30 s and carefully aspirate and discard the supernatant. Repeat this process once more, ensuring that the liquid in the tube is completely aspirated the second time. Keep the 1.5 mL centrifuge tube on the magnetic rack and open the cap to dry at room temperature until the surface of the magnetic beads is no longer reflective and cracked. Remove the 1.5 mL centrifuge tube and add 6.5 μL of TE Buffer to elute the DNA. Gently pipette to mix thoroughly and incubate at room temperature for 5 min. Then, briefly centrifuge. Then place the 1.5 mL centrifuge tube on a magnetic rack and let it stand for 4 minutes until the liquid is clear. Transfer 23 μL of the supernatant to a new PCR tube. The magnetic beads must be completely removed during this step.
[0076] After this round of PCR amplification and product purification, the specific product obtained in Example 2 was successfully tagged with various tags applicable to subsequent sequencing, and the magnetic beads were removed, resulting in a single-sample double-stranded DNA library. This library can be stored long-term at -20°C. Based on the number of samples, a total of 8 sample double-stranded DNA libraries were constructed, which were enriched with drug resistance genes and virulence genes of multidrug-resistant pathogens.
[0077] II. Routine Circulation of Documents
[0078] To ensure that the eight double-stranded DNA libraries constructed in step one can be successfully processed and circularized, the experiments involved in this step include mixing single-sample double-stranded DNA libraries and routine circularization of mixed sample libraries.
[0079] 1. Mixing of single-sample double-stranded DNA libraries
[0080] The double-stranded DNA library of the 8 samples constructed in step one of this embodiment was used with Qubit. TM 4. Quality control was performed using a fluidometer. Samples with concentrations greater than 5 ng / µL were mixed and added. The amount added to each library (µL) was 400 (ng) / number of samples / C (ng / µL). Finally, a mixed library of samples was constructed. Detailed concentrations are shown in Table 9. To facilitate sampling, all samples can be scaled up proportionally according to actual conditions. In this example, sampling was carried out at a 10-fold scale.
[0081] Table 9. Input of double-stranded DNA libraries for a single sample
[0082]
[0083] 2. Routine cyclization of mixed sample libraries
[0084] Using the mixed library constructed in the previous step as a template, a third round of PCR was performed to denature the library. Since the amount of template added was less than 48 μL, TE buffer was added to bring the total to 48 μL. No other reagents were used in the third round of PCR; the reaction procedure is shown in Table 10.
[0085] Table 10. Third-round PCR reaction procedure
[0086]
[0087] Then, the samples were routinely circularized using the products from the third round of PCR as a template. Two rounds of PCR were performed in total: the fourth and fifth rounds. The reagents used in the fourth round of PCR were Splint Buffer and DNA Rapid Ligase from the MGIEAsy circularization module, while the reagents used in the fifth round of PCR were Digestion Buffer and Digestion Enzyme from the MGIEAsy circularization module. The PCR reaction system for the fourth round is shown in Table 11, and the reaction procedure is shown in Table 12; the PCR reaction system for the fifth round is shown in Table 13, and the reaction procedure is shown in Table 14.
[0088] Table 11 Fourth round PCR reaction system
[0089]
[0090] Table 12 Fourth Round PCR Reaction Procedure
[0091]
[0092] Table 13 Fifth round PCR reaction system
[0093]
[0094] Table 14 Fifth Round PCR Reaction Procedure
[0095]
[0096] Immediately after the fifth round of PCR, add 7.5 μL of Digestion Stop Buffer from the MGIEasy circularization module to the PCR tube and vortex to mix. The fifth round PCR product needs to be purified. The purification reagents used include DNA Clean Beads from the MGIEasy DNA Purification Magnetic Bead Kit and TE buffer, and 80% ethanol is also required.
[0097] The specific steps are as follows: Use 170 μL DNA Clean Beads to purify 71.5 μL of the fifth round PCR product. Transfer both to a 1.5 mL centrifuge tube and gently pipette to mix thoroughly. After mixing, incubate at room temperature for 10 min. After incubation, briefly centrifuge to collect the liquid on the tube wall. Place the 1.5 mL centrifuge tube on a magnetic rack and let it stand for 4 min until the liquid is clear. Carefully aspirate and discard the supernatant using a pipette. Keep the 1.5 mL centrifuge tube on the magnetic rack, add 500 μL of freshly prepared 80% ethanol to rinse the magnetic beads and tube wall. Let it stand for 30 s, then carefully aspirate and discard the supernatant. Repeat this process once more, ensuring the tube is completely dry the second time. Keep the 1.5 mL centrifuge tube on the magnetic rack and open the cap to air dry at room temperature until the surface of the magnetic beads is no longer reflective and cracked. Remove the 1.5 mL centrifuge tube, add 22 μL of TE buffer for DNA elution, and gently pipette until completely mixed. Incubate at room temperature for 10 min, then briefly centrifuge. Place the 1.5 mL centrifuge tube on a magnetic rack and let it stand for 4 min until the liquid is clear. Transfer 20 μL of the supernatant to a new PCR tube. This step requires complete removal of the magnetic beads.
[0098] After product purification, use Qubit ® The standard provided in the ssDNA Assay Kit uses Qubit TM 4. ss DNA quality control was performed using a fluorometer. In this example, the ss DNA concentration of the circularized library was 0.833 ng / μL, meeting the requirement of ≥ 0.4 ng / μL. This completes the routine circularization of the library, which can be stored long-term at -20℃.
[0099] III. DNB Preparation
[0100] To ensure a balanced base distribution in the library and prevent interference with subsequent sequencing, a standard library was added to the circularized library during DNB preparation at a ratio of 7:3, with a total addition of 60 fmol. The standard library used was the one from the standard library kit, with a concentration of 1.93 ng / μL and a length of 429 bp.
[0101] To convert concentration units from ng / μL to fmol / μL, the conversion formula is C(fmol / μL) = 3030. C (ng / μL) / N, where N is the length of the library. DNB was prepared using a mixed library of circularized and standard libraries as a template via the MGISEQ-200RS high-throughput sequencing kit (FCL PE100). Two rounds of PCR reactions were performed: the sixth and seventh rounds. The reagents used in the sixth round of PCR were TE Buffer and DNB preparation buffer from the MGISEQ-200RS high-throughput sequencing kit (FCL PE100), while the reagents used in the seventh round of PCR were DNB polymerase mixture I and DNB polymerase mixture II (LC) from the MGISEQ-200RS high-throughput sequencing kit (FCL PE100). The PCR reaction system for the sixth round is shown in Table 15, and the reaction procedure is shown in Table 16; the PCR reaction system for the seventh round is shown in Table 17, and the reaction procedure is shown in Table 18.
[0102] Table 15 Sixth round PCR reaction system
[0103]
[0104] Table 16 Sixth Round PCR Reaction Procedure
[0105]
[0106] Table 17 Seventh Round Reaction System
[0107]
[0108] Table 18 Seventh Round PCR Reaction Procedure
[0109]
[0110] Immediately after the seventh round of PCR reaction, add 20 μL of DNB stop buffer from the MGISEQ-200RS high-throughput sequencing kit (FCLPE100) to the PCR tube and gently pipette over it 8 times. Do not vigorously pipette over the tube to avoid damaging the DNB.
[0111] Use Qubit after the reaction is complete ® The standard provided in the ssDNA Assay Kit uses Qubit TMThe ss DNA was quality checked using a 4-fluorometer. In this example, the ss DNA concentration of DNB was 8.49 ng / μL, which is ≥ 8 ng / μL, meeting the requirements for sequencing. The DNB preparation was successful. It was then stored at 4°C for a short period before sequencing.
[0112] IV. Sequencing
[0113] The DNB prepared in step 3 was sequenced using the MGI high-throughput (rapid) sequencing kit (FCL PE100). Before sequencing, the instrument needed to be cleaned according to the MGISEQ-200 cleaning instructions. The sequencing steps were then performed according to the kit instructions. The sequencing strategy was FCL, PE100, and the sequencing time was 24 hours.
[0114] Example 4: Sequencing data download and bioinformatics analysis
[0115] After sequencing, the instrument needs to be cleaned again according to the MGISEQ-200 cleaning instructions. Then, copy all sample sequencing data for analysis and statistical analysis of results. The sequencing report after the sequencing run showed that the Q30 (%) was 94.6, ESR (%) was 75.2, and Split Rate (%) was 98.3, indicating that the data quality met the analysis requirements.
[0116] The environmental sample data were processed using bioinformatics methods. After data quality control using FASTQ, sequence comparison analysis was performed on the sample data using pblat software and a customized bioinformatics script. The barcodes of all samples tested were correctly identified, and the raw data reads of each sample in the examples were all no less than 3 M, meeting the analytical requirements.
[0117] After bioinformatics analysis, the data underwent data normalization, target gene abundance calculation, and statistical analysis of drug resistance and virulence gene detection results. The results were then visualized. The results of this embodiment are reliable, with some genes showing a detection depth of up to 10000X. The eight samples in this embodiment showed multiple drug resistance and virulence genes detected, with variations in detection among samples (Table 19), suggesting a certain level of risk in the dairy farm environment that should be taken seriously.
[0118] Table 19 Detection results of 8 samples in the examples
[0119]
[0120] #Percentage of the number of genes detected out of the designed genes; Percentage of detected gene types out of the designed genes
[0121] In summary, the application examples demonstrate that the primer set provided by this invention, without interference, simplifies manual operation and improves the detection efficiency of drug resistance genes and virulence genes in samples. The primer set provided by this invention possesses strong specificity (negative controls do not meet amplification requirements) and sensitivity (it can enrich target genes from extremely low concentrations of environmental samples), enabling accurate capture of target genes from environmental samples. This allows for assessment of the risk of multidrug-resistant pathogens in the environment based on the detection results. This invention achieves the goal of directly, rapidly, and accurately detecting multiple drug resistance genes and virulence genes carried by multidrug-resistant pathogens in samples. Therefore, this invention successfully establishes a high-throughput targeted sequencing method for detecting drug resistance genes and virulence genes of multiple drug-resistant pathogens. The above descriptions are merely preferred embodiments of this invention.
Claims
1. A primer combination for detecting drug resistance genes and virulence genes of multi-drug resistant pathogenic bacteria for high-throughput targeted sequencing, characterized in that, consist of: The sequence "GACATGGCTACGATCCGACTT" is added to the 5' end of each Primer 1 primer in the primer combination, and the sequence "CGCTTGGCCTCCGACTT" is added to the 5' end of each Primer 2 primer. 。 2. The primer combination according to claim 1, characterized in that, 3. Use of the primer combination of claim 1 or 2 in the preparation of a detection reagent for detecting drug resistance genes and virulence genes of multi-drug resistant pathogenic bacteria for high-throughput targeted sequencing. The primer combination of claim 1 or 2.
4. A kit for detection of drug resistance genes and virulence genes of multi-drug resistant pathogenic bacteria for high-throughput targeted sequencing, characterized in that, The method comprises the following steps:
5. A method for detecting drug resistance genes and virulence genes of multi-drug resistant pathogenic bacteria for high-throughput targeted sequencing, characterized in that, (1) extracting DNA from the sample to be tested; The sample to be tested is soil; (2) performing multiplex PCR amplification on the obtained DNA sample using the primer combination of claim 1 or 2; (3) purifying, library building and sequencing the amplification product obtained in step (2); (4) performing bioinformatics analysis on the sequencing results obtained in step (3). The system for multiplex PCR amplification in step (2) is: PCR Enzyme Mix 12.5 μL, PCR Clean Enzyme 0.5 μL, primer combination 2 μL, DNA template 10 μL, water to 25 μL.
6. The detection method according to claim 5, characterized in that, The program for multiplex PCR amplification in step (2) is: 105℃ hot lid, 37℃ 5 min, 95℃ 10 min; 95℃ 20 s, 64℃ 1 min, 60℃ 1 min, 72℃ 30 s, 13 cycles; 12℃ storage.
7. The detection method according to claim 5, characterized in that, The method comprises the following steps:
8. A method of assessing the risk of multi-drug resistant pathogenic bacteria in an environment, characterized by, a. Using the detection method of any one of claims 5-7, detecting drug resistance genes and virulence genes in the soil sample; b. According to the types and abundances of the detected genes, assessing the risk of multi-drug resistant pathogenic bacteria in the environment.
Citation Information
Patent Citations
Capture probe group for detecting pathogenic microorganisms and application of capture probe group
CN119662886A
Primer group for simultaneous detection of 15 porcine pathogens through high-throughput targeted amplicon sequencing and use thereof
US20240167106A1