SNP (Single Nucleotide Polymorphism) molecular marker for identifying high / low tartronic acid content of cucumber fruit and application of SNP molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker for identifying high / low tartronic acid content of cucumber fruits and application of the SNP molecular marker, and belongs to the technical field of biotechnology-assisted breeding, the site of the SNP marker is the 4th, 352nd and 029bp of the physical position of a cucumber chromosome 4, the basic group of the site is C or T, and the basic group of the site is C or T; the cucumber material with the basic group at the site T is a cucumber material with high content of tartronic acid in the fruit, and the cucumber material with the basic group at the site C is a cucumber material with low content of tartronic acid in the fruit. The invention not only lays a foundation for fine positioning and molecular cloning of the tartronic acid content character of the cucumber fruit, but also provides an efficient way for the molecular marker-assisted breeding of a new cucumber variety with high tartronic acid content.

Description

Technical Field

[0001] The present invention relates to the technical field of biotechnology-assisted breeding, and particularly to SNP molecular markers for identifying high / low malonic acid content in cucumber fruits and their applications. Background Art

[0002] Malonic acid (CAS No. 80-69-3), also known as 2-hydroxy malonic acid or tartronic acid, is a dicarboxylic acid with the molecular formula C3H4O5. It contains a hydroxyl group and a carboxyl group, so it is also a hydroxycarboxylic acid and is soluble in water, alcohol, etc. The research by Iakusheva et al. showed that malonic acid can inhibit the conversion of carbohydrates into fat (1958). The research by Liu Xiaoying et al. showed that malonic acid can reduce the fat content in Caenorhabditis elegans without affecting behaviors such as movement and swallowing (2023).

[0003] Naturally synthesized malonic acid exists only in a very few fruits and vegetables such as cucumbers, wax gourds, and chieh-quas. There is relatively little research on the synthesis of malonic acid in plants at home and abroad. At present, the research on malonic acid in fruits and vegetables mainly focuses on the optimization of its extraction, the determination of its content, the influence of elements such as nitrogen and phosphorus on the malonic acid content, and the genetic effects. The determination of malonic acid content in vegetables mostly uses high-performance liquid chromatography and ion chromatography. Xu Lili et al. optimized the extraction conditions through single-factor experiments and orthogonal experiments, and analyzed an optimal extraction process for extracting malonic acid from cucumbers (2016). Liu Na et al. optimized the extraction conditions of malonic acid in chieh-quas by the response surface method, and obtained the optimal extraction process for chieh-quas as the extraction temperature of 25°C, the extraction time of 55 min, the ethanol concentration of 5%, and the solid-liquid ratio of 1:60 (Liu Na 2021). Gao Jie et al. measured the malonic acid content of 56 cucumber germplasms, and the results showed that the content was between 1.77 and 10.22 g / kg, and the highest content differed from the lowest content by 5.7 times (2012). Sun Yanyan et al. found that in addition to the fruits, cucumbers also contain trace amounts of malonic acid in their stems and leaves (2013). At the same time, You Yuqing et al. screened out an excellent parent and three hybrid combinations by the diallel cross method. The inheritance of malonic acid is mainly additive, without maternal effects (2014).

[0004] So far, SNP markers linked to high malonic acid content in cucumber fruits have not been reported. Summary of the Invention

[0005] One of the purposes of the present invention is to provide SNP molecular markers for identifying high / low malonic acid content in cucumber fruits and their applications in view of the above problems.

[0006] The technical solution adopted by the present invention to achieve its purpose is:

[0007] The first aspect of the present invention provides an SNP molecular marker for identifying high / low malic acid content in cucumber fruits. The locus of the SNP marker is at the 4,352,029th base pair of the physical position on chromosome 4 of cucumber. The base at this locus is C or T. Cucumber materials with base T at this locus are cucumber materials with high malic acid content in fruits, and cucumber materials with base C at this locus are cucumber materials with low malic acid content in fruits.

[0008] The second aspect of the present invention provides the application of the above SNP molecular marker for identifying high / low malic acid content in cucumber fruits in any one of the following (1)-(3):

[0009] (1) Identifying or assisting in identifying cucumber materials with high / low malic acid content in fruits;

[0010] (2) Screening or assisting in screening cucumber varieties with high malic acid content in fruits;

[0011] (3) Cultivating or assisting in cultivating cucumber varieties with high malic acid content in fruits;

[0012] The nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.3 or SEQ ID NO.4, in which the 26th base is C or T. Cucumber materials with base C at this locus are cucumber materials with low malic acid content in fruits, and cucumber materials with base T at this locus are cucumber materials with high malic acid content in fruits.

[0013] The above application includes the following steps: extracting genomic DNA of the sample to be tested as a template, performing PCR amplification using the amplification primers of the SNP molecular marker, and performing sequencing or restriction enzyme digestion electrophoresis detection on the PCR amplification product. The restriction enzyme digestion electrophoresis detection refers to using a restriction endonuclease that can recognize the differential locus of the SNP molecular marker to digest the PCR amplification product, and then performing electrophoresis on the amplification product; preferably, the electrophoresis uses non-denaturing polyacrylamide gel electrophoresis.

[0014] For the above application, the amplification primers of the SNP molecular marker are as follows:

[0015] dcaps-04-F: 5'-TATTTAATGCCCTAAAAAACAAGTA-3',

[0016] dcaps-04-R: 5'-GTGTTTAAATTGAAATTAAGCC-3'.

[0017] In the above application, a 228-bp fragment is obtained by PCR amplification. When detected by sequencing, a cucumber material with a base T at the 26th position of the PCR-amplified fragment is a cucumber material with a high malic acid content in the fruit, and a cucumber material with a base C at the 26th position of the PCR-amplified fragment is a cucumber material with a low malic acid content in the fruit.

[0018] Preferably, in the above application, the reaction system for PCR amplification includes a DNA template, amplification primers, 2×3G TaqMaster Mix for PAGE, and double-distilled water.

[0019] Preferably, in the above application, the reaction program for PCR amplification is: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 30 s, for 35 cycles; incubation at 72°C for 5 min.

[0020] In the above application, a 228-bp fragment is obtained by PCR amplification. When detected by restriction enzyme digestion electrophoresis, the restriction enzyme is RsaI. If a 228-bp band is obtained after electrophoresis of the digested product, the test object is a material with a high malic acid content; if a 204-bp band is obtained after electrophoresis of the digested product, the test object is a material with a low malic acid content.

[0021] Preferably, in the above application, the system for RsaI digestion is: 3 μl of PCR product, 0.2 μl of restriction enzyme, 1 μl of NEBcutsmart buffer, and 5.8 μl of double-distilled water;

[0022] The digestion temperature is 37°C and the digestion time is 2 h.

[0023] The third aspect of the present invention provides a kit for detecting the above SNP molecular marker, which includes the amplification primers dcaps-04-F and dcaps-04-R for the SNP molecular marker, and the nucleic acid sequences of the primers are as follows:

[0024] dcaps-04-F: 5'-TATTTAATGCCCTAAAAAACAAGTA-3',

[0025] dcaps-04-R: 5'-GTGTTTAAATTGAAATTAAGCC-3'.

[0026] Preferably, the kit further includes a cucumber genomic DNA extraction reagent, a PCR amplification reaction reagent, a PCR amplification product sequencing reagent, or an SNP differential site recognition reagent; preferably, the SNP differential site recognition reagent includes a restriction enzyme capable of recognizing SNP differential sites.

[0027] The beneficial effects of the present invention are:

[0028] The present invention not only lays a foundation for the fine mapping and molecular cloning of the trait of high malic acid content in cucumber fruits, but also provides an efficient approach for the molecular marker-assisted breeding of new cucumber varieties with high malic acid content in fruits.

[0029] The present invention provides the application of the developed SNP markers for assisting in screening new cucumber varieties with high malic acid content in fruits. The genomic DNA of the material to be tested is amplified using the specific primers dcaps-04-F / dcaps-04-R of the SNP markers, and then the amplified products are identified by sequencing or RsaI digestion. Through the technical solution provided by the present invention, the screening of materials with high / low malic acid content in cucumber fruits can be carried out at any stage of cucumber candidate materials, which has the advantages of high efficiency, few limitations, and accuracy, improves the efficiency of breeding cucumber varieties with high malic acid content in fruits, and shortens the breeding cycle. Brief Description of the Drawings

[0030] Figure 1 It is the electrophoretic detection result after digestion of the SNP marker (SNP4352029) of the present invention for detecting cucumber parental materials 65G (P1), 02245 (P2), and individual plants of the F1 generation; Lanes 1-3 are the detection results of parental materials 65G (P1), 02245 (P2), and individual plants of the F1 generation respectively; among them, P1: 65G (with high malic acid content in fruits) obtains a 228 bp fragment, P2: 02245 (with low malic acid content in fruits) obtains a 204 bp fragment, and both 228 bp and 204 bp fragments are detected in the F1 generation.

[0031] Figure 2 It is the molecular detection result of using cucumber materials to verify the SNP marker (SNP4352029) for 40 materials. Detailed Embodiments

[0032] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereby.

[0033] In the following embodiments, the experimental reagents not specifically described are conventional reagents in the art, which can be prepared according to the conventional methods in the art or obtained by commercial purchase; the experimental methods not specifically described are all conventional methods in the art, and can refer to the Molecular Cloning Experiment Manual (Sambrook J & Russell DW, Molecular cloning: a laboratory manual, 2001), or refer to the methods described in the manufacturer's instructions.

[0034] Materials and Methods

[0035] 65G (P1): A European greenhouse-type cucumber female line selected by the cucumber research group of the Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences. It has strong growth vigor, large leaves, many consecutive fruit set, about 18 cm long fruits, smooth peel, no spines or tubercles, and is a material with high malic acid content. It is an existing known variety and is also recorded in the article "New Cucumber Variety 'Zhongnong No. 19'" published by Gu Xingfang et al. on page 690 of the third issue of Acta Horticulturae Sinica in 2006. It is preserved in this laboratory and is guaranteed to be distributed to the public for verification experiments within twenty years from the application date.

[0036] 02245 (P2): A North China dense-thorn type cucumber inbred line selected by the cucumber research group of the Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences. It has strong growth vigor, medium-sized leaves, dark green fruit strips, about 35 cm long fruits, white thorns, dense, small tubercles, no ribs and no stripes, and is a material with low malic acid content. It is an existing known variety and is also recorded in the article "Breeding of a New Heat-tolerant Cucumber Variety Zhongnong No. 106" published by Gu Xingfang et al. on pages 31 - 33 of the 6th issue of China Vegetables in 2008. It is preserved in this laboratory and is guaranteed to be distributed to the public for verification experiments within twenty years from the application date.

[0037] 65G and 02245 were used to hybridize with '65G' as the female parent and '02245' as the male parent to obtain F1, and an F9 generation RILs population containing 140 lines was obtained by the single-seed descent method. 40 of these materials were used for verification experiments.

[0038] All experimental materials are preserved in the cucumber research group laboratory of the Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, and are guaranteed to be distributed to the public for verification experiments within twenty years from the application date.

[0039] The dcaps-04 marker primer was designed by this laboratory based on the re-sequenced genomic information using dCAPS finder 2.0 software (http: / / helix.wustl.edu / dcaps / dcaps.html) and primer 3.0 software, and was synthesized by Beijing Sangon Biotech Co., Ltd. The details of the re-sequenced genomic information can be found in the paper "A genomic variation map provides insights into the genetic basis of cucumber domestication and diversity" published by Qi et al. in the journal Nature Genetics in 2013.

[0040] Main Reagents

[0041] The PCR experiment used 2×3G Taq Master Mix for PAGE (RedDye) from Vazyme; the digestion used the restriction endonuclease RsaI from New England Biolabs; the gel electrophoresis used 40% non-denaturing polyacrylamide from Beijing Coolaber Technology Co., Ltd., which was diluted to 6% before use. Sequencing was performed by Beijing Sangon Biotech Co., Ltd.

[0042] Detection method for the content of malic acid in cucumber in the examples:

[0043] Select commercial cucumbers at the 15 - 20th node of the cucumber plant with appropriate size and transfer them to the laboratory within 1 hour. Cut about 3 cm thick slices evenly at the head, middle, and tail of the fruit. After chopping and mixing, take 100 g and break it with a homogenizer, store it in a -20°C refrigerator, and then send it to the Vegetable Quality Supervision, Inspection and Testing Center of the Ministry of Agriculture and Rural Affairs of Beijing for determination of the content of malic acid (detected by high performance liquid chromatography).

[0044] Example 1. Obtaining SNP markers linked to high malic acid content in cucumber fruits

[0045] Based on the resequencing information of the core germplasm population, SNPs with a minor allele frequency (MAF) greater than 0.5 and a missing rate less than 20% were first screened. Association analysis was performed in combination with the malic acid content data, using the FaST-LMM (Factored Spectrally Transformed Linear Mixed Models) model, and significant associated loci were screened with -log 10 (P)=5 as the threshold. Manhattan plots and QQ-plot graphs were drawn using the R package CMplot. The loci related to the malic acid content in cucumber fruits were mapped to chromosome 4, and the position of the maximum threshold point was SNP4352029. Based on the above results, this study was carried out.

[0046] I. Obtaining SNP markers

[0047] Combined with the malic acid content and resequencing data of 130 core germplasm populations, using GWAS analysis, at the physical position of 4,352,029 bp on chromosome 4 of cucumber, the SNP marker SNP4352029 (T / C) linked to high malic acid content in cucumber fruits was obtained. It was found that in the genome of cucumber material 65G (high malic acid content, with a malic acid content of 10.79 g / kg in its cucumber fruits), the base at this locus was T; in the genome of cucumber material 02245 (low malic acid content, with a malic acid content of 4.07 g / kg in its cucumber fruits), the base at this locus was C.

[0048] II. Developing dCAPS markers based on SNP markers

[0049] Based on the obtained SNP marker SNP4352029 linked to the high malic acid content in cucumber fruits, a dCAPS marker (named dcaps-04) linked to the high malic acid content in cucumber fruits was developed. The DNA sequence of the above-mentioned segment of the cucumber chr.4 chromosome reference genome (the reference genome sequence of the North China type cucumber line "9930", version number Cucumber(Chinese Long)v3 Genome) was downloaded through the cucumber genome database website (http: / / cucurbitgenomics.org / ). According to the position of the SNP, a pair of primers was designed using the dCAPS Finder 2.0 (http: / / helix.wustl.edu / dcaps / dcaps.html) website and the primer 3.0 software:

[0050] dcaps-04-F (SEQ ID NO.1): 5'-TATTTAATGCCCTAAAAAACAAGTA-3',

[0051] dcaps-04-R (SEQ ID NO.2): 5'-GTGTTTAAATTGAAATTAAGCC-3'.

[0052] Due to the relationship of the above-mentioned obtained SNP (SNP = T / C), when the base C exists, a recognition sequence (GT↓AC, ↓ is the cleavage site) of the restriction endonuclease RsaI is formed, and the amplified fragment can be cleaved by the endonuclease RsaI; when the base T exists, the recognition sequence of the restriction endonuclease RsaI cannot be formed, and the amplified fragment cannot be cleaved by the endonuclease RsaI.

[0053] PCR amplification was performed on the parental materials 65G and 02245 using the above primers (dcaps-04-F / dcaps-04-R). In the material 65G (high malic acid content), a 228bp band (nucleotide sequence as shown in SEQ ID NO.3) was obtained; in the material 02245 (low malic acid content), a 228bp band (nucleotide sequence as shown in SEQ ID NO.4) was also obtained. Combining the restriction endonuclease RsaI to digest the amplified fragment, a specific band ( Figure 1 ) was obtained. In the material 65G (high malic acid content), a 228bp band (nucleotide sequence as shown in SEQ ID NO.3) was obtained, and in the material 02245 (low malic acid content), a 204bp band (nucleotide sequence as shown in SEQ ID NO.5) was obtained.

[0054] The specific operation method for detection is as follows:

[0055] Step 1. DNA Extraction and PCR Amplification

[0056] Take the young leaves of cucumber plants, and extract the genomic DNA of the parents 65G (P1) and 02245 (P2), as well as the F1 and RILs populations using the improved CTAB (cetyltrimethylammonium bromide) method.

[0057] The PCR reaction system for dCAPS markers is as follows: the total reaction system is 10 μL, including 3 μL of DNA (5.0 ng·μL -1 ), 1 μL each of the forward and reverse primers dcaps-04-F / dcaps-04-R (concentration 50 ng·μL -1 ), and 5 μL of 2×3G Taq Master Mix for PAGE (Red Dye) (product of Vazyme).

[0058] The PCR amplification program is as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 30 s, for 35 cycles; incubation at 72°C for 5 min, and storage at 16°C.

[0059] Step 2. Complete Digestion of PCR Products with RsaI

[0060] The digestion system is as follows: 3 μl of PCR product, 0.2 μl of endonuclease, 1 μl of NEB cutsmart buffer, and 5.8 μl of double-distilled water. The digestion temperature is 37°C, and the digestion time is 2 h.

[0061] Step 3. Result Judgment

[0062] Method 1: Skip Step 2, without digestion, directly sequence the PCR products. The sequence obtained from material 65G (high malonic acid content) has a base T at the 26th position; the sequence obtained from material 02245 (low malonic acid content) has a base C at the 26th position; the sequence obtained from F1 has two bases, T and C, present at this position.

[0063] Method 2: After complete digestion with the endonuclease RsaI, separate the digestion products using 6% non-denaturing polyacrylamide gel. The electrophoresis buffer is 0.5×TBE, perform electrophoresis separation at a constant power of 150 V for 1 h, and after electrophoresis, stain with silver and develop the color, then count the band patterns.

[0064] As Figure 1 shown, material 65G (high malonic acid content) yields a 228-bp fragment, and the band pattern is denoted as a; material 02245 (low malonic acid content) yields a 204-bp fragment, and the band pattern is denoted as b; both bands are detected in F1, and the band pattern is denoted as h, and its field phenotype is a high malonic acid content in fruits (8.91 g / kg).

[0065] Fragment (228bp) linked to low malic acid in cucumber, SEQ ID NO.3:

[0066] TATTTAATGCCCTAAAAAACAAGTA C GAAACAAACACATCATAAACTACCAATCCTAT

[0067] CTCTTCTCTTCTCATTGCCTTCTTACTTTAATGTGATCAAATTAAATCTTTTTTATTTCC

[0068] ACCTAATTTCATTCCGGATTCAAATCTATTTTAACCCATCCATGTTATTTTTAAATTAATTATATTTTCAAAATTATTATTAATATTTGGCTTAATTTCAATTTAAACAC。

[0069] Fragment (228bp) linked to high malic acid in cucumber, SEQ ID NO.4:

[0070] TATTTAATGCCCTAAAAAACAAGTA T GAAACAAACACATCATAAACTACCAATCCTAT

[0071] CTCTTCTCTTCTCATTGCCTTCTTACTTTAATGTGATCAAATTAAATCTTTTTTATTTCC

[0072] ACCTAATTTCATTCCGGATTCAAATCTATTTTAACCCATCCATGTTATTTTTAAATTAATTATATTTTCAAAATTATTATTAATATTTGGCTTAATTTCAATTTAAACAC。

[0073] Fragment (204bp) generated after digestion of the fragment linked to low malic acid in cucumber by RsaI, SEQ ID NO.5: A CGAAACAAACACATCATAAACTACCAATCCTATCTCTTCTCTTCTCATTGCCTTCTTACTTTAATGTGATCAAATTAAATCTTTTTTATTTCCACCTAATTTCATTCCGGATTCAAATCTATTTTAACCCATCCATGTTATTTTTAAATTAATTATATTTTCAAAATTATTATTAATATTTGGCTTAATTTCAATTTAAACAC。

[0074] Example 2. Verification of SNP Markers Linked to High Malic Acid Content in Cucumber Fruits

[0075] Using 40 recombinant inbred line materials preserved by this research group, the SNP marker (dcaps-04) linked to high malic acid content in fruits obtained in Example 1 was verified to determine the accuracy of this marker for molecular marker-assisted selection. The verification method adopted Steps 1 to 3 described in Example 1. The results of field identification and molecular verification are shown in Table 1, and the enzyme digestion bands of PCR products are shown in Figure 2 .

[0076] Table 1. Determination of Malic Acid Content in Fruits of 40 Cucumber Recombinant Inbred Line Materials and Results of Molecular Verification

[0077]

[0078]

[0079] According to the clustering analysis results of the detection results of the malic acid content in fruits of the RILs population of 140 lines obtained by this research group in the early stage (using '65G' as the female parent and '02245' as the male parent to hybridize to obtain F1, and obtaining the F9 generation RILs population containing 140 lines by the single-seed descent method), the materials were divided into three categories. Cucumber fruits with malic acid content above 8.05 g / kg were high malic acid materials, those between 6.43 - 8.05 g / kg were medium malic acid content materials, and those below 6.43 g / kg were low malic acid content materials.

[0080] After investigation, among the 40 cucumber materials used for verification in Table 1, field phenotypic identification showed that there were extremely significant differences in the malic acid content between the materials with low malic acid content and those with high malic acid content. There were 20 materials with a field phenotypic malic acid content of low malic acid content (below 6.43 g / kg), and the average malic acid content of the fruits was 5.16 g / kg. Among them, the enzymatic digestion electrophoresis band types of 16 materials were b, and those of 4 materials were a. The correct rate of molecular identification in these 20 materials was 80%. In addition, the field phenotypic identification of another 20 cucumber materials was high malic acid content (above 8.05 g / kg), and the average malic acid content of the fruits was 9.76 g / kg. Among them, the enzymatic digestion electrophoresis band types of 17 materials were a, and those of 3 materials were b. The correct rate of molecular identification in these 20 materials was 85%.

[0081] In the identification of all 40 materials, the phenotypic data reflected by the electrophoresis band types of the SNP markers of the present invention were consistent with the actual malic acid content measurement results in 33 of the 40 materials. The overall correct rate of the molecular identification results was 82.5%. The molecular identification method of the present invention can be used to identify cucumber materials with high malic acid content for molecular assisted breeding.

Claims

1. A SNP molecular marker for identifying high / low malonic acid content in cucumber fruit, characterized in that: The site of the SNP marker is at the physical position 4,352,029bp of chromosome 4 of cucumber. The base of the site is C or T. The cucumber material with the base T at the site is a cucumber material with high succinic acid content in the fruit, and the cucumber material with the base C at the site is a cucumber material with low succinic acid content in the fruit.

2. Use of the SNP molecular marker for identifying high / low malonic acid content in cucumber fruit according to claim 1 in any of the following (1)-(3): (1) Identify or assist in identifying materials with high / low tartronic acid content in cucumber fruits; (2) screening or assisting in screening cucumber varieties with high succinic acid content in fruits; (3) Cultivating or assisting in the cultivation of cucumber varieties with high succinic acid content in fruits; The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.3 or SEQ ID NO.4, wherein the 26th base is C or T, and the cucumber material whose base at this position is C is a cucumber material with low succinic acid content in the fruit, and the cucumber material whose base at this position is T is a cucumber material with high succinic acid content in the fruit.

3. The use according to claim 2, characterized in that: The application comprises the following steps: extracting genomic DNA of the sample to be tested as a template, performing PCR amplification using the amplification primers of the SNP molecular marker, and sequencing or enzyme-cutting electrophoresis detection on the PCR amplification product. The enzyme-cutting electrophoresis detection refers to using a restriction endonuclease that can recognize the difference site of the SNP molecular marker to cut the PCR amplification product, and then performing electrophoresis on the amplification product; preferably, the electrophoresis uses non-denaturing polyacrylamide gel electrophoresis.

4. The use according to claim 3, characterized in that: The amplification primers of the SNP molecular markers are as follows: dcaps-04-F:5'-TATTTAATGCCCTAAAAAACAAGTA-3', dcaps-04-R:5'-GTGTTTAAATTGAAATTAAGCC-3'.

5. The use according to claim 4, characterized in that: A 228 bp fragment was obtained by PCR amplification. When sequencing was used for detection, the cucumber material whose 26th base of the PCR amplification fragment was T was the cucumber material with high succinic acid content in the fruit, and the cucumber material whose 26th base of the PCR amplification fragment was C was the cucumber material with low succinic acid content in the fruit.

6. The use according to claim 4 or 5, characterized in that: The reaction system of PCR amplification includes DNA template, amplification primers, 2×3G Taq Master Mix for PAGE, and double distilled water.

7. The use according to claim 6, characterized in that: The reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 30 s, 35 cycles; and insulation at 72°C for 5 min.

8. The use according to claim 4, characterized in that: A 228 bp fragment is obtained by PCR amplification. When enzyme digestion and electrophoresis are used for detection, the restriction endonuclease is RsaI. If a 228 bp band is obtained by electrophoresis after enzyme digestion, the detection object is a material with a high succinic acid content; if a 204 bp band is obtained by electrophoresis after enzyme digestion, the detection object is a material with a low succinic acid content.

9. The use according to claim 8, characterized in that: The system for RsaI digestion was as follows: PCR product 3 μl, endonuclease 0.2 μl, NEB cutsmart buffer 1 μl, double distilled water 5.8 μl; The enzyme digestion temperature was 37°C and the enzyme digestion time was 2 h.

10. A kit for detecting the SNP molecular marker according to claim 1, characterized in that: The amplification primers dcaps-04-F and dcaps-04-R containing the SNP molecular marker, the nucleic acid sequences of the primers are as follows: dcaps-04-F:5'-TATTTAATGCCCTAAAAAACAAGTA-3', dcaps-04-R:5'-GTGTTTAAATTGAAATTAAGCC-3'. Preferably, the kit further comprises a cucumber genomic DNA extraction reagent, a PCR amplification reaction reagent, a PCR amplification product sequencing reagent or a SNP differential site recognition reagent; preferably, the SNP differential site recognition reagent comprises a restriction endonuclease capable of recognizing SNP differential sites.

Images