Application of Nlrp3 gene and / or knockout reagent thereof in construction of arterial vascular calcification animal model

Abstract

The invention relates to application of an Nlrp3 gene and / or a knockout reagent thereof in construction of an arterial vascular calcification animal model. The construction method of the arterial vascular calcification animal model comprises the following steps: (1) constructing a gene editing system for targeted knockout of a mouse Nlrp3 gene; (2) performing gene editing on a mouse fertilized egg by using the gene editing system in the step (1), and inserting loxP sites at two ends of the Nlrp3 gene; and (3) carrying out mating propagation on the mouse obtained in the step (2) and a mouse expressing Cre recombinase to obtain a mouse of which the Nlrp3 gene is knocked out, and culturing to obtain the arterial vascular calcification animal model. The arterial vascular calcification mouse is obtained by specifically knocking out the Nlrp3 gene of the mouse, and the arterial vascular calcification mouse has important application value in the aspects of mechanism exploration of arterial vascular calcification diseases and drug research and development.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to the application of the Nlrp3 gene and / or its knockout reagent in constructing an animal model of arterial vascular calcification. Background Art

[0002] Vascular calcification is a common pathological manifestation of atherosclerosis (As), hypertension, diabetic angiopathy, vascular injury, chronic kidney disease, and aging. It is mainly manifested as an increase in vascular wall stiffness and a decrease in compliance, which easily leads to myocardial ischemia, left ventricular hypertrophy, and heart failure, and triggers thrombosis and plaque rupture. It is one of the important factors for the high incidence and high mortality of cardiovascular and cerebrovascular diseases. The mechanism of vascular calcification is complex. Previous mechanism studies have revealed the importance of vascular smooth muscle cell transdifferentiation, phosphorus and calcium environment, and matrix vesicles in the progression of vascular calcification. However, the potential molecular mechanism of vascular calcification still needs to be clarified. There is currently no effective treatment for vascular calcification. Therefore, animal models of vascular calcification are crucial for studying pathological mechanisms and developing treatment methods.

[0003] Currently, animal models of vascular calcification mainly include those induced by drugs (such as vitamin D3 induction, warfarin induction, etc.), those caused by chronic kidney disease (such as vitamin D3 combined with subtotal nephrectomy), and gene knockout animal models of vascular calcification. For example, CN117210497A discloses the application of the Abcg4 gene in constructing a mouse model of cerebral atherosclerosis with pulmonary enlargement. By knocking out the Abcg4 gene in mice, the mouse model of cerebral atherosclerosis with pulmonary enlargement is obtained. These models and methods provide important tools for studying vascular calcification, help to deeply understand its pathophysiological process, and provide an experimental basis for developing new treatment methods. Developing animal models of vascular calcification with different induction mechanisms is of great significance for deeply understanding pathological mechanisms and expanding treatment methods.

[0004] In summary, developing a new method for constructing an animal model of arterial vascular calcification is of great significance in the field of treating vascular calcification-related diseases. Summary of the Invention

[0005] To solve the above technical problems, the present invention provides the application of the Nlrp3 gene and / or its knockout reagent in constructing an animal model of arterial vascular calcification. By specifically knocking out the Nlrp3 gene in mice, a mouse model of arterial vascular calcification is obtained, which has important application value in exploring the mechanism of arterial vascular calcification diseases and drug discovery.

[0006] To achieve this purpose, the present invention adopts the following technical solutions:

[0007] In a first aspect, the present invention provides the application of the Nlrp3 gene and / or its knockout reagent in constructing an animal model of arterial vascular calcification.

[0008] Preferably, the application specifically includes knocking out the Nlrp3 gene in experimental animals to obtain an animal model of arterial vascular calcification.

[0009] In the present invention, a new construction strategy is designed, and it is found that knocking out the Nlrp3 gene can effectively induce calcium salt deposition in the aorta of animals, thereby constructing an animal model of arterial vascular calcification, which can be used for simulating vascular calcification-related diseases, analyzing the pathogenesis, and screening and testing therapeutic drugs, methods, etc.

[0010] In a second aspect, the present invention provides a method for constructing an animal model of arterial vascular calcification, and the method for constructing the animal model of arterial vascular calcification includes the following steps:

[0011] (1) Construct a gene editing system for targeted knockout of the Nlrp3 gene in mice;

[0012] (2) Use the gene editing system described in step (1) to perform gene editing on mouse fertilized eggs, and insert loxP sites at both ends of the Nlrp3 gene;

[0013] (3) Breed the mice obtained in step (2) with mice expressing Cre recombinase to obtain mice with the Nlrp3 gene knocked out, and after culturing, obtain the animal model of arterial vascular calcification.

[0014] The method for constructing an animal model of arterial vascular calcification provided by the present invention solves the problems of high gene off-target rate and low animal survival rate in traditional gene knockout technologies, avoids the problem of gene embryonic lethality, and the obtained gene-edited mouse model has important clinical transformation value for exploring the mechanism of arterial vascular calcification diseases and drug research and development.

[0015] Preferably, the gene editing system includes sgRNA targeting the Nlrp3 gene in mice, Cas enzyme, and homologous recombination repair template ssDNA.

[0016] Preferably, the nucleic acid sequence of the sgRNA includes the sequences shown in SEQ ID NO.1 to SEQ ID NO.2.

[0017] Preferably, the Cas enzyme includes Cas9 enzyme.

[0018] Preferably, the homologous recombination repair template ssDNA contains loxP sites.

[0019] Preferably, the nucleic acid sequence of the homologous recombination repair template ssDNA includes the sequence shown in SEQ ID NO.3.

[0020] SEQ ID NO.1: TAGGTGGTATGACCGGACAGAGG。

[0021] SEQ ID NO.2: CGTCTCAGAACGACGGAATCAGG。

[0022] SEQ ID NO.3: ATAACTTCGTATAGCATACATTATACGAAGTTAT。

[0023] The sgRNA targeting the mouse Nlrp3 gene designed in the present invention has high editing efficiency and low off-target rate.

[0024] Preferably, the initial mouse for constructing the model can be a C57BL / 6 mouse or the like.

[0025] Preferably, the mouse expressing Cre recombinase can be a Cdh16-Cre mouse or the like.

[0026] Preferably, the method for constructing the arterial vascular calcification animal model includes the following steps:

[0027] (1) Prepare the CRISPR-Cas9 gene editing system, including sgRNA, mRNA of Cas9 enzyme and homologous recombination repair template ssDNA. The nucleic acid sequence of the sgRNA includes the sequences shown in SEQ ID NO.1 to SEQ ID NO.2, and the nucleic acid sequence of the homologous recombination repair template ssDNA includes the sequence shown in SEQ ID NO.3;

[0028] (2) Simultaneously introduce sgRNA, mRNA of Cas9 enzyme and homologous recombination repair template ssDNA into mouse fertilized eggs to obtain gene recombinant fertilized eggs with loxP sites inserted at both ends of the Nlrp3 gene. Transplant the surviving fertilized eggs after introduction into the uterus of pseudopregnant female mice to obtain F0 generation mice;

[0029] (3) Mate the positive mice in the F0 generation with wild-type mice to obtain F1 generation mice, and cross the F1 generation heterozygous mice to obtain F2 generation homozygous mice and F2 generation heterozygous mice;

[0030] (4) Mate the F2 generation homozygous mice or F2 generation heterozygous mice with mice expressing Cre recombinase to obtain F3 generation mice;

[0031] (5) Backcross the F3 generation mice with the F2 generation homozygous mice to obtain mice with the Nlrp3 gene knocked out;

[0032] (6) Culture the mice with the Nlrp3 gene knocked out to obtain the arterial vascular calcification animal model.

[0033] In a third aspect, the present invention provides the use of an animal model constructed by the method for constructing an animal model of arterial vascular calcification described in the second aspect in analyzing the pathogenesis of arterial vascular calcification or in preparing products for diagnosing and monitoring arterial vascular calcification.

[0034] Based on the animal model of arterial vascular calcification constructed by the present invention, the pathogenesis of arterial vascular calcification can be further analyzed, or products for diagnosing and monitoring arterial vascular calcification can be developed and tested, etc.

[0035] In a fourth aspect, the present invention provides the use of an animal model constructed by the method for constructing an animal model of arterial vascular calcification described in the first aspect in evaluating and / or screening treatment methods or therapeutic drugs for arterial vascular calcification.

[0036] Based on the animal model of arterial vascular calcification constructed by the present invention, treatment methods or therapeutic drugs for diseases related to arterial vascular calcification can be further evaluated and / or screened, and effective treatment regimens can be developed by testing the effects of the treatment methods or drugs to be screened on the animal model.

[0037] Compared with the prior art, the present invention has the following beneficial effects:

[0038] The present invention designs a brand-new construction strategy and a gene editing system. Knocking out the Nlrp3 gene can effectively induce calcium salt deposition in the aorta of animals, obtaining a mouse model of arterial vascular calcification, which can be used for the simulation of diseases related to vascular calcification, the analysis of pathogenesis, and the screening and testing of therapeutic drugs and methods, etc., and is of great significance for the field of treating diseases related to vascular calcification. Brief Description of the Drawings

[0039] Figure 1 It is a schematic diagram of the knockout principle;

[0040] Figure 2 It is a graph of the genotyping results of homozygotes;

[0041] Figure 3 It is a graph of the genotyping results of Cdh16-Cre;

[0042] Figure 4 It is a graph of the verification results of gene knockout;

[0043] Figure 5 It is a graph of the alizarin red staining results of the aortas of mice in the model group and the normal control group. Detailed Embodiments

[0044] To further elaborate on the technical means adopted by the present invention and their effects, the present invention will be further described below in conjunction with examples and drawings. It can be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0045] For those not specifying particular techniques or conditions in the examples, follow the techniques or conditions described in the literature in this field or the product specifications. For reagents or instruments without indicating the manufacturer, they are all conventional products that can be obtained through regular commercial channels.

[0046] In the present invention, a conditional gene knockout animal model can be achieved through the Cre-LoxP specific recombinase system. Hybridizing transgenic mice carrying specific loxP sites (Flox mice) with transgenic mice specifically expressing Cre enzyme in cells (Cre mice) can obtain mice with gene knockout in specific tissue cells. This method of conditional gene knockout requires constructing two types of transgenic mice (Flox mice and Cre mice) simultaneously, and changing the gene promoter of the Cre enzyme can achieve gene knockout under multiple conditions (such as drug induction, specific time, specific tissue, etc.). The knockout schematic diagram is as Figure 1 shown.

[0047] Example 1

[0048] This example provides a mouse specifically knocking out the Nlrp3 gene. The mouse used for knocking out the Nlrp3 gene is a C57BL / 6NCya background strain mouse. The preparation process includes the following steps:

[0049] (1) Prepare sgRNA targeting the mouse Nlrp3 gene, Cas9 mRNA, and homologous recombination repair template ssDNA respectively. The nucleic acid sequence of the sgRNA is as shown in SEQ ID NO.1 to SEQ ID NO.2, and the nucleic acid sequence of the homologous recombination repair template ssDNA is as shown in SEQ ID NO.3.

[0050] (2) Electroporate the sgRNA, Cas9 mRNA, and homologous recombination repair template ssDNA into mouse fertilized eggs simultaneously. After gene integration, obtain gene recombinant fertilized eggs with loxP sites inserted into the Nlrp3 gene. Transplant the surviving fertilized eggs after electroporation into the uterus of pseudopregnant female mice to obtain F0 generation mice.

[0051] (3) Mate the positive mice in the F0 generation with wild-type mice to obtain F1 generation mice. Cross the F1 generation heterozygous mice to obtain F2 generation homozygous Flox mice and F2 generation heterozygous Flox mice.

[0052] (4) Mate the F2 generation homozygous Flox mice or F2 generation heterozygous Flox mice with Cdh16-Cre mice to obtain F3 generation mice.

[0053] (5) Backcross the F3 generation mice with the F2 generation homozygous Flox mice to screen for Nlrp3[flox / flox, Cdh16-Cre] mice and obtain mice specifically knocking out the Nlrp3 gene.

[0054] Example 2

[0055] This example provides a method for constructing an animal model of arterial vascular calcification, including the following steps:

[0056] Take mice with specific knockout of the Nlrp3 gene, culture them until they are 18 - 22 weeks old, allow them to eat and drink freely in an SPF - level environment, control the room temperature at (21 ± 2) °C, and the relative humidity at (50 ± 15)%, and continue to feed them for 7 weeks until the mice are 25 - 29 weeks old to obtain the animal model of arterial vascular calcification, and use ordinary C57BL / 6 mice cultured under the same conditions as the healthy control group.

[0057] Test Example 1

[0058] This test example performs PCR amplification on the genome of the animal model of arterial vascular calcification obtained in Example 2.

[0059] Extract genomic DNA using the TaKaRa MiniBEST Universal Genomic DNA Extraction Kit (Ver.5.0_Code No.9765).

[0060] The PCR reaction system is shown in Table 1, and the reaction program is shown in Table 2.

[0061] Table 1

[0062] Component Volume <![CDATA[ddH2O]]> 9.0 μL Forward primer F 1.0 μL Reverse primer R 1.0 μL Premix Taq 12.5 μL Genomic DNA 1.5 μL

[0063] Primer F2: 5’ - TTGTGGAGGATGGGAAGTCTAAAG - 3’.

[0064] Primer R2: 5’ - CTCAGATAGACACCATCGTCTCAG - 3’.

[0065] Primer F3: 5’ - CAGAATTTTGGGAGCCTGATACACT - 3’.

[0066] Cdh16 - Cre verification primer: F: 5’ - GCAGATCTGGCTCTCCAAAG - 3’; R: 5’ - AGGCAAATTTTGGTGTACGG - 3’.

[0067] Table 2

[0068]

[0069] Amplify respectively using primer F2, R2 and Cdh16 - Cre verification primer, analyze the genotype, and the results of agarose gel electrophoresis of the PCR products are as Figure 2 and Figure 3As shown, WT is the wild-type control, Water represents the blank reaction control without DNA template. For the flox / flox, Cdh16-Cre homozygous genotype, the amplified target product size is 251bp, the wild-type allele target product size is 191bp, and the Cre amplified target product size is approximately 420bp.

[0070] The gene knockout was verified by amplifying with primers F3 and R2. The electrophoresis results of the amplified products are as Figure 4 shown (verified in multiple model mice), and the target product size is 467bp.

[0071] Based on the above results, the present invention successfully constructed a mouse model with Nlrp3 gene knockout.

[0072] Test Example 2

[0073] In this test example, the mouse model of arterial vascular calcification and the control group mice prepared in Example 2 were taken. The aorta was embedded, sectioned, and subjected to alizarin red (vascular calcification) pathological staining. The staining steps are as follows:

[0074] 1. Sample fixation

[0075] Fix with 4% paraformaldehyde (fix for 20 min), then wash 3 times with PBS to remove residual fixative.

[0076] 2. Staining

[0077] Prepare 1% alizarin red S solution, usually adjust the pH with deionized water at pH 4.2.

[0078] Immerse the sample in the alizarin red S staining solution and stain for 20 min.

[0079] 3. Rinsing

[0080] Gently rinse the sample with deionized water several times until there is no obvious residual staining solution in the background.

[0081] Subsequently, microscopic observation can be carried out.

[0082] The staining results are as Figure 5 shown. For the aorta of normal C57BL / 6 mice stained with alizarin red, there is no obvious calcium salt deposition, while for the aorta of the mouse model of arterial vascular calcification stained with alizarin red, the aorta is deeply stained and calcium salt deposition is obvious, indicating that the mouse model of arterial vascular calcification was successfully constructed.

[0083] In summary, the present invention designs a brand-new construction strategy and a gene editing system. Knocking out the Nlrp3 gene can effectively induce aortic calcium salt deposition in animals, and an animal model of arterial vascular calcification is obtained. This model can be used for the simulation of vascular calcification-related diseases, the analysis of pathogenesis, and the screening and testing of therapeutic drugs and methods, etc., which is of great significance for the field of treating vascular calcification-related diseases.

[0084] The applicant declares that the above description is only the specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed by the present invention fall within the protection scope and the disclosure scope of the present invention.

Claims

1. Application of Nlrp3 gene and / or its knockout reagent in constructing an animal model of arterial vascular calcification.

2. The application according to claim 1, characterized in that, The specific application includes knocking out the Nlrp3 gene of the experimental animal to obtain an animal model of arterial vascular calcification.

3. A method for constructing an animal model of arterial vascular calcification, characterized in that, The method for constructing the animal model of arterial vascular calcification includes the following steps: (1) Construct a gene editing system targeting the Nlrp3 gene of mice; (2) Use the gene editing system described in step (1) to perform gene editing on mouse fertilized eggs, and insert loxP sites at both ends of the Nlrp3 gene; (3) Breed the mice obtained in step (2) with mice expressing Cre recombinase to obtain mice with the Nlrp3 gene knocked out, and after culturing, obtain the animal model of arterial vascular calcification.

4. The method for constructing an animal model of arterial vascular calcification according to claim 3, characterized in that The gene editing system includes sgRNA targeting the Nlrp3 gene of mice, Cas enzyme, and homologous recombination repair template ssDNA.

5. The method for constructing an animal model of arterial vascular calcification according to claim 4, characterized in that, The nucleic acid sequence of the sgRNA includes the sequences shown in SEQ ID NO.1 to SEQ ID NO.

2.

6. The method for constructing an animal model of arterial vascular calcification according to claim 4, characterized in that, The Cas enzyme includes Cas9 enzyme.

7. The method for constructing an animal model of arterial vascular calcification according to claim 4, characterized in that, The homologous recombination repair template ssDNA contains loxP sites; Preferably, the nucleic acid sequence of the homologous recombination repair template ssDNA includes the sequence shown in SEQ ID NO.

3.

8. The method for constructing an animal model of arterial vascular calcification according to any one of claims 3 to 7, characterized in that The method for constructing the animal model of arterial vascular calcification includes the following steps: (1) Prepare a CRISPR-Cas9 gene editing system, including sgRNA, mRNA of Cas9 enzyme, and homologous recombination repair template ssDNA. The nucleic acid sequence of the sgRNA includes the sequences shown in SEQ ID NO.1 to SEQ ID NO.2, and the nucleic acid sequence of the homologous recombination repair template ssDNA includes the sequence shown in SEQ ID NO.3; (2) Simultaneously introduce sgRNA, mRNA of Cas9 enzyme, and homologous recombination repair template ssDNA into mouse fertilized eggs to obtain gene recombinant fertilized eggs with loxP sites inserted at both ends of the Nlrp3 gene. Transplant the surviving fertilized eggs after introduction into the uterus of pseudopregnant female mice to obtain F0 generation mice; (3) Breed the positive mice in the F0 generation with wild-type mice to obtain F1 generation mice, and cross the F1 generation heterozygous mice to obtain F2 generation homozygous mice and F2 generation heterozygous mice; (4) Breed the F2 generation homozygous mice or F2 generation heterozygous mice with mice expressing Cre recombinase to obtain F3 generation mice; (5) Backcross the F3 generation mice with the F2 generation homozygous mice to obtain mice with the Nlrp3 gene knocked out; (6) Take the mice with the Nlrp3 gene knocked out for culturing to obtain the animal model of arterial vascular calcification.

9. Application of the animal model constructed by the method for constructing an animal model of arterial vascular calcification according to any one of claims 3-8 in analyzing the pathogenesis of arterial vascular calcification or preparing products for the diagnosis and monitoring of arterial vascular calcification.

10. Application of the animal model constructed by the method for constructing an animal model of arterial vascular calcification according to any one of claims 3-8 in evaluating and / or screening treatment methods or therapeutic drugs for arterial vascular calcification.

Images