Tacrolimus and siRNA combined double-drug-loading microneedle as well as preparation method and application thereof
By mixing methacrylated gelatin, carrageenan, sodium alginate or polyvinyl alcohol loaded with tacrolimus and targeted siRNA at the tip of the microneedle needle, the problem of poor permeability and frequent administration of tacrolimus in the treatment of psoriasis is solved, achieving efficient and safe drug delivery and controlled release, significantly improving the therapeutic effect of psoriasis.
Patent Information
- Application Number
- CN202510419135.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-03
- Publication Date
- 2025-07-04
- Estimated Expiration
- 2045-04-03
AI Technical Summary
The existing tacrolimus ointment in treating psoriasis has problems such as poor skin permeability, low drug retention, frequent drug administration and major side effects. The efficiency of tacrolimus microneedle loading is limited, which may increase the risk of bacterial/fungal colonization.
Design a dual drug-loaded microneedle with tacrolimus combined with siRNA. By mixing methacrylated gelatin, carrageenan, sodium alginate or polyvinyl alcohol at the tip of the microneedle needle, siRNA targeting TNF-α or IL-6, to achieve efficient delivery and controlled release of drugs.
The simultaneous administration of tacrolimus and siRNA was achieved, which improved the therapeutic effect, reduced inflammatory response, reduced side effects, enhanced the permeability and controlled release of the drug, and solved the problem of frequent administration.
Smart Images

Figure CN120241771A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to a dual-drug-loaded microneedle of tacrolimus combined with siRNA, and a preparation method and application thereof. Background Art
[0002] Psoriasis is a chronic and recurrent inflammatory skin disease. It is common to have scaly erythema on the epidermis, with clear boundaries of the skin lesions, thick scales protruding above the skin surface, and obvious itching may occur. The treatment methods of psoriasis depend on its severity and location, etc. The current treatment methods are divided into 3 types, namely topical treatment, phototherapy and systemic treatment. Among them, topical treatment is mainly for patients with mild to moderate psoriasis, and the commonly used drugs mainly include macrolide immunosuppressive inhibitors, keratolytics, coal tar and glucocorticoids, etc. However, the use of a single drug has poor skin permeability, low drug skin retention rate, lack of long-term controlled release leading to frequent administration and serious side effects, such as gastrointestinal toxicity, liver damage, bone marrow suppression, and low immunity leading to infections, etc. Therefore, there is a need to develop a non-parenteral administration, highly efficient delivery, and low-side-effect drug delivery system.
[0003] In recent years, the microneedle drug delivery technology has become an emerging method for delivering biopharmaceuticals. By inserting microneedles carrying drugs into the skin for subcutaneous administration, it is safe, convenient, and has high bioavailability, and can achieve the required therapeutic effect with less dosage. Thus, it provides a new treatment plan for psoriasis.
[0004] Tacrolimus (TAC) is a calcineurin inhibitor and a macrolide antibiotic. Tacrolimus ointment is commonly used to treat psoriasis. However, as a transport carrier, the ointment cannot effectively penetrate the outermost skin barrier, which hinders the drug from penetrating deep into the dermis layer and reduces the therapeutic effect. In addition, the ointment as a delivery carrier has disadvantages such as high viscosity, greasy texture, slow skin penetration, and lack of patient compliance, etc., which limit the application of tacrolimus ointment in topical treatment.
[0005] There have been some reports on combining tacrolimus with the microneedle drug delivery technology to prepare microneedle patches containing tacrolimus for treating inflammation, tinea, etc. However, tacrolimus has low water solubility, limited microneedle drug loading efficiency, and tacrolimus may inhibit local immunity, and the microtrauma caused by microneedles may increase the risk of bacterial / fungal colonization, especially in areas with extensive skin lesions.
[0006] Therefore, improving the tacrolimus microneedle patch to better treat psoriasis is still a technical problem to be solved. Summary of the Invention
[0007] In order to solve the above technical problems, one of the purposes of the present invention is to provide a dual-drug-loaded microneedle of tacrolimus combined with siRNA.
[0008] The technical solution adopted by the present invention is as follows:
[0009] A double-loaded drug microneedle of tacrolimus combined with siRNA, comprising a backing part and a tip part arranged on one side of the backing part. The tip part is realized through the following two schemes:
[0010] Scheme A: The components of the tip part include tacrolimus, siRNA targeting TNF-α, methacrylated gelatin, carrageenan and sodium alginate. The tip part is obtained by mixing and curing these components;
[0011] Scheme B: The components of the tip part include tacrolimus, siRNA targeting IL-6 and polyvinyl alcohol. The tip part is obtained by mixing and curing these components.
[0012] Preferably, the siRNA targeting TNF-α is connected to a DNA tetrahedron through base complementary pairing. The DNA tetrahedron is composed of single-stranded DNAs S1, S2, S3, and S4 that are base complementary to each other. The sequence of S1 is as shown in SEQ ID NO:1, the sequence of S2 is as shown in SEQ ID NO:2, the sequence of S3 is as shown in SEQ ID NO:3, and the sequence of S4 is as shown in SEQ ID NO:4; The siRNA targeting TNF-α includes a sense strand and an antisense strand. The sequence of the sense strand is as shown in SEQ ID NO:5, and the sequence of the antisense strand is as shown in SEQ ID NO:6;
[0013] The siRNA targeting IL-6 is connected to a DNA tetrahedron through base complementary pairing. The DNA tetrahedron is composed of single-stranded DNAs S1, S2, S3, and S4 that are base complementary to each other. The sequence of S1 is as shown in SEQ ID NO:1, the sequence of S2 is as shown in SEQ ID NO:2, the sequence of S3 is as shown in SEQ ID NO:3, and the sequence of S4 is as shown in SEQ ID NO:4; The siRNA targeting IL-6 includes a sense strand and an antisense strand. The sequence of the sense strand is as shown in SEQ ID NO:7, and the sequence of the antisense strand is as shown in SEQ ID NO:8.
[0014] Preferably, the size of the backing part is (10 - 15) × (10 - 15) mm. The tip part is arranged at the center of the backing part and includes microneedles arranged in a 15×15 array. The height of the microneedles is 500 - 800 μm, and the distance between adjacent tips is 600 - 800 μm.
[0015] The second object of the present invention is to provide a preparation method of a double-loaded drug microneedle of tacrolimus combined with siRNA as described above, comprising the following steps:
[0016] For Scheme A:
[0017] S1. Prepare a female mold microneedle array mold according to the designed microneedle patch;
[0018] S2. Prepare the tip system: Mix methacrylated gelatin, carrageenan, and sodium alginate in proportion and heat to dissolve to obtain a base solution; Prepare a DNA tetrahedron material, the DNA tetrahedron material is connected to the siRNA targeting TNF-α, and then tacrolimus, the DNA tetrahedron material, and the base solution are mixed in a set proportion to obtain the required tip system;
[0019] S3. Assembly: Add the microneedle system solution to the female mold microneedle array mold and fill the tip part of the female mold microneedle array mold. After ultraviolet curing, continue to add the tip system until the back lining part of the female mold microneedle array mold is filled, dry for at least 24 h, and demold to obtain the required dual-loaded microneedles;
[0020] For Scheme B:
[0021] S1. Prepare a female mold microneedle array mold according to the designed microneedle patch;
[0022] S2. Prepare the tip system: Prepare a DNA tetrahedron material, the DNA tetrahedron material is connected to the siRNA targeting TNF-α, and then tacrolimus, the DNA tetrahedron material, and a polyvinyl alcohol solution are mixed in a set proportion to obtain the required tip system;
[0023] S3. Prepare the back lining solution: It is an aqueous solution of polyvinyl alcohol;
[0024] S4. Assembly: Add the tip system to the female mold microneedle array mold and fill the tip part of the female mold microneedle array mold. After drying, add the back lining solution. The back lining solution contacts the tip system and fills the back lining part of the female mold microneedle array mold. After drying, demold to obtain the required dual-loaded microneedles.
[0025] Preferably, the preparation method of the DNA tetrahedron connected to the siRNA targeting TNF-α is: Dilute the siRNA targeting TNF-α and the DNA strands constituting the DNA tetrahedron into working solutions of 10 μM respectively. After mixing the working solutions according to a stoichiometric ratio of 1:1, anneal in a PCR instrument to obtain the required DNA tetrahedron connected to the siRNA targeting TNF-α;
[0026] The preparation method of the DNA tetrahedron connected to the siRNA targeting IL-6 is: Dilute the siRNA targeting IL-6 and the DNA strands constituting the DNA tetrahedron into working solutions of 10 μM respectively. After mixing the working solutions according to a stoichiometric ratio of 1:1, anneal in a PCR instrument to obtain the required DNA tetrahedron connected to the siRNA targeting IL-6.
[0027] Preferably, the DNA tetrahedron is composed of single-stranded DNAs S1, S2, S3, and S4 with complementary bases. The sequence of S1 is shown as SEQ ID NO:1, the sequence of S2 is shown as SEQ ID NO:2, the sequence of S3 is shown as SEQ ID NO:3, and the sequence of S4 is shown as SEQ ID NO:4. The siRNA targeting TNF-α includes a sense strand and an antisense strand. The sequence of the sense strand is shown as SEQ ID NO:5, and the sequence of the antisense strand is shown as SEQ ID NO:6. The siRNA targeting IL-6 includes a sense strand and an antisense strand. The sequence of the sense strand is shown as SEQ ID NO:7, and the sequence of the antisense strand is shown as SEQ ID NO:8.
[0028] Preferably, in the needle tip system of Scheme A, the final concentration of tacrolimus is 1 mg / mL, the final concentration of the DNA tetrahedron conjugated with the siRNA targeting TNF-α is 1 μM, the final concentration of methacrylated gelatin is 4 wt%, the final concentration of carrageenan is 0.2 wt%, and the final concentration of sodium alginate is 0.2 wt%.
[0029] In the needle tip system of Scheme B, the final concentration of tacrolimus is 0.1% (w / v), and the final concentration of the DNA tetrahedron conjugated with the siRNA targeting IL-6 is 1 μM.
[0030] Preferably, in Scheme A, the photoinitiator is lithium phenyl(2,4,6-trimethylbenzoyl)phosphate, and the dosage of the photoinitiator is 2.5 - 5% of the mass of methacrylated gelatin. In Scheme B, the concentration of the aqueous polyvinyl alcohol solution is 4 wt%.
[0031] Preferably, in both Scheme A and Scheme B, vacuum pumping treatment is performed 1 - 3 times before the drying treatment. The degree of vacuum for the vacuum pumping treatment is (8 - 9.5)×10 -2 , and the single time is 1 - 2 min.
[0032] Preferably, in both Scheme A and Scheme B, the drying temperature is 22 - 35 °C.
[0033] A third object of the present invention is to provide an application of the double-loaded drug microneedle of tacrolimus combined with siRNA as described above in the preparation of a dressing for treating psoriasis or in the preparation of an external medicine for treating psoriasis.
[0034] A fourth object of the present invention is to provide a pharmaceutical and medical device composition for treating psoriasis, comprising the double-loaded drug microneedle of tacrolimus combined with siRNA as described above.
[0035] The beneficial effects of the present invention are as follows:
[0036] Based on the existing psoriasis treatment, this application first proposes to co-load tacrolimus and TNF-α siRNA or IL-6 siRNA in a microneedle patch, and connect the siRNA through a DNA tetrahedron, effectively solving the following problems:
[0037] 1) Tacrolimus is generally administered by topical application of ointment, and TNF-α siRNA or IL-6 siRNA is generally administered by injection. This application co-loads the two drugs to prepare microneedles, achieving the purpose of releasing two drugs from one microneedle patch for efficient and safe treatment of psoriasis.
[0038] 2) siRNA is a kind of RNA interference technology, which can mediate the degradation of target mRNA and knockdown the expression of target genes in a sequence-specific manner. By reducing the expression of TNF-α or IL-6 through siRNA, the inflammatory response can be reduced, achieving the effect of treating psoriasis lesions and inflammation. However, the safety problems caused by the introduction of siRNA delivery systems such as liposomes for long-term use in humans have not been solved, and the instability of siRNA in the body makes it prone to off-target effects. This application proposes to use a new delivery system - DNA tetrahedron for siRNA delivery. DNA nanomaterials have high designability, modifiability, biocompatibility and biodegradability. Connecting siRNA to the DNA tetrahedron not only has the advantages of good biological safety and strong controllable release adjustability, but also can effectively overcome the problem of easy degradation of siRNA in the body.
[0039] 2) This application designs a new DNA tetrahedron, which can effectively prevent siRNA from being degraded in the body and finally deliver it to target cells.
[0040] 3) The selection of polymer materials is related to the strength and solubility of microneedle materials. In the double-loaded microneedles of tacrolimus and TNF-α siRNA, methacrylated gelatin GelMA is specifically selected as the polymer material, which is mutually soluble with tacrolimus and TNF-α siRNA used in this application, and still has high mechanical strength after dissolving the drugs, thus ensuring the uniformity and effectiveness of microneedle preparation to the greatest extent.
[0041] 4) In the double-loaded microneedles of tacrolimus and TNF-α siRNA, tacrolimus has the best solubility in polyvinyl alcohol. Carrageenan and sodium alginate are two common natural polysaccharides with excellent anti-inflammatory and antibacterial activities, but their mechanical strength cannot meet the actual application requirements. This application mixes carrageenan, sodium alginate and methacrylated gelatin, which not only improves the hardness of the microneedles, but also endows the microneedles with a certain anti-inflammatory effect.
[0042] 5) Tacrolimus and TNF-α siRNA or IL-6 siRNA are simultaneously loaded in the microneedles, enabling the delivery of two therapeutic drugs with a single patch of microneedles, and solving the problems of frequent injections and high risk of disease transmission in the prior art for the treatment of psoriasis with tacrolimus. Animal experiments have proven that the microneedles with the combination of the two drugs have better therapeutic effects than the microneedles loaded with tacrolimus alone. Description of the Drawings
[0043] Figure 1 It is a solubility test chart of tacrolimus in a polymer solution. In the figure, A shows the solubility of tacrolimus in solutions of 4 polymer materials. From left to right in the figure are 4% PVA (transparent and clear), 10% PVP (slightly turbid), 5% GelMA (slightly turbid), 5% HAMA (slightly turbid), 5% HA (turbid); B shows the dissolution of sodium alginate and carrageenan in 4 high-strength biomaterials. From left to right are 5% GelMA, 10% PVA, 10% PVP, 5% HAMA; C shows the dissolution of tacrolimus in each solution in B. From left to right are Alg+L-car+ (5% GelMA, 10% PVA, 10% PVP, 5% HAMA).
[0044] Figure 2 It is a connection schematic diagram of DNA tetrahedron loaded with siRNA involved in this application.
[0045] Figure 3 It is the characterization result of the DNA tetrahedron loaded with siRNA prepared in this application. Among them, A is the DNA tetrahedron loaded with IL-6 siRNA, and B is the DNA tetrahedron loaded with TNF-α siRNA.
[0046] Figure 4 It is for designing a female mold microneedle array mold. In the figure, A is the top view and B is the sectional view.
[0047] Figure 5 It is the microscopic magnification diagram of the dual-drug-loaded microneedles of tacrolimus and TNF-α siRNA prepared in this application. Among them, A is the overall view and B is the enlarged view of the tip part.
[0048] Figure 6 It is the microscopic magnification diagram of the dual-drug-loaded microneedles of tacrolimus and IL-6 siRNA prepared in this application. Among them, A is the overall view and B is the enlarged view of the tip part.
[0049] Figure 7 It is the transdermal test result of the dual-drug-loaded microneedles prepared in this application. Among them, A is the dual-drug-loaded microneedles of tacrolimus and IL-6 siRNA, and B is the dual-drug-loaded microneedles of tacrolimus and TNF-α siRNA.
[0050] Figure 8Tip dissolution test of the dual-drug-loaded microneedles prepared for this application, where A is the tacrolimus and IL-6 siRNA dual-drug-loaded microneedles, and B is the tacrolimus and TNF-α siRNA dual-drug-loaded microneedles.
[0051] Figures 9 - 13 Mouse test results of the tacrolimus and IL-6 siRNA dual-drug-loaded microneedles Figure 9 Psoriasis on the backs of mice in different administration groups Figure 10 PASI scores of mice in different administration groups. In the figure, A is the change in erythema index, B is the change in scale index, and C is the change in skin thickness index. Figure 11 Spleen indices of mice in different administration groups Figure 12 Histopathological observations of the skin tissues of mice in different administration groups Figure 13 IL-6 (A) and TNF-α (B) in the sera of mice in different administration groups
[0052] Figures 14 - 18 Mouse test results of the tacrolimus and TNF-α siRNA dual-drug-loaded microneedles Figure 14 Psoriasis on the backs of mice in different administration groups Figure 15 PASI scores of mice in different administration groups. In the figure, A is the change in erythema index, B is the change in scale index, and C is the change in skin thickness index. Figure 16 Spleen indices of mice in different administration groups Figure 17 Histopathological observations of the skin tissues of mice in different administration groups Figure 18 IL-6 (A) and TNF-α (B) in the sera of mice in different administration groups Detailed implementation manners
[0053] For ease of understanding, the technical solutions of the present invention will be described in more detail below in conjunction with the embodiments.
[0054] Unless otherwise specified, all kinds of raw materials, reagents, instruments, and equipment used herein can be purchased through the market or prepared by existing methods.
[0055] For convenience of description, the siRNA targeting TNF-α is referred to as TNF-α siRNA, and the siRNA targeting IL-6 is referred to as IL-6 siRNA. The "DNA tetrahedron loaded with siRNA" is used as a general term for the DNA tetrahedron loaded with TNF-α siRNA or IL-6 siRNA.
[0056] Example 1
[0057] Solubility test of tacrolimus in the polymer solution
[0058] 1. Test the clarity of the solutions of five polymer materials, namely polyvinyl alcohol (PVA), gelatin methacrylate (GelMA), hyaluronic acid methacrylate (HAMA), hyaluronic acid (HA), and polyvinylpyrrolidone (PVP).
[0059] Prepare the following polymer material solutions:
[0060] 1. 4% PVA: Accurately weigh 40 mg of polyvinyl alcohol, add 1 mL of deionized water, heat in a water bath at 70 °C and stir for one hour, and let it stand at room temperature for use;
[0061] 2. 5% GelMA: Accurately weigh 50 mg of gelatin methacrylate in an EP tube, add 1 mL of PBS solution containing 0.25% LAP, heat in a water bath at 70 °C and stir, paying attention to avoiding light, for use;
[0062] 3. 5% HAMA: Accurately weigh 50 mg of hyaluronic acid methacrylate, add 1 mL of PBS solution containing 0.25% LAP, heat in a water bath at 60 °C, paying attention to avoiding light, for use;
[0063] 4. 5% HA: Accurately weigh 50 mg of hyaluronic acid, add 1 mL of deionized water, heat in a water bath at 50 °C and stir for half an hour, for use;
[0064] 5. 10% PVP: Accurately weigh 100 mg of polyvinylpyrrolidone, add 1 mL of deionized water and shake until dissolved, for use;
[0065] The commonly used clinical concentration of tacrolimus is 0.1%. Accurately weigh 2 μL of 5% tacrolimus (5 mg of tacrolimus dissolved in 100 μL of water) according to the concentration and then add 98 μL of 4% PVA solution. Observe the clarity of the drug after dissolution in the polymer material. According to the above method, weigh an equal amount of tacrolimus and add it to the other five polymer materials, and compare the clarity of tacrolimus after dissolution respectively. As Figure 1 shown in A, the solution of tacrolimus is transparent and clear after dissolution in the 4% PVA material, indicating that the solubility in the 4% PVA material is the best. To improve the clinical treatment effect and increase the utilization rate of biomaterials, PVA is selected as a component for the preparation of the final microneedles.
[0066] 2. Test the solubility of tacrolimus in gelatin methacrylate (GelMA) + carrageenan, GelMA + sodium alginate, and GelMA + carrageenan + sodium alginate.
[0067] First, prepare a mixed solution of two materials, sodium alginate (Alg) and carrageenan (L-car), and explore the solubility of the mixed solution when mixed with four high-strength biomaterials, gelatin methacrylate (GelMA), hyaluronic acid methacrylate (HAMA), polyvinyl alcohol (PVA), and polyvinylpyrrolidone (PVP), respectively.
[0068] Prepare several mixed solutions of materials:
[0069] (1) 2% carrageenan: Accurately weigh 60 mg of L-car into an EP tube, add 3 mL of double-distilled water, heat in a water bath at 60 °C and stir until ready for use;
[0070] (2) 2% sodium alginate: Accurately weigh 60 mg of Alg into an EP tube, add 3 mL of double-distilled water, heat in a water bath at 60 °C and stir until ready for use;
[0071] (3) 5% GelMA: Accurately weigh 50 mg of GelMA into an EP tube, add 1 mL of 0.25% LAP, heat in a water bath at 60 °C and stir, paying attention to avoiding light, until ready for use;
[0072] (4) 5% HAMA: Accurately weigh 50 mg of HAMA into an EP tube, add 1 mL of 0.25% LAP, heat in a water bath at 60 °C and stir, paying attention to avoiding light, until ready for use;
[0073] (5) 10% PVA: Accurately weigh 100 mg of PVA into an EP tube, add 1 mL of deionized water, heat in a water bath at 70 °C and stir until ready for use;
[0074] (6) 10% PVP: Accurately weigh 100 mg of PVP into an EP tube, add 1 mL of deionized water, heat in a water bath at 70 °C and stir until ready for use;
[0075] Prepare 100 μL of mixed solutions of Alg, L-car and the above four high-strength biomaterials respectively. The concentrations of Alg and L-car in the mixed solution are 10% respectively, and the concentrations of the four high-strength biomaterials are 80%. As shown in B, from left to right are the mixed solutions of Alg + L-car + GelMA, Alg + L-car + PVA, Alg + L-car + PVP, and Alg + L-car + HAMA. It can be seen that all four tubes of mixed solutions are clear and transparent. Tacrolimus is solubilized with ethanol until the concentration of tacrolimus in ethanol is 5%. The final concentration of tacrolimus in the material is 1 mg / mL. Therefore, add 2 μL of tacrolimus to each of the four mixed materials. Centrifuge the mixed materials added with tacrolimus for 30 s and place them in a water bath to heat and dissolve. As shown in Figure 1 Figure 1 Figure 1As shown in C, it can be seen that all four tubes have different degrees of suspension. The solution of Alg+L-car+GelMA+TAC in the leftmost tube has the least suspension and is relatively uniform. Therefore, this mixed material is selected as the microneedle tip system.
[0076] Example 2
[0077] Preparation of DNA Tetrahedron Loaded with siRNA
[0078] TNF-α siRNA includes a sense strand and an antisense strand:
[0079] Sense strand: TTCATACACC CGUCGUAGCAAACCACCAATT (SEQ ID NO:5) Antisense strand: UUGGUGGUUUGCUACGACGTG (SEQ ID NO:6)
[0080] IL-6 siRNA includes a sense strand and an antisense strand:
[0081] Sense strand: TTCATACACC UUCUCCGAACGUGUCACGUTT (SEQ ID NO:7) Antisense strand: ACGUGACACGUUCGGAGAATT (SEQ ID NO:8)
[0082] The DNA tetrahedron is composed of single-stranded DNAs S1, S2, S3, and S4 with complementary bases. In the DNA tetrahedron used to carry TNF-α siRNA or IL-6 siRNA, the sequences of each strand are as follows.
[0083] S1: ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA (SEQ ID NO:1)
[0084] S2: ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG (SEQ ID NO:2)
[0085] S3: GGTGTATGAA ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC (SEQ ID NO:3)
[0086] S4: ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG (SEQ ID NO:4)
[0087] The underlined parts of the above S3 and the sense strand sequence are the base complementary pairing parts of the two strands. S1-S4 form a DNA tetrahedron through base complementary pairing, and the design principle is as Figure 2 shown.
[0088] The DNA tetrahedron loaded with siRNA (hereinafter simply referred to as TDN-siRNA) can be achieved by the following method:
[0089] Step 1: Dilute six single-stranded DNAs: Centrifuge the primer tube (1000 - 3000 r / min) for several minutes to gather the DNA to the bottom of the tube. After adding an appropriate amount of double-distilled water, cover the tube cap, heat in a water bath and vortex to mix evenly, so that the DNA is fully dissolved, and the concentration of the DNA stock solution is about 100 μM. Further dilute to obtain a working solution of 10 μM.
[0090] Step 2: Mix the six single-stranded DNAs in a stoichiometric ratio of 1:1:1:1:1:1. The mixed solution contains TM buffer (10 μM Tris-HCl pH = 8.0, 50 μM MgCl2), and the final concentration of the six single-stranded DNAs is 1 μM. Complete the annealing step in a PCR instrument according to the annealing steps of 95 °C for 10 min and 4 °C for 20 min, and then TDN-siRNA is obtained.
[0091] Characterize the formed TDN-siRNA using 8% non-denaturing polyacrylamide gel (native PAGE). As Figure 3 shown in A and B, clear and distinct bands are present at the corresponding positions of the ladder in both the tetrahedron lane and the TDN-siRNA lane, indicating the successful synthesis of TDN-siRNA.
[0092] Example 3
[0093] Preparation of dual-loaded microneedles
[0094] 1. For the dual-loading scheme of tacrolimus and TNF-α siRNA, it includes the following steps:
[0095] Step 1: Preparation of photoinitiator
[0096] Add 20 mL of PBS to 0.05 g of LAP (photoinitiator, lithium phenyl(2,4,6-trimethylbenzoyl)phosphate), heat and dissolve in a 35 °C water bath for 15 min, with several oscillations during this period, to obtain a photoinitiator solution with a concentration of 0.25%. The photoinitiator solution needs to be protected from light and stored at 4 °C.
[0097] Step 2: Preparation of the tip system solution
[0098] Prepare a 600 μL microneedle solution system. Weigh 0.025 g of GelMA and dissolve it in 500 μL of LAP solution to obtain a 5% GelMA solution. Place the GelMA solution in a 70 °C water bath heating device for later use; weigh 0.002 g of carrageenan and dissolve it in 100 μL of double-distilled water to obtain a 2% carrageenan solution, and place it in a 70 °C water bath heating device for later use; weigh 0.002 g of sodium alginate and dissolve it in 100 μL of double-distilled water to obtain a 2% sodium alginate solution, and place it in a 70 °C water bath heating device for later use. Tacrolimus is dissolved in ethanol to obtain a 5% tacrolimus solution.
[0099] Take 480 μL of GelMA + 60 μL of carrageenan + 60 μL of sodium alginate to obtain a mixed material, add 12 μL of tacrolimus, and add 60 μL of TDN-siRNA prepared in Example 2 to this mixed system to obtain a microneedle tip solution system.
[0100] Step 3: Preparation of dual-loaded microneedles
[0101] Prepare a female microneedle array mold according to the designed microneedle shape. Refer to Figure 4 , in this example, the microneedle array mold is prepared from polydimethylsiloxane. The microneedle dimensions are: needle height 600 μm, bottom diameter 300×300 μm, needle tip distance 600 μm, the number array is 15×15, the microneedle patch size is 11.7×11.7 mm, and the groove depth is 2 mm.
[0102] Pour the tip system into the microneedle array mold. After the tip system is evenly dispersed, place the mold in a vacuum sealing tank and perform a vacuum operation. The vacuum degree is -0.089, and the number of vacuum pumping times is 3 times, with each vacuum pumping time being 1 min. And after defoaming, continue to supplement the liquid until the microneedle mold is filled. Repeat the vacuum pumping, defoaming, and liquid supplementing operations three times. For the last liquid supplement, fill the solution until the liquid surface is slightly convex.
[0103] Cure the mold with ultraviolet light for 1 min and then place it in an oven at 28 °C to dry for 24 h. Demold to obtain the dual-loaded microneedle patch.
[0104] The above demolding can use existing demolding techniques. A typical demolding process is as follows: Paste a 3M biofilm on the surface of the microneedle backing layer (i.e., the back side of the microneedle, the side without microneedles). The function of this film is to make the microneedle array easy to peel off, without microneedle bending and breaking during the peeling process, and it can be easily picked up and placed. Separate the microneedles from the mold to obtain the final product.
[0105] It should be emphasized that in this microneedle, an integrated tip part and backing part are prepared using the tip solution. The additional tip solution should be added before the tip part is completely dry. The curing and drying procedures can be adjusted adaptively according to individual cases.
[0106] The double-drug-loaded microneedles prepared above were observed under a microscope. As shown in A of Figure 5 , it can be seen that the prepared microneedles have no microneedle defects caused by air bubbles, the microneedle height is uniform, and the needle tips are sharp and complete. Further, the microneedles were characterized by a scanning electron microscope. As shown in B of Figure 5 , it can be observed that the needle tips of the microneedles are complete and the array is neat.
[0107] 2. For the double-drug-loaded scheme of tacrolimus and IL-6 siRNA, the steps are as follows:
[0108] Step 1: Preparation of the needle tip system solution
[0109] Weigh 5 mg of tacrolimus powder and place it in a 0.2 mL EP tube. Add 100 μL of water (add a little 75% ethanol to assist dissolution) until dissolved. In the tacrolimus solution, the concentration of tacrolimus is 5% (w / v).
[0110] Accurately weigh 8 mg of PVA and place it in a 0.2 mL EP tube. Add 100 μL of water and stir evenly until dissolved. The resulting solution is a 8% (w / v) PVA solution for later use.
[0111] Accurately measure 100 μL of the TDN-siRNA prepared in Example 2 with a size of 2 μm and 4 μL of 5% tacrolimus and add them to 100 μL of the 8% PVA solution, and stir evenly until dissolved to obtain the microneedle tip system (denoted as Solution1, S1). In this system, the concentration of tacrolimus is 0.1% (w / v), the concentration of PVA is 5% (w / v), and the concentration of the TDN-siRNA tetrahedron is 1 μM.
[0112] Step 2: Prepare a 4 wt% aqueous solution of polyvinyl alcohol as the backing solution;
[0113] Step 3: Preparation of the double-drug-loaded microneedles
[0114] Prepare a female mold microneedle array mold according to the designed microneedle shape. Refer to Figure 4 . In this example, the microneedle array mold is prepared from polydimethylsiloxane (PDMS). The microneedle dimensions are: needle height 600 μm, bottom diameter 300×300 μm, needle tip distance 600 μm, the number of arrays is 15×15, the microneedle patch size is 11.7×11.7 mm, and the groove depth is 2 mm.
[0115] The solution of the prepared needle tip system was evenly dispersed in the microneedle array mold. The mold was placed in a vacuum-sealed tank, and a vacuum operation was carried out. The vacuum degree was -0.089, and the vacuum time was 2 min. The bubbles generated on the liquid surface during the vacuuming process were removed, and the liquid was replenished until the microneedle mold was filled. The mold was placed in an oven at 28 °C and dried for 4 h. The mold was taken out and the backing solution was added until it was flush with the mold surface, and then dried for another 5 h. After demolding, the dual-loaded microneedles were obtained.
[0116] The prepared dual-loaded microneedles were observed under a microscope. As Figure 6 shown in A of Figure 6 , it can be seen that the morphology of the prepared microneedles is excellent, and the needle tips are sharp and complete. Further, the microneedles were characterized by a scanning electron microscope. As
[0117] Example 4
[0118] Characterization of the transdermal performance of dual-loaded microneedles
[0119] The mouse was fixed. After depilating its back with a hair remover, an appropriate amount of depilatory cream was applied to the depilated area. After staying for 30 s, the depilatory cream was completely wiped clean with a wet cotton ball. Then, a small amount of depilatory cream was applied to the area where the hair was not completely removed. After staying for 10 s, it was completely wiped clean with a wet cotton ball, and then the back skin was dried with a dry cotton ball.
[0120] The mouse was sacrificed by cervical dislocation. The back skin was cut off and fully unfolded and fixed with a needle. Double-sided tape was attached to one side of the hammer, and then the microneedles were attached. Using a force of about 10 N, the two types of dual-loaded microneedles prepared in Example 3 were vertically pressed on the skin respectively. After holding and fixing for 3 min, the hammer was removed. The pressed area of the microneedles was stained with methylene blue, and after staying for about 1 min, it was washed off.
[0121] As Figure 7 shown, the transdermal conditions of the two types of dual-loaded microneedles can be observed. It can be seen that the microneedle arrays are clear and complete, indicating that both designs have relatively high mechanical strength after loading drugs and have good transdermal performance, meeting the usage requirements.
[0122] Example 5
[0123] Dissolution test of the needle tips of dual-loaded microneedles
[0124] The double-loaded drug microneedles prepared in Example 4 were cut into 3 - 4 pieces in the form of two rows of arrays per small piece. Take the back skin of a mouse, use sealing film instead of double-sided tape to extend and adsorb it on one end of a hammer. Place a piece of microneedles gently on the back skin of the mouse, immediately press vertically with the hammer. After pressing for 5 minutes, remove the hammer, take off the microneedles, and stick them parallel to the side of the lid of a 96-well plate with double-sided tape for subsequent observation. Then, microneedle patches after pressing for 10 minutes, 15 minutes, and 20 minutes were obtained respectively in the same way.
[0125] Place the microneedle patches dissolved for different times under an upright fluorescence microscope for observation. As Figure 8 shown in A and B in
[0126] Example 6
[0127] Therapeutic effect of tacrolimus and IL-6 siRNA double-loaded drug microneedles on imiquimod-induced psoriasis model in mice
[0128] 1. Establishment and grouped administration of psoriasis model in mice
[0129] Thirty 6-week-old male BALB / c mice were used as experimental animals. The 30 mice were randomly divided into six groups, with 5 mice in each group, namely the control group, the model group, the positive control drug group, the single-loaded tacrolimus microneedle group, the single-loaded IL-6 siRNA microneedle group, and the double-loaded drug microneedle group. The treatment methods were as follows: Use a hair clipper to shave the hair on the back of the mice and perform hair removal treatment to form a hairless area of about 3 * 3 cm. After shaving, gently clean the skin with physiological saline to ensure no hair residue.
[0130] Control group: Apply vaseline ointment every day for nine consecutive days;
[0131] Model group: Apply 5% imiquimod ointment to the shaved area at the same time every day for five consecutive days, and apply vaseline from the 6th to the 9th day;
[0132] Positive control drug group: After shaving the hair of the mice, apply 5% imiquimod ointment to the shaved area at the same time every day for five consecutive days, and apply tacrolimus ointment from the 6th to the 9th day, once a day, at a concentration of 0.1 mg / mL and 0.1 mL per time;
[0133] Single-loaded tacrolimus microneedle group: After shaving the hair of the mice, apply 5% imiquimod ointment to the shaved area at the same time every day for five consecutive days, and administer single-loaded tacrolimus microneedles from the 6th to the 9th day (prepared by the same microneedle preparation method as in Example 3, but the microneedles do not contain IL-6 siRNA). When administering, apply the microneedles to each mouse for 10 minutes until the tip part is completely dissolved;
[0134] Single-loaded IL-6 siRNA group: After shaving the hair of the mice, 5% imiquimod ointment was applied to the shaved area at the same time every day for five consecutive days. On the 6th - 9th days, single-loaded IL-6 siRNA microneedles (prepared by the same microneedle preparation method as in Example 3, but the microneedles did not contain tacrolimus) were administered. When administering, each mouse pressed the microneedle for 10 minutes until the tip part was completely dissolved;
[0135] Dual-loaded drug microneedle group: After shaving the hair of the mice, 5% imiquimod ointment was applied to the shaved area at the same time every day for five consecutive days. On the 6th - 9th days, dual-loaded drug microneedles (prepared in Example 3) were administered. When administering, each mouse applied the microneedle for 10 minutes until the tip part was completely dissolved;
[0136] 2. Observation of the psoriasis model in mice and PASI score
[0137] The damaged conditions on the backs of mice in each group were observed visually. As Figure 9 shown, during the treatment period, the psoriasis conditions in each drug administration group improved to varying degrees. The PASI score was statistically analyzed once a day during drug administration and model establishment. The PASI score includes skin thickness, psoriasis condition, and erythema condition. In the evaluation of the psoriasis area and severity index, the higher the score, the more severe the psoriasis symptoms. As Figure 10 shown in A - C, compared with the normal group of mice, the PASI score of the model group of mice continued to increase within 7 days of model establishment. Compared with the model group of mice, the PASI score of each drug administration group of mice decreased after drug administration treatment. Among them, the decrease in the PASI score of the dual-loaded microneedle drug administration group of mice was greater and the treatment effect was better, and the difference was statistically significant.
[0138] 3. Body weight and spleen index of mice
[0139] (1) Before the start of the experiment (day 0) and after daily drug administration treatment, the body weight of the mice was measured using an electronic balance accurate to 0.01 g. The mice were placed on the electronic balance, and each mouse was measured and recorded separately. The body weight change on the 10th day relative to the 0th day was calculated. Compared with the normal group of mice, the body weight of the model group of mice continued to decrease. Compared with the model group of mice, the body weight of each drug administration group of mice gradually decreased during model establishment and gradually recovered during the drug administration period, and the body weight on the 10th day was close to the body weight of the same mouse on the 0th day.
[0140] (2) On the 10th day, the mice were sacrificed uniformly. On the day of sacrificing the mice, the spleens of the mice were dissected and weighed separately.
[0141] Spleen index = mouse spleen mass (mg) / mouse body weight (g)
[0142] As Figure 11It was shown that compared with the normal group of mice, the spleen index of the model group of mice was significantly increased. Compared with the model group of mice, the spleen indexes of each drug-administered group of mice were decreased to varying degrees. This indicates that the spleen volume of the psoriasis mice treated with drugs will become smaller; there is no difference in the size of the spleen between the drug-loaded microneedle group and the TAC ointment treatment group, and the treatment effect of the microneedle group is obvious.
[0143] 4. Histopathological observation and scoring of mouse skin tissue
[0144] At the end of the experiment (the tenth day), the mice were anesthetized and sacrificed, and the skin tissue was taken. The skin tissue was immediately placed in 4% paraformaldehyde, dehydrated, paraffin-embedded, sectioned, and HE-stained. The HE-stained sections were observed and photographed under a microscope, and the pathological changes of the skin tissue were recorded. And three epidermal vertical distances from the epidermal stratum corneum to the basal layer were randomly measured from each section to analyze the thickening of the epidermal layer.
[0145] As Figure 12 shown: compared with the normal group of mice, the epidermis of the model group of mice was significantly thickened, with vascular hyperplasia and infiltration of inflammatory cells, incomplete keratinization and hyperkeratosis, thinning of the granular layer, acanthosis, and irregular elongation. Compared with the model group of mice, each drug-administered group of mice improved the above pathological changes to varying degrees.
[0146] 5. ELISA detection of IL-6 and TNF-α in serum
[0147] At the end of the experiment (the tenth day), the mice were bled from the eyeballs uniformly, allowed to stand and centrifuged, and the mouse serum was taken. According to the instructions of the reagent manufacturer, the test samples were added to the wells of the ELISA plate. After the color reaction stopped, a microplate reader was used for double-wavelength detection, and the detection wavelength was set to 450 nm and the reference wavelength was set to 610 nm. The concentrations of IL-6 and TNF-α in the samples were calculated.
[0148] As Figure 13 shown, compared with the normal group of mice, the expressions of IL-6 and TNF-α in the serum of the model group of mice were significantly increased, and the difference was statistically significant; compared with the model group, the expressions of IL-6 and TNF-α in the serum of the two single-drug-loaded microneedle administration groups, the double-drug-loaded microneedle administration group, and the TAC ointment treatment group were significantly decreased, and the difference was statistically significant. It shows that the double-drug-loaded microneedle has a good treatment effect.
[0149] Example 8
[0150] Therapeutic effect of tacrolimus and TNF-α siRNA double-drug-loaded microneedles on imiquimod-induced mouse psoriasis model
[0151] 1. Establishment of mouse psoriasis model and grouping for drug administration
[0152] The experimental animals were 48 male BALB / c mice at 6 weeks of age. The 48 mice were randomly divided into six groups, with 8 mice in each group, namely the control group, the model group, the positive control drug group, the single-drug-loaded microneedle group 1 (containing only tacrolimus), the single-drug-loaded microneedle group 2 (containing only TDN-siRNA), and the dual-drug-loaded microneedle group. The treatment methods were as follows: Use a hair clipper to shave the hair on the backs of the mice and perform hair removal treatment to form a hairless area of approximately 3*3 cm. After shaving, gently clean the skin with physiological saline to ensure no hair residue.
[0153] Control group: Apply vaseline ointment every day for nine consecutive days.
[0154] Model group: Apply 5% imiquimod ointment to the shaved area at the same time every day for five consecutive days, and apply vaseline to the shaved area on the 6th - 9th day.
[0155] Positive control drug group: After shaving the hair of the mice, apply 5% imiquimod ointment to the shaved area at the same time every day for five consecutive days, and apply tacrolimus ointment on the 6th - 9th day, once a day, at a concentration of 0.1 mg / mL and 0.1 mL per time.
[0156] Single tacrolimus-loaded microneedle group: After shaving the hair of the mice, apply 5% imiquimod ointment to the shaved area at the same time every day for five consecutive days, and administer the single tacrolimus-loaded microneedle on the 6th - 9th day (prepared by the same microneedle preparation method as in Example 3, but the microneedles do not contain TDN-siRNA). When administering the drug, press the microneedle on each mouse for 10 minutes until the tip of the needle is completely dissolved.
[0157] Single TNF-α siRNA group: After shaving the hair of the mice, apply 5% imiquimod ointment to the shaved area at the same time every day for five consecutive days, and administer the single TNF-α siRNA microneedle on the 6th - 9th day (prepared by the same microneedle preparation method as in Example 3, but the microneedles do not contain tacrolimus). When administering the drug, press the microneedle on each mouse for 10 minutes until the tip of the needle is completely dissolved.
[0158] Dual-drug-loaded microneedle group: After shaving the hair of the mice, apply 5% imiquimod ointment to the shaved area at the same time every day for five consecutive days, and administer the dual-drug-loaded microneedle on the 6th - 9th day (prepared by the same microneedle preparation method as in Example 3). When administering the drug, press the microneedle on each mouse for 10 minutes until the tip of the needle is completely dissolved.
[0159] 2. Observation of the psoriasis model in mice and PASI score
[0160] Visually observe the damaged conditions on the backs of the mice in each group, such as Figure 14As shown, during the treatment period of each administration group, the psoriasis condition improved to varying degrees. The PASI score was statistically analyzed by scoring once a day during administration and modeling. The PASI score includes skin thickness, psoriasis condition, and erythema condition. In the evaluation of the psoriasis area and severity index, the higher the score, the more severe the psoriasis symptoms. As Figure 15 As shown in A - C, compared with the normal group of mice, the PASI score of the model group of mice continued to increase within 7 days of modeling. Compared with the model group of mice, the PASI scores of each administration group of mice decreased after administration treatment. Among them, the decrease in the PASI score of the dual - loaded microneedle administration group of mice was greater and the treatment effect was better, and the difference was statistically significant.
[0161] 3. Mouse body weight and spleen index
[0162] (1) Before the start of the experiment (day 0) and after daily administration treatment, the body weight of the mice was measured using an electronic balance accurate to 0.01 g. The mice were placed on the electronic balance, and each mouse was measured and recorded separately. Calculate the change in body weight on day 10 relative to day 0. Compared with the normal group of mice, the body weight of the model group of mice continued to decrease. Compared with the model group of mice, the body weight of each administration group of mice gradually decreased during modeling and gradually recovered during the administration period, and the body weight on day 10 was close to that of the same mouse on day 0.
[0163] (2) On day 10, the mice were sacrificed uniformly. On the day of sacrifice of the mice, the spleens of the mice were dissected and weighed separately.
[0164] Spleen index = mouse spleen mass (mg) / mouse body weight (g)
[0165] As Figure 16 shown, compared with the normal group of mice, the spleen index of the model group of mice was significantly increased. Compared with the model group of mice, the spleen indexes of each administration group of mice decreased to varying degrees. It indicates that the spleen volume of psoriasis mice treated with drugs will become smaller; there is no difference in the size of the spleen between the single - loaded microneedle group and the TAC ointment group, and the treatment effect of the dual - loaded microneedle group is obvious.
[0166] 4. Histopathological observation and scoring of mouse skin tissue
[0167] At the end of the experiment (day 10), the mice were anesthetized and sacrificed, and skin tissues were taken. The skin tissues were immediately placed in 4% paraformaldehyde for dehydration, paraffin embedding, sectioning, and HE staining. The HE - stained sections were observed and photographed under a microscope, and the pathological changes of the skin tissues were recorded. And three random measurements of the epidermal vertical distance from the epidermal stratum corneum to the basal layer were taken from each section to analyze the thickening of the epidermal layer.
[0168] As Figure 17As shown: Compared with the normal group of mice, the epidermis of the model group of mice was significantly thickened, with angiogenesis and infiltration of inflammatory cells, incomplete and hyperkeratosis, thinning of the granular layer, acanthosis, and irregular elongation. Compared with the model group of mice, each drug administration group of mice improved the above pathological changes to varying degrees.
[0169] 5. Detection of IL-6 and TNF-α in serum by ELISA
[0170] At the end of the experiment (the tenth day), blood was collected from the eyes of the mice uniformly, allowed to stand and centrifuged, and the mouse serum was taken. According to the instructions of the reagent manufacturer, the test samples were added to the wells of the ELISA plate. After the color reaction stopped, a microplate reader was used for dual-wavelength detection, with the detection wavelength set at 450 nm and the reference wavelength at 610 nm. The concentrations of IL-6 and TNF-α in the samples were calculated.
[0171] As Figure 18 shown, compared with the normal group of mice, the expressions of IL-6 and TNF-α in the serum of the model group of mice were significantly increased, and the difference was statistically significant; compared with the model group, the expressions of IL-6 and TNF-α in the serum of the two single-loaded microneedle drug administration groups, the dual-loaded microneedle drug administration group, and the TAC ointment treatment group were significantly decreased, and the difference was statistically significant. It shows that the dual-loaded drug microneedles have good therapeutic effects.
[0172] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the present invention; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention should be included within the protection scope of the present invention.
Claims
1. A dual-drug-loaded microneedle of tacrolimus combined with siRNA, comprising a backing part and a needle tip part arranged on one side of the backing part, characterized in that, The tip part is realized through the following two schemes: Scheme A: The components of the tip part include tacrolimus, siRNA targeting TNF-α, methacrylated gelatin, carrageenan, and sodium alginate, and the tip part is obtained by mixing and curing these components; Scheme B: The components of the tip part include tacrolimus, siRNA targeting IL-6, and polyvinyl alcohol, and the tip part is obtained by mixing and curing these components.
2. The dual-drug-loaded microneedle of tacrolimus combined with siRNA according to claim 1, characterized in that, The siRNA targeting TNF-α is connected to the DNA tetrahedron through base complementary pairing. The DNA tetrahedron is composed of single-stranded DNAs S1, S2, S3, and S4 that are base complementary to each other. The sequence of S1 is shown in SEQ ID NO:1, the sequence of S2 is shown in SEQ ID NO:2, the sequence of S3 is shown in SEQ ID NO:3, and the sequence of S4 is shown in SEQ ID NO:
4. The siRNA targeting TNF-α includes a sense strand and an antisense strand. The sequence of the sense strand is shown in SEQ ID NO:5, and the sequence of the antisense strand is shown in SEQ ID NO:6; The siRNA targeting IL-6 is connected to the DNA tetrahedron through base complementary pairing. The DNA tetrahedron is composed of single-stranded DNAs S1, S2, S3, and S4 that are base complementary to each other. The sequence of S1 is shown in SEQ ID NO:1, the sequence of S2 is shown in SEQ ID NO:2, the sequence of S3 is shown in SEQ ID NO:3, and the sequence of S4 is shown in SEQ ID NO:
4. The siRNA targeting IL-6 includes a sense strand and an antisense strand. The sequence of the sense strand is shown in SEQ ID NO:7, and the sequence of the antisense strand is shown in SEQ ID NO:
8.
3. The dual-drug-loaded microneedle of tacrolimus combined with siRNA according to claim 1, characterized in that The size of the backing part is (10-15)×(10-15) mm. The tip part is arranged at the center of the backing part and includes microneedles arranged in a 15×15 array. The height of the microneedles is 500-800 μm, and the distance between adjacent tips is 600-800 μm.
4. A preparation method of a tacrolimus combined with siRNA dual-loaded microneedle according to claim 1 or 2 or 3, characterized in that, It includes the following steps: For Scheme A: S1. Prepare a negative mold microneedle array mold according to the designed microneedle patch; S2. Prepare the tip system: Mix methacrylated gelatin, carrageenan, and sodium alginate in proportion and heat to dissolve to obtain a base solution; Prepare the DNA tetrahedron material. The DNA tetrahedron material is connected to the siRNA targeting TNF-α, and then tacrolimus, the DNA tetrahedron material, and the base solution are mixed in a set proportion to obtain the required tip system; S3. Assembly: Add the microneedle system solution into the negative mold microneedle array mold and fill the tip part of the negative mold microneedle array mold. After ultraviolet curing, continue to add the tip system until the backing part of the negative mold microneedle array mold is filled, dry for at least 24 h, and demold to obtain the required double-loaded microneedles; For Scheme B: S1. Prepare a negative mold microneedle array mold according to the designed microneedle patch; S2. Preparation of the needle tip system: Prepare a DNA tetrahedron material, connect the siRNA targeting TNF-α to the DNA tetrahedron material, and then mix tacrolimus, the DNA tetrahedron material, and a polyvinyl alcohol solution in a set ratio to obtain the required needle tip system; S3. Preparation of the backing solution: An aqueous solution of polyvinyl alcohol; S4. Assembly: Add the needle tip system into a female mold micro-needle array mold and fill the needle tip part of the female mold micro-needle array mold. After drying, add the backing solution. The backing solution contacts the needle tip system and fills the backing part of the female mold micro-needle array mold. After drying, demold to obtain the required dual-drug-loaded micro-needles.
5. The preparation method of a double-loaded drug microneedle of tacrolimus combined with siRNA according to claim 4, characterized in that, The preparation method of the DNA tetrahedron connected with the siRNA targeting TNF-α is as follows: Dilute the siRNA targeting TNF-α and the DNA strands constituting the DNA tetrahedron into working solutions of 10 μM respectively. After mixing the working solutions according to a stoichiometric ratio of 1:1, anneal in a PCR instrument to obtain the required DNA tetrahedron connected with the siRNA targeting TNF-α; The preparation method of the DNA tetrahedron connected with the siRNA targeting IL-6 is as follows: Dilute the siRNA targeting IL-6 and the DNA strands constituting the DNA tetrahedron into working solutions of 10 μM respectively. After mixing the working solutions according to a stoichiometric ratio of 1:1, anneal in a PCR instrument to obtain the required DNA tetrahedron connected with the siRNA targeting IL-6.
6. The preparation method of a dual-drug-loaded microneedle of tacrolimus combined with siRNA according to claim 5, wherein, The DNA tetrahedron is composed of single-stranded DNA S1, S2, S3, and S4 with complementary bases. The sequence of S1 is as shown in SEQ ID NO:1, the sequence of S2 is as shown in SEQ ID NO:2, the sequence of S3 is as shown in SEQ ID NO:3, and the sequence of S4 is as shown in SEQ ID NO:4; The siRNA targeting TNF-α includes a sense strand and an antisense strand. The sequence of the sense strand is as shown in SEQ ID NO:5, and the sequence of the antisense strand is as shown in SEQ ID NO:6; The siRNA targeting IL-6 includes a sense strand and an antisense strand. The sequence of the sense strand is as shown in SEQID NO:7, and the sequence of the antisense strand is as shown in SEQ ID NO:
8.
7. The preparation method of a dual-drug-loaded microneedle of tacrolimus combined with siRNA according to claim 5, wherein, In the needle tip system of Scheme A, the final concentration of tacrolimus is 1 mg / mL, the final concentration of the DNA tetrahedron connected with the siRNA targeting TNF-α is 1 μM, the final concentration of methacrylated gelatin is 4 wt%, the final concentration of carrageenan is 0.2 wt%, and the final concentration of sodium alginate is 0.2 wt%; In Scheme A, the photoinitiator is lithium phenyl(2,4,6-trimethylbenzoyl)phosphate, and the dosage of the photoinitiator is 2.5-5% of the mass of methacrylated gelatin; In Scheme B, the concentration of the aqueous polyvinyl alcohol solution is 4 wt%; In the needle tip system of Scheme B, the final concentration of tacrolimus is 0.1% (w / v), and the final concentration of the DNA tetrahedron connected with the siRNA targeting IL-6 is 1 μm.
8. The preparation method of a double-loaded drug microneedle of tacrolimus combined with siRNA according to claim 4, characterized in that, In Scheme A and Scheme B, vacuum pumping is carried out 1 to 3 times before the drying treatment, and the degree of vacuum for the vacuum pumping is (8 - 9.5)×10 -2 , the single - time duration is 1 to 2 minutes; the drying temperature is 22 to 35 °C.
9. Use of a dual-drug-loaded microneedle of tacrolimus combined with siRNA according to claim 1 or 2 or 3 in the preparation of a dressing for treating psoriasis or in the preparation of an external medicine for treating psoriasis.
10. A pharmaceutical and medical device composition for treating psoriasis, comprising a dual-drug-loaded microneedle of tacrolimus combined with siRNA according to claim 1 or 2 or 3.
Citation Information
Patent Citations
Small RNA used for psoriasis treatment, and derivatives and medicinal preparations thereof
CN103736102A
Application of siRNA (small interfering RNA) to inhibition of TRIM7 (tripartite motif proteins7) gene expression
CN108324728A
Microneedle carrying IL-17A specific siRNA and application of microneedle in prevention and treatment of psoriasis
CN118291460A
Compound based on DNA tetrahedron and preparation method and application thereof
CN119455134A
Sirna For Inhibiting Il-6 Expression and Composition Containing Them
US20080234218A1