Immunogen and monoclonal antibody of pigeon Newcastle disease virus and their preparation method and application

Abstract

The present invention belongs to the field of biotechnology, and specifically relates to an immunogen, monoclonal antibody, and preparation method and application of pigeon Newcastle disease virus. The nucleotide sequence encoding the immunogen is shown in SEQ ID NO. 2. The present invention uses molecular biology software to perform nucleotide sequence analysis on the Newcastle disease virus fusion protein gene, identifies the target, selects an interval where the antigenic epitope is relatively concentrated for truncation, and prepares an immunogen to enhance the immunogenicity of the target protein and the specificity of the antibody. The immunogen of the present invention is constructed using the pCold-TF vector, which can produce a higher concentration of the target protein and is soluble, which helps to produce a stronger immune response after immunizing mice, thereby producing a high-concentration, highly specific monoclonal antibody.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to an immunogen of pigeon Newcastle disease virus, a monoclonal antibody and a preparation method and application thereof. Background Art

[0002] Newcastle disease, ND for short, is one of the diseases that seriously harm the pigeon industry and is caused by the virulent Newcastle disease virus. Newcastle disease virus, NDV for short. Pigeon-derived Newcastle disease virus, also known as pigeon paramyxovirus type I, PPMV-1 for short, is a variant strain of chicken-derived NDV formed after adapting to pigeons. It is distributed all over the world and has caused huge economic losses to the pigeon industry. Since it was introduced into my country in the 1980s, it has been prevalent in many provinces and regions of my country for a long time, seriously hindering the healthy development of my country's pigeon industry. F protein, also known as pigeon Newcastle disease virus fusion protein, is a glycoprotein on the surface of pigeon Newcastle disease virus. As an envelope protein, it is closely related to the antigenicity and pathogenicity of the virus. As the main protective antigen, antibodies targeting F protein can effectively prevent the fusion of virus and cells and thus protect pigeons from viral infection. At the same time, the establishment of a rapid detection method based on this antibody can greatly improve the detection efficiency of Newcastle disease virus.

[0003] Existing immunogens for pigeon-derived Newcastle disease virus (NDV) typically use the full-length F protein as an immunogen. Immunizing mice with the intact fusion protein results in the production of antibodies targeting a broad range of epitopes, reducing the likelihood of mice producing antibodies against highly antigenic epitopes and increasing the difficulty of subsequent antibody screening. Furthermore, most current immunogens are insoluble or have low concentrations, often failing to generate a robust immune response after immunization in mice, thus reducing the probability of successful immunization and further increasing the difficulty of antibody preparation. Therefore, there is an urgent need for a novel immunogen that can be used to prepare antibodies against NDV in pigeons. Summary of the Invention

[0004] In order to prepare monoclonal antibodies against pigeon Newcastle disease virus, the present invention provides an immunogen of pigeon Newcastle disease virus.

[0005] The technical solution adopted in the present invention is:

[0006] In a first aspect, the present invention provides an immunogen for pigeon Newcastle disease virus. The nucleotide sequence encoding the immunogen is shown in SEQ ID NO.2.

[0007] The second aspect of the present invention provides a recombinant vector comprising the nucleotide sequence.

[0008] The third aspect of the present invention provides a monoclonal antibody against pigeon Newcastle disease virus prepared using the immunogen.

[0009] The fourth aspect of the present invention provides a method for preparing the monoclonal antibody, comprising the following steps:

[0010] Immunizing mice with the immunogen to obtain immune spleen cells capable of producing monoclonal antibodies against pigeon Newcastle disease virus;

[0011] The immune spleen cells are fused with mouse myeloma cells SP2 / 0, and the cells are screened to obtain hybridoma cells that can stably secrete monoclonal antibodies against pigeon Newcastle disease virus;

[0012] Monoclonal antibodies are prepared from the hybridoma cell line by an in vitro culture method or an in vivo ascites induction method.

[0013] Preferably, the hybridoma cell capable of stably secreting monoclonal antibodies to pigeon Newcastle disease virus is a hybridoma cell line Mus Musculus, The hybridoma cell line Mus Musculus The deposit number is CGMCC No.46056, and it was deposited in the General Microbiology Center of China Culture Collection Administration on October 10, 2024.

[0014] Preferably, the construction process of the hybridoma cell capable of stably secreting monoclonal antibodies to pigeon Newcastle disease virus is:

[0015] A mouse myeloma cell SP2 / 0 suspension is prepared; an immune spleen cell suspension is prepared; the mouse myeloma cell SP2 / 0 suspension and the immune spleen cell suspension are mixed, a fusion agent is added to perform cell fusion, and the cells are cultured to obtain hybridoma cells that can stably secrete monoclonal antibodies to pigeon Newcastle disease virus.

[0016] Preferably, the mouse myeloma cell SP2 / 0 suspension and the immune spleen cell suspension are mixed at a cell ratio of 1:10 to 1:5.

[0017] Preferably, the fusion agent includes any one of PEG1450, PEG1500, PEG4000 and PEG6000.

[0018] The fifth aspect of the present invention provides a kit for detecting Newcastle disease virus in pigeons, wherein the kit comprises any one of the immunogen, the recombinant vector or the monoclonal antibody.

[0019] The sixth aspect of the present invention provides a preparation for the prevention or treatment of Newcastle disease virus in pigeons, wherein the preparation comprises any one of the immunogen, the recombinant vector or the monoclonal antibody.

[0020] The biomaterial sample preservation information involved in the present invention is as follows:

[0021] F5 was deposited in the General Microbiology Center of China Culture Collection Administration on October 10, 2024. The classification name of F5 is hybridoma cell line. Mus Musculus, The deposit number is CGMCC No.46056, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The present invention provides an immunogen for pigeon Newcastle disease virus, the nucleotide sequence encoding the immunogen being shown in SEQ ID NO. 2. The present invention utilizes truncation of regions where antigenic epitopes are relatively concentrated to prepare the immunogen, thereby enhancing the immunogenicity of the target protein and the specificity of the antibody. The immunogen of the present invention is constructed using the pCold-TF vector, capable of producing a high concentration of the target protein and being soluble, which facilitates a strong immune response after immunization of mice, thereby producing highly concentrated and specific monoclonal antibodies.

[0024] The present invention specifically expresses and purifies the virus's surface glycoprotein, the fusion protein F, and immunizes mice to produce monoclonal antibodies specific for this protein. Using the pCold-TF expression vector, high concentrations of soluble protein were obtained, enabling the preparation of high-titer monoclonal antibodies. This addresses the lack of commercially available monoclonal antibodies targeting fusion proteins, facilitates the development of virus detection methods, and contributes to scientific research. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Prediction of protein transmembrane regions.

[0026] Figure 2 Prediction of protein antigen epitopes.

[0027] Figure 3 These are the identification results of prokaryotic and eukaryotic expression vectors. A is the detection result of pCold-TF-his-F; B is the detection result of pGEX-6P-1-F; C is the detection result of pCMV-Myc-F.

[0028] Figure 4 This is for the solubility analysis of pCold-TF-his-F protein.

[0029] Figure 5 This is the purification result of pCold-TF-his-F protein.

[0030] Figure 6 Solubility analysis of pGEX-GST-F protein.

[0031] Figure 7 For the purification of pGEX-GST-F protein.

[0032] Figure 8 Western Blot identification of pGEX-GST-F protein.

[0033] Figure 9 Western Blot identification of monoclonal antibodies against pigeon Newcastle disease virus. A is the hybridoma supernatant; B is the mouse ascites.

[0034] Figure 10 The results of the titer determination of monoclonal antibodies against Newcastle disease virus in pigeons at different dilution multiples are shown in Figure 1. The dilution multiples of A to E are 1:800, 1:1600, 1:3200, 1:6400 and 1:12800, respectively. DETAILED DESCRIPTION

[0035] The present invention will be further described below by way of specific examples, but the scope of the present invention is not limited thereto. The details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but such modifications or replacements fall within the scope of protection of the present invention.

[0036] The inventive concept of the present invention is as follows:

[0037] Currently available immunogens for pigeon-derived Newcastle disease virus mostly use whole pigeon Newcastle disease virus to immunize mice to prepare polyclonal or monoclonal antibodies against certain proteins of the virus. Usually, the full-length F protein is used as the immunogen, and mice are immunized with the complete fusion protein. The mice then produce antibodies against all epitopes, which reduces the possibility of mice producing antibodies against highly antigenic epitopes and increases the difficulty of subsequent antibody screening. Secondly, most current immunogens are insoluble or have low concentrations, and often fail to produce a good immune response after immunization in mice, thereby reducing the probability of successful immunization and further increasing the difficulty of antibody preparation.

[0038] Based on this, the present invention provides an immunogen for pigeon Newcastle disease virus, and the nucleotide sequence encoding the immunogen is shown in SEQ ID NO.2.

[0039] In order to make those skilled in the art better understand the technical solution of the present invention and be able to implement it, the present invention is further described below in conjunction with specific examples. In the description of the present invention, if not otherwise specified, the reagents used are all commercially available and the methods used are all conventional techniques in the art.

[0040] Example 1

[0041] Pigeon Newcastle Disease Virus Immunogens, specifically as follows:

[0042] (1) Prediction of protein transmembrane regions and antigenic epitopes.

[0043] First, the complete gene sequence of pigeon Newcastle disease virus fusion protein was input into the online prediction website to predict the protein transmembrane region and antigenic epitope, such as Figure 1 and Figure 2 As shown, the non-transmembrane region and the region with a relatively concentrated antigenic epitope were then truncated, and finally amino acids 220 to 465 were truncated, with the total length of the truncated gene being 738 bp. The pigeon Newcastle disease virus fusion protein is referred to as F protein.

[0044] The complete nucleotide sequence of the F protein is shown in SEQ ID NO.1, and the truncated nucleotide sequence is shown in SEQ ID NO.2.

[0045] SEQ ID NO.1:

[0046]

[0047] SEQ ID NO.2:

[0048] GTGTTCGGGCCACAAATCACTTCCCCTGCCCTAACTCAGCTAACCATCCAAGCGCTTTATAATTTAGCTGGCGGTAACATGGACTACCTATTGACTAAATTAGGTATAGGGAACAATCATCTCAGCTCATTAATAGGCAGTGGCTTGATCACAGGCAACCCTATACTGTATGACTCACAGACTCAACTCTTGGGCATCCAGGTAAATTTACCCTCAGTTGGGAACCTCAATAATATGCGTGCCACCTACCTGGAAACTTTATCTGTAAGCACAACCAAAGGGTTTGCCTCAGCACTTGTCCCGAAGGTAGTGACACAAGTCGGCTCTGTGATAGAAGAACTTGACACCTCATATTGTATAGAATCTGATCTGGATCTATACTGTACAAGGATAGTGACATTCCCTATGTCTCCAGGAATTTATTCTTGTCTGAGCGGTAATACATCAGCTTGCATGTACTCAAAGACTGAAGGCGCACTCAATACGCCATACATGGCCCTCAAAGGGTCAGTCATTGCCAATTGCAAAATAACAACCTGCAGATGTGCAGACCCCCCAGGTATCATATCGCAAAACTATGGAGAAGCTGTGTCTCTGATAGATAGACATTCATGCAATGTCTTATCATTAGATGGGATAACCCTGAGGCTCAGTGGGGAGTTTGATGCAACTTATCAAAAGAATATCTCAATACTAGATTCTCAAGTCATCGTGACAGGCAACCTTGGTATATCAACC。

[0049] (2) Construction of prokaryotic and eukaryotic expression vectors.

[0050] Viral RNA was extracted from the viral fluid harvested from the allantoic cavity of inoculated chicken embryos and reverse transcribed to obtain cDNA, which was then used as a template for amplification of the truncated gene. Primers were designed based on the nucleotide sequence shown in SEQ ID NO. 2 to amplify the fragment. The gel-recovered fragment was then ligated into the pCOLD-TF-his and pGEX-6p-1 prokaryotic plasmids, respectively, using homologous recombination to obtain the pCOLD-TF-his-F and pGEX-GST-F vectors. The pCOLD-TF-his-F and pGEX-GST-F vectors were then transformed into the cloning bacterium DH5α and the expression bacterium Rosetta, respectively, for subsequent protein expression.

[0051] At the same time, the complete F protein genome shown in SEQ ID NO.1 was connected to the pCMV-Myc eukaryotic plasmid to construct the pCMV-Myc-F recombinant eukaryotic plasmid for later use in the identification of positive serum and the determination of antibody titer.

[0052] like Figure 3 As shown, the present invention successfully constructed two prokaryotic vectors and one eukaryotic vector.

[0053] (3) Induced expression, purification and identification of pCold-TF-his-F vector.

[0054] After the pCold-TF-his-F vector was induced by IPTG at 16°C for 24 h, the cells were collected, lysed by ultrasonication, and analyzed by SDS-PAGE. The results showed that the protein was expressed in the supernatant at a high level. Figure 4 . Figure 4 In the figure, lanes 1 to 4 are: pCold-TF-his empty vector precipitate, pCold-TF-his empty vector supernatant, pCold-TF-his-F induction precipitate, and pCold-TF-his-F induction supernatant.

[0055] Since the target protein F protein was expressed in the supernatant, affinity chromatography was used for protein purification. A certain amount of beads was first added to the supernatant after ultrasonic lysis. After overnight at 4°C, a pre-prepared 10mM, 50mM, 100mM, 250mM, and 500mM imidazole solution was used for gradient elution and the filtrate was collected. The filtrate was then run on SDS-PAGE gel to select the optimal elution concentration. The results are shown in the figure. Figure 5, showing that the F protein was eluted with 50mM and 100mM imidazole concentrations, and high concentrations of the target protein were collected, and it was relatively pure; then the eluate of the specified concentration was collected, and the protein was concentrated using an ultrafiltration tube, and then the protein concentration was measured; the protein concentration was 4.6mg / ml, and the F protein purified from pCold-TF-his-F was selected as the immunogen for mouse immunization. Figure 5 In the figure, lanes 1 to 7 are: whole bacteria supernatant, whole bacteria pellet, 10 mM imidazole eluate, 50 mM imidazole eluate, 100 mM imidazole eluate, 250 mM imidazole eluate and 500 mM imidazole eluate, respectively.

[0056] (4) Induced expression, purification and identification of pGEX-GST-F protein.

[0057] After the pGEX-GST-F protein was induced by IPTG at 37°C for 5 h, the cells were collected and lysed by ultrasonication. SDA-PAGE analysis showed that the pGEX-GST-F protein was expressed in the form of inclusion bodies. Therefore, the pGEX-GST-F protein was purified by gel purification. The concentration of the purified protein was 0.16 mg / mL. Figure 6 and Figure 7 .

[0058] Western Blot analysis showed that the F protein was of the correct size. Figure 8 Therefore, the F protein purified from pGEX-GST-F was used as the coating antigen to establish an ELISA screening method for the subsequent identification of serum titers and screening of hybridomas.

[0059] Example 2

[0060] The preparation method of pigeon Newcastle disease virus monoclonal antibody is as follows:

[0061] S1. Immunizing mice with the immunogen to activate spleen cells in the mouse peritoneal cavity and obtain immune spleen cells that can produce monoclonal antibodies against pigeon Newcastle disease virus.

[0062] (1) Prepare mouse myeloma cell suspension SP2 / 0.

[0063] Two weeks before cell fusion, remove SP2 / 0 cells frozen in liquid nitrogen and resuscitate. Two days before fusion, expand the culture in flasks using DMEM medium containing 20% ​​serum by volume. Prepare two flasks of cells for selection during fusion. Select cells with neat, smooth, translucent edges, in the logarithmic growth phase, and in good growth condition and re-culture the medium 6 hours before fusion. At the time of fusion, gently blow off the cells with serum-free DMEM, centrifuge at 1000 rpm for 5 minutes, resuspend in serum-free DMEM, centrifuge, and finally resuspend in 10 mL of DMEM. Count and set aside.

[0064] (2) Preparation of feeder layer cells.

[0065] One day before fusion, prepare feeder cells and select peritoneal macrophages from 6-week-old BALB / c mice. Eyes of negative mice were enucleated for blood collection. After dislocation of the neck, the mice were placed in 75% medical alcohol and soaked for 5 minutes. Place the mice on a dissection table within the cleanroom, secure their limbs, and carefully use sterile scissors to tear open the abdominal fur, fully exposing the peritoneum while avoiding rupturing it. Use a 5mL sterile syringe to draw an appropriate amount of HAT selective medium and inject it into the mouse's peritoneal cavity, avoiding puncturing the intestine and keeping as far away from the fat as possible. Without removing the syringe, use forceps to gently massage the peritoneal cavity with alcohol pads to thoroughly infiltrate the peritoneal cavity and obtain a sufficient number of macrophages. Then remove the syringe. Repeat this step three times to make up to 40mL of HAT selective medium. Mix thoroughly and aliquot into four 96-well cell plates. Culture in a 37°C, 5% CO2 cell culture incubator until ready for fusion.

[0066] (3) Prepare immune spleen cell suspension.

[0067] The mouse immunization process is as follows:

[0068] First dose: intramuscular injection into the hind leg, 100 μg / mouse Freund's complete adjuvant containing F protein.

[0069] Second vaccination, 21 days after the first vaccination: intramuscular injection into the hind leg, 100 μg / mouse Freund's incomplete adjuvant containing F protein.

[0070] Three vaccinations, 40 days after the first vaccination: intramuscular injection into the hind leg, 100 μg / unit of Freund's incomplete adjuvant containing F protein

[0071] Booster immunization: intraperitoneal injection: 200 μg / mouse F protein, without adjuvant.

[0072] Five days after the booster immunization, blood was collected from the eyeballs of the mice. As much positive blood as possible was collected to prevent the spleen cells from being contaminated with red blood cells, which could affect fusion efficiency. After dislocating the mice by cervical dissection, they were sterilized by soaking in 75% medical alcohol for 5 minutes. The mice were placed on a dissection table in a cleanroom. Sterile scissors were used to carefully tear open the abdominal hair and incise the peritoneum to fully expose the abdominal cavity. The spleen was carefully removed with forceps and placed in 10 mL of serum-free DMEM for washing, removing excess connective tissue. A 5 mL syringe was used to draw up serum-free DMEM and insert it into one end of the spleen to dislodge the splenocytes. This process was repeated several times until the spleen turned pink. Finally, the spleen was minced, filtered through a 40 µm cell strainer, and transferred to a sterile 50 mL centrifuge tube. Centrifuged at 1000 rpm for 6 minutes, and the cells at the bottom were resuspended in 10 mL of serum-free DMEM. The cells were washed once with serum-free DMEM and counted for later use.

[0073] S2. Fusing the immune spleen cells with mouse myeloma cells SP2 / 0, and screening to obtain hybridoma cells that can stably secrete monoclonal antibodies against pigeon Newcastle disease virus.

[0074] (1) Fusion of hybridoma cells.

[0075] After thorough mixing of SP2 / 0 cells and spleen cells at a ratio of 1:10, centrifuge at 800 rpm for 6 minutes, discard the supernatant, and wash once with DMEM. Centrifuge at 800 rpm for 6 minutes, discard the supernatant, and pipette out any remaining liquid to avoid affecting the concentration of the fusion agent. Gently tap the bottom of the centrifuge tube to loosen the cell clumps. Place the centrifuge tube on a wide-mouth bottle containing sterile distilled water preheated at 37°C. Add 1 mL of preheated PEG1450 fusion agent over 1 minute, gently swirling the tube. Incubate at 37°C for 90 seconds. Terminate the fusion with preheated DMEM, adding 1 mL over 1 minute, then 2 mL over 1 minute, for a total of 15 mL. Incubate at 37°C for 5 minutes. Centrifuge at 800 rpm for 6 minutes, discard the supernatant, gently tap the tube to loosen the cell clumps, add HAT selection medium, and mix gently. The fused cells are plated into a 96-well plate containing feeder cells and cultured in a cell culture incubator. After fusion, observe the cells every day for contamination and growth status. On the 5th day after fusion, if the culture medium turns yellow, aspirate the original culture medium and add 100µL HT selective medium.

[0076] (2) Screening of positive hybridoma cells.

[0077] On day 10 after fusion, when cells have grown to cover the bottom 1 / 10 of the cell plate, positive cells can be screened. Using the indirect ELISA method, aspirate 40µL and 60µL of cell culture medium as the primary antibody, respectively. Serum from immunized mice serves as a positive control, while serum from negative mice serves as a negative control. Positive clones are carefully transferred to 24-well cell plates and cultured. After stable cell growth, assay the cells. If positive, proceed to the next step of subcloning.

[0078] (3) Subcloning of positive hybridoma cells.

[0079] Cells that test strongly positive using indirect ELISA are subcloned using the limiting dilution method. Gently aspirate the cells in the 24-well plate and mix the cell suspension with 0.4% trypan blue solution at a ratio of 9:1. Count the cells on an automated cell counter and dilute them with 20% culture medium to 10 viable cells / mL. Add 100µL to each well of a 96-well plate and incubate in a cell culture incubator at 37°C and 5% CO2. Remaining cells are further expanded and frozen. During the first three days after subcloning, inspect the cells for contamination and the presence of single cells in each well. If not, perform subcloning again promptly. When the cells have grown to 1 / 10 to 1 / 5 of the bottom, perform the same assay. Select wells with strongly positive single cells and perform subcloning again using the same method. Generally, after three subclones per well, a stable monoclonal antibody-secreting cell line will be obtained. The resulting cell line that stably secretes monoclonal antibodies is promptly expanded and frozen. This method has been used to obtain a hybridoma cell line that stably secretes monoclonal antibodies against pigeon Newcastle disease virus. Mus Musculus, F5.

[0080] (4) Cryopreservation and recovery of hybridoma cells.

[0081] Cell freezing: Wash the cell culture dish containing hybridoma F5 cells three times with PBS, resuspend and mix with DMEM medium, centrifuge at 1000 rpm for 8 minutes, discard the supernatant, resuspend and mix with cell freezing solution, add to sterile cell freezing tubes, mark them, place them in a freezing box, freeze them in a -80℃ refrigerator for 24 hours, and then transfer them to a liquid nitrogen tank for long-term storage.

[0082] Cell recovery: After quickly taking out F5 cells from the liquid nitrogen tank, place them in a 37°C water bath and gently stir. After thawing, centrifuge at 1000 rpm for 8 minutes, discard the supernatant, resuspend in DMEM containing 20% ​​serum, and place in a cell culture incubator for culture.

[0083] S3. Using the hybridoma cell F5 to prepare monoclonal antibodies.

[0084] Monoclonal antibodies to pigeon Newcastle disease virus were prepared using an in vitro culture method as follows:

[0085] After hybridoma cells F5 were transferred to T75 cell flasks for expansion and culture, the cells were completely dead and shed, and the cell supernatant was collected and centrifuged at 1000 rpm for 10 minutes. The supernatant, i.e., the monoclonal antibody against pigeon Newcastle disease virus, was taken and aliquoted and stored at -80°C.

[0086] It should be noted that in S3 of Example 2, the monoclonal antibody can also be prepared by in vivo ascites induction method, the purpose of which is to obtain monoclonal antibodies, which is similar to the effect produced by the in vitro culture method.

[0087] The method of inducing ascites in vivo is as follows:

[0088] Eight multiparous mice were purchased and each multiparous mouse was intraperitoneally injected with Freund's complete adjuvant for sensitization. Ten days later, the hybridoma F5 cells that were growing well were washed once with serum-free DMEM, resuspended in serum-free DMEM, counted using the trypan blue counting method, and diluted to 10 6 Cells / mL. Each mouse was injected intraperitoneally with 500 µL of the solution. Gently massage the mouse's abdomen after injection. Seven days later, the mouse's abdomen was noticeably distended. Ascites was collected using a 10 mL syringe needle. Centrifuge at 4000 rpm for 10 minutes to remove impurities such as fat. The supernatant was collected, aliquoted, and stored at -80°C.

[0089] The identification of the pigeon Newcastle disease virus monoclonal antibody obtained in Example 2 is as follows:

[0090] The pGEX-GST-F protein was diluted to four concentrations of 0.8 μg / mL, 0.4 μg / mL, 0.2 μg / mL, and 0.1 μg / mL for antigen coating. At the same time, the mouse serum was diluted from 1:1600 to 1:51200, a total of 6 dilutions, and incubated as the primary antibody for indirect ELISA. The measured OD values ​​were then plotted in a table, and the optimal concentration was selected using the checkerboard method. The results showed that when the antigen coating concentration was 0.2 μg / mL and the mouse serum was diluted 1:6400, the positive absorbance value measured at 450 nm was near 1.0 and the P / N value was the largest. Therefore, the optimal antigen coating concentration of F protein was 0.2 μg / ml, and the optimal serum dilution was 1:6400. The results are shown in Table 1.

[0091] Table 1 Determination of the optimal F protein antigen coating concentration and optimal serum dilution

[0092]

[0093] WB identification showed that hybridoma cell supernatant F5 and mouse ascites could react specifically with the two prokaryotically expressed fusion proteins. Figure 9 .

[0094] Using TF-his-F protein as antigen, mouse ascites was diluted at different times as primary antibody for WB test. The results showed that the highest dilution of the prepared monoclonal antibody reached 1:12800. Figure 10 .

[0095] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0096] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.

Claims

1. An immunogen for pigeon Newcastle disease virus, characterized in that: The nucleotide sequence encoding the immunogen is shown in SEQ ID NO.

2.

2. A recombinant vector comprising the nucleotide sequence of claim 1.

3. A monoclonal antibody against pigeon Newcastle disease virus prepared using the immunogen according to claim 1, characterized in that: The hybridoma cell line secreting the monoclonal antibody has a deposition number of CGMCC No. 46056 and was deposited in the General Microbiology Center of the China Culture Collection Administration on October 10, 2024.

4. A kit for detecting Newcastle disease virus in pigeons, characterized in that The kit comprises any one of the immunogen according to claim 1, the recombinant vector according to claim 2, or the monoclonal antibody according to claim 3.

5. A preparation for preventing or treating Newcastle disease virus in pigeons, characterized in that: The preparation comprises any one of the immunogen according to claim 1, the recombinant vector according to claim 2 or the monoclonal antibody according to claim 3.

Images