Recombinant fibronectin as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of biology, and discloses recombinant fibronectin as well as a preparation method and application thereof. The recombinant fibronectin provided by the invention comprises an amino acid fragment with a sequence as shown in SEQ ID NO: 1 and / or a variant sequence with at least 80% homology with the amino acid fragment as shown in SEQ ID NO: 1, and can be correctly and massively expressed in prokaryotic expression systems such as escherichia coli, bacillus subtilis and the like; in addition, the recombinant fibronectin also has excellent cell adhesion capacity and biological activity for promoting cell migration, is an active substance which has great potential and is used for promoting tissue or wound repair, and has a good application prospect in preparation of products for promoting tissue or wound repair.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a recombinant fibronectin, a preparation method thereof, and an application thereof. Background Art

[0002] Fibronectin (FN) is an important component of the extracellular matrix widely present in animal tissues and body fluids. FN is a high-molecular-weight dimer glycoprotein composed of two subunits of about 220 kDa connected by disulfide bonds. Although the FN subunits from different tissue sources are different, they are all composed of repeated amino acid sequences to form multiple globular domains, which enables FN to have multiple functions and can bind to different macromolecules or cell surface specific receptors.

[0003] In the human body, FN is divided into soluble plasma type and insoluble cellular type. Among them, plasma FN is mainly synthesized by hepatocytes and is distributed in blood and body fluids, mainly playing a role in the early stage of wound repair; cellular FN is mainly secreted by fibroblasts, vascular endothelial cells and macrophages, and is distributed on the cell surface and matrix, helping cells to restore their morphology and arrangement. Compared with plasma FN, it has better coagulation and tissue repair effects; in addition, FN has good binding properties with collagen, can provide a scaffold in wound repair, promote cell migration to the wound, maintain the stability of the extracellular matrix, regulate cell adhesion, migration, proliferation and apoptosis, and promote the formation of collagen structure, and has great application potential in biomedicine.

[0004] At present, the methods for obtaining FN protein are mainly direct extraction method and genetic engineering technology. Among them, the direct extraction method directly extracts FN using biological tissues as raw materials; however, due to the tight binding of FN to extracellular matrix components in tissues, the direct extraction method has problems such as complex process and high cost. Genetic engineering technology is based on prokaryotic expression systems such as Escherichia coli, constructs an expression strain for expressing FN protein in vitro, and biosynthesizes recombinant FN using the expression strain; however, due to the large size of the FN protein fragment and the lack of corresponding protein structure folding and modification systems in prokaryotic expression systems such as Escherichia coli, the recombinant FN prepared has the problem of low biological activity and has great limitations. Summary of the Invention

[0005] The first object of the present invention is to solve the problem of high immunogenicity of FN obtained by natural extraction in the prior art, and to provide a recombinant fibronectin. The recombinant fibronectin can be correctly and abundantly expressed in prokaryotic expression systems such as Escherichia coli and Bacillus subtilis, and the recombinant fibronectin also has excellent biological activity of promoting cell migration, and is a highly potential active substance for promoting tissue or wound repair.

[0006] Specifically, the recombinant fibronectin provided by the present invention specifically includes an amino acid fragment with a sequence as shown in SEQ ID NO: 1 and / or a variant sequence having at least 80% homology with the amino acid fragment shown in SEQ ID NO: 1.

[0007] Further, the recombinant fibronectin includes a protein tag, and the protein tag is selected from one or more of a 6×His tag, a Flag tag, a GST tag, an MBP tag, and a Myc tag.

[0008] The second object of the present invention is to provide a nucleic acid molecule encoding the above-mentioned recombinant fibronectin.

[0009] The third object of the present invention is to provide a recombinant strain that synthesizes and expresses the above-mentioned recombinant fibronectin.

[0010] Further, the recombinant strain includes the above-mentioned nucleic acid molecule.

[0011] Further, the chassis cells of the recombinant strain are selected from one or more of Saccharomyces cerevisiae, Pichia pastoris, Streptomyces, Bacillus subtilis, and Escherichia coli.

[0012] Further, the chassis cells of the recombinant strain are Bacillus subtilis WB800N.

[0013] The fourth object of the present invention is to provide a preparation method of the above-mentioned recombinant fibronectin, and the preparation method specifically includes: taking the above-mentioned recombinant strain for induced expression to obtain the recombinant fibronectin.

[0014] Further, when the chassis cells of the recombinant strain are Bacillus subtilis WB800N, the temperature of the induced expression is 30-40 °C, and the time is 6-48 h.

[0015] The fifth object of the present invention is to provide the application of the above-mentioned recombinant fibronectin in the preparation of products for promoting tissue or wound repair.

[0016] Beneficial effects:

[0017] The recombinant fibronectin provided by the present invention can be correctly and abundantly expressed in prokaryotic expression systems such as Bacillus subtilis and Escherichia coli, and is easy to be purified, having the potential for large-scale industrial production; in addition, the recombinant fibronectin shows good effects in promoting cell migration in cell scratch experiments of cells such as fibroblasts and human umbilical cord mesenchymal stem cells, and has excellent cell adhesion ability, and can promote cells to the damaged site and adhere and fix them to achieve the effect of promoting tissue or wound repair, and can be well applied to the preparation of products for promoting tissue or wound repair, having a broad application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 It is a schematic structural diagram of the recombinant plasmid for recombinant fibronectin expression provided in Example 1 of the present invention;

[0019] Figure 2 It is a gel electrophoresis diagram of the flow-through solution, washing solution and elution solution provided in Example 3 of the present invention;

[0020] Figure 3 It is one of the experimental result diagrams of the test on the cell migration promoting effect of recombinant fibronectin on L-929 fibroblasts provided in Example 4 of the present invention (scale bar is 500 μm);

[0021] Figure 4 It is the second experimental result diagram of the test on the cell migration promoting effect of recombinant fibronectin on L-929 fibroblasts provided in Example 4 of the present invention;

[0022] Figure 5 It is one of the experimental result diagrams of the test on the cell adhesion effect of recombinant fibronectin on L-929 fibroblasts provided in Example 4 of the present invention (scale bar is 300 μm);

[0023] Figure 6 It is the second experimental result diagram of the test on the cell adhesion effect of recombinant fibronectin on L-929 fibroblasts provided in Example 4 of the present invention;

[0024] Figure 7 It is one of the experimental result diagrams of the test on the cell migration promoting effect of recombinant fibronectin on human umbilical cord mesenchymal stem cells HUMSCs provided in Example 4 of the present invention (scale bar is 500 μm);

[0025] Figure 8 It is the second experimental result diagram of the test on the cell migration promoting effect of recombinant fibronectin on human umbilical cord mesenchymal stem cells HUMSCs provided in Example 4 of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0026] Based on the problems existing in the existing fibronectin, such as complex preparation process, high production cost and low activity of the obtained recombinant fibronectin, the inventors of the present invention have carried out extensive and in-depth research and a large number of experiments, analyzed the structures of a large number of existing known natural fibronectins, and designed based on this, and creatively obtained the recombinant fibronectin claimed in the present invention.

[0027] In the present invention, the recombinant fibronectin comprises an amino acid fragment having a sequence as shown in SEQ ID NO:1 and / or a variant sequence having at least 80% homology with the amino acid fragment shown in SEQ ID NO:1. Among them, the variant sequence is obtained by substituting, deleting or adding one or more amino acids to the amino acid fragment shown in SEQ ID NO:1, and the substitution, deletion or addition that occurs does not affect the biological activity of the recombinant fibronectin.

[0028] In the present invention, the recombinant fibronectin preferably further comprises a protein tag. Among them, the protein tag serves as a marker sequence for purifying the recombinant fibronectin and does not affect the biological activity of the recombinant fibronectin. This protein tag is a conventional technical means in genetic engineering technology, and the present invention does not specifically limit it.

[0029] In some specific embodiments, specific examples of the protein tag include, but are not limited to, one or more of a 6×His tag, a Flag tag, a GST tag, an MBP tag, and a Myc tag.

[0030] In the present invention, the recombinant fibronectin preferably further comprises a cleavage site. Among them, the cleavage site is used to remove the protein tag and does not affect the biological activity of the recombinant fibronectin. This cleavage site is a conventional technical means in genetic engineering technology, and the present invention does not specifically limit it.

[0031] In the present invention, the key to the excellent cell migration-promoting effect of the recombinant fibronectin lies in the amino acid fragment having a sequence as shown in SEQ ID NO:1 and / or a variant sequence having at least 80% homology with the amino acid fragment shown in SEQ ID NO:1; and the above-introduced fragments such as protein tags and cleavage sites are further optimizations of the recombinant fibronectin, and their purpose is to better realize the preparation of the recombinant fibronectin and do not limit the recombinant fibronectin claimed in the present invention. In other words, recombinant fibronectins including the above protein tags, cleavage sites, scar sequences after cleavage or other fragments are all included in the protection scope of the present invention.

[0032] For the purpose of obtaining the above recombinant fibronectin, the present invention also provides a nucleic acid molecule. The nucleic acid molecule encodes the above recombinant fibronectin.

[0033] In the present invention, the nucleotide sequence of the nucleic acid molecule is determined according to the recombinant fibronectin and the protein expression system to be used. Those skilled in the art can make adaptive designs according to actual needs, and the present invention does not specifically limit it.

[0034] For the purpose of obtaining the above-mentioned recombinant fibronectin, the present invention also provides a recombinant strain. The recombinant strain synthesizes and expresses the above-mentioned recombinant fibronectin.

[0035] In the present invention, the recombinant strain is constructed by introducing the above-mentioned nucleic acid molecule into a protein expression system based on the protein expression systems commonly used in genetic engineering technology. The protein expression system can specifically be a prokaryotic cell expression system and / or a cell-free expression system.

[0036] In the present invention, a prokaryotic expression system is preferably used during the construction of the recombinant strain; at this time, specific examples of the chassis cells of the recombinant strain include, but are not limited to, one or more of Saccharomyces cerevisiae, Pichia pastoris, Streptomyces, Bacillus subtilis, and Escherichia coli.

[0037] In some specific embodiments, the chassis cell of the recombinant strain is preferably Bacillus subtilis WB800N. At this time, Bacillus subtilis WB800N has more excellent performance in the stability of secreted proteins, and the recombinant fibronectin can be highly expressed in this Bacillus subtilis WB800N to achieve good preparation effects, and has broad application prospects in realizing the large-scale industrial production of the recombinant fibronectin.

[0038] The present invention also provides a method for preparing the above-mentioned recombinant fibronectin. The preparation method specifically includes: taking the above-mentioned recombinant strain for induction expression to obtain the recombinant fibronectin.

[0039] In the present invention, the method and conditions for induction expression are determined according to the chassis cells of the recombinant strain used, and those skilled in the art can make adaptive selections according to actual needs, and the present invention does not particularly limit it.

[0040] In some specific embodiments, when the chassis cell of the recombinant strain is Bacillus subtilis WB800N, the conditions for induction expression include that the temperature is preferably 30-40 °C, such as 30 °C, 31.2 °C, 32 °C, 33 °C, 35 °C, 38 °C, 40 °C or any value between them; the time is preferably 6-48 h, such as 6 h, 12 h, 18 h, 24 h, 36 h, 48 h or any value between them.

[0041] Based on the cell adhesion ability and the biological activity of promoting cell migration of the above-mentioned recombinant fibronectin, the present invention also provides the application of the recombinant fibronectin in the preparation of products for promoting tissue or wound repair.

[0042] Embodiments of the present invention will be described in detail below. Examples of the embodiments are intended to explain the present invention and should not be construed as limiting the present invention. For those without specific technical or conditions noted in the embodiments, the techniques or conditions described in the literature in the art or according to the product specifications are followed. Reagents or instruments without the manufacturer noted are all conventional products that can be obtained through commercial purchase.

[0043] The nucleotide sequences and amino acid sequences involved in the present invention are specifically shown in Table 1.

[0044] Table 1.

[0045]

[0046] Example 1.

[0047] This example is used to illustrate a pHT43-FNSF recombinant plasmid for recombinant fibronectin expression and its construction method. The construction specifically includes:

[0048] I. Design of recombinant fibronectin and its coding gene

[0049] 1. Analyze the structure of the existing known natural fibronectin, rearrange and optimize the functional domains therein, obtain a recombinant fibronectin including a fragment with the amino acid sequence shown in SEQ ID NO: 1, and sequentially introduce an enterokinase cleavage site shown in SEQ ID NO: 2 and a 6×His tag shown in SEQ ID NO: 3 at the C-terminus of the recombinant fibronectin.

[0050] 2. Based on the amino acid fragment obtained from the above design, perform codon optimization for Bacillus subtilis to obtain a gene fragment (hereinafter referred to as the FNSF fragment) for guiding the expression of recombinant fibronectin. The nucleotide sequence is specifically shown in SEQ ID NO: 4. This gene fragment is synthesized by Biosynthesis Company and carried on the pet-22b(+) plasmid to obtain the pet-22b(+)-FNSF recombinant plasmid.

[0051] II. Construction of the recombinant plasmid for recombinant fibronectin expression

[0052] 1. Amplification of the pet-22b(-)-FNSF recombinant plasmid: (1) Transform the pet-22b(+)-FNSF recombinant plasmid into Escherichia coli E. coli DH5α competent cells (Sangon Biotech, catalog number B528413, the same below) according to the instructions, and coat it on an LB solid culture plate containing 100 μg / mL ampicillin, and culture it overnight at 37°C to obtain positive clones.

[0053] (2) Inoculate the positive clone into LB liquid medium containing 100 μg / mL ampicillin and culture it overnight at 37°C. Use a plasmid extraction kit (Aikerui Biotech, product number AG21002, the same below) and refer to the instruction manual to extract the plasmid, obtaining a large amount of pet-22b(+)-FNSF recombinant plasmid.

[0054] 2. Preparation of FNSF fragment: Use the primer system shown in Table 2 to perform PCR amplification on the pet-22b(+)-FNSF recombinant plasmid, and verify the band size by electrophoresis and perform gel recovery to obtain the FNSF fragment. Homologous arms at both ends of the BamHⅠ restriction enzyme site of the pHT43 plasmid are introduced at both ends of the FNSF fragment.

[0055] Table 2.

[0056] Name SEQ ID NO: Sequence Forward primer 5 CAAAAACATCAGCCGTAGATATGACCCCGTCTCAGCCG Reverse primer 6 GGACGTCGACTCTAGAGATTAGTGGTGGTGGTGGTGATG

[0057] Among them, the PCR reaction system includes: 25 μL of 2×Phanta Max Master Mix, 2 μL of forward primer (10 μM), 2 μL of reverse primer (10 μM), 1 μL of pet-22b(+)-FNSF plasmid template, and ddH2O is added to make up to 50 μL. The PCR reaction program includes: pre-denaturation at 95°C for 30 s; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 1 min, for 33 cycles; storage at 4°C.

[0058] 3. Preparation of linearized pHT43 plasmid: (1) Transform the pHT43 plasmid (Shanghai Zeye Biotech, product number ZY1860, the same below) into E. coli DH5α competent cells, and coat it on an LB solid culture plate containing 100 μg / mL ampicillin and culture it overnight at 37°C to obtain positive clones.

[0059] (2) Inoculate the positive clone into LB liquid medium containing 100 μg / mL ampicillin and culture it overnight at 37°C. Use a plasmid extraction kit and refer to the instruction manual to extract the plasmid, obtaining a large amount of pHT43 plasmid, and use an ultraviolet analyzer to measure the concentration of the pHT43 plasmid.

[0060] (3) Use QuickCut BamHⅠ (Takara, product number 1605) and refer to the instruction manual to perform a restriction enzyme digestion reaction on the pHT43 plasmid at 30°C for 5 min, and verify the band size by electrophoresis and perform gel recovery to obtain the linearized pHT43 plasmid.

[0061] 4. Preparation of pHT43-FNSF recombinant plasmid: Using a seamless cloning kit (Novoprotein, product number C112-01) and referring to the instruction manual, linearized pHT43 plasmid and FNSF fragment were taken for seamless cloning and ligation at 37°C for 30 min to obtain pHT43-FNSF recombinant plasmid. The structure of this pHT43-FNSF recombinant plasmid is as shown in Figure 1 and it was stored at -20°C for later use.

[0062] Example 2.

[0063] This example is used to illustrate a WB800N-pHT43-FNSF recombinant engineering bacterium for recombinant fibronectin expression and its construction method. The construction specifically includes:

[0064] 1. Amplification of pHT43-FNSF recombinant plasmid: (1) The pHT43-FNSF recombinant plasmid provided in Example 1 was transformed into Escherichia coli DH5α competent cells and spread on an LB solid culture plate containing 100 μg / mL ampicillin, and cultured at 37°C for 14 h to obtain positive clones.

[0065] (2) The positive clones were inoculated into an LB liquid medium containing 100 μg / mL ampicillin and cultured overnight at 37°C. Plasmid extraction was carried out using a plasmid extraction kit and referring to the instruction manual to obtain a large amount of pHT43-FNSF recombinant plasmid.

[0066] 2. Construction of WB800N-pHT43-FNSF recombinant engineering bacterium: (1) A single colony of Bacillus subtilis WB800N (Biosciences, product number pL057, the same below) was inoculated into GMⅠ medium and cultured at 30°C and 125 rpm for 24 h to obtain an activated bacterial solution.

[0067] (2) 2 mL of the activated bacterial solution was inoculated into 18 mL of GMⅠ medium and cultured at 37°C and 220 rpm for 3.5 h to obtain a seed bacterial solution.

[0068] (3) 10 mL of the seed bacterial solution was inoculated into 190 mL of GMⅡ medium and cultured at 37°C and 125 rpm for 90 min, then centrifuged at 5000 g for 10 min to collect the bacterial cells, and 10 mL of the supernatant was reserved to resuspend the bacterial cells to obtain Bacillus subtilis WB800N competent cells, and 6 mL of 30% glycerol was added and mixed evenly, aliquoted, and stored at -80°C.

[0069] (4) Take the competent cells of Bacillus subtilis WB800N and treat them in a water bath at 45°C for 60 s. Then, take 500 μL of the bacterial solution and mix it with 5 μL of the recombinant plasmid pHT43-FNSF. Incubate the mixture at 37°C and 200 rpm for 90 min. After that, take 200 μL of the bacterial solution and spread it on an LB solid culture plate containing chloramphenicol. Incubate the plate upside down at 37°C for 16 h. Verify the obtained single colonies to get positive clones successfully introduced with the recombinant plasmid pHT43-FNSF. This positive clone is the recombinant engineering bacterium WB800N-pHT43-FNSF, which is preserved in a glycerol tube.

[0070] Example 3.

[0071] This example is used to illustrate the preparation of recombinant fibronectin. The specific preparation steps include:

[0072] 1. Expression of recombinant fibronectin: (1) Pick a single colony of the recombinant engineering bacterium WB800N-pHT43-FNSF provided in Example 2 and inoculate it into an LB liquid medium containing chloramphenicol. Incubate it overnight at 37°C and 220 rpm to obtain a seed solution.

[0073] (2) Take 5 mL of the seed solution and inoculate it into 500 mL of an LB liquid medium containing chloramphenicol. Incubate it at 37°C and 200 rpm until the OD 600 value of the culture broth reaches 0.8. Then, add isopropyl β-D-thiogalactoside at an addition amount of 0.5 mM in terms of the final concentration. Induce expression at 37°C and 150 rpm for 16 h to obtain a fermentation broth.

[0074] 2. Purification of recombinant fibronectin: Take the fermentation broth and centrifuge it at 4°C and 8000 rpm for 15 min. Collect the supernatant and add 40 wt% ammonium sulfate to precipitate the supernatant. Centrifuge it at 4°C and 8000 rpm for 15 min, discard the supernatant, and purify the protein precipitate using a His-tag denaturation-resistant nickel column (Beyotime, product number P2233) with reference to the instruction manual. Collect the flow-through fraction, washing fraction, and elution fraction.

[0075] Take the flow-through fraction, washing fraction, and elution fraction and mix them with 4× loading buffer containing DDT, then perform boiling treatment for 10 min, and then carry out SDS-PAGE gel electrophoresis. The results are as Figure 2 shown.

[0076] From Figure 2 the test results shown, it can be known that the molecular weight of the recombinant fibronectin contained in the elution fraction is approximately 27 kDa.

[0077] (3) The eluate was ultrafiltered using a 10 kD protein ultrafiltration tube, and after buffer replacement with PBS (Pusenuo, catalog number PB180327), the protein concentration of the solution was measured using a BCA protein concentration kit (Takara, catalog number T9300A) and adjusted to 1 mg / mL. After filtration through a 0.22 μm filter membrane, it was stored at -20 °C.

[0078] Example 4.

[0079] This example is used to illustrate the activity of the recombinant fibronectin provided in Example 3. The specific tests include:

[0080] 1. Promoting cell migration of L-929 fibroblasts: (1) Use a marker pen to draw line markings on the back of a six-well plate filled with RPMI-1640 medium, with 5 lines drawn in each well.

[0081] (2) Take L-929 fibroblasts at an inoculation density of 6×10 5 cells / well for cell seeding. After the cells have grown to a confluent monolayer, use a 200 μL pipette tip to closely adhere to the edge of the six-well plate lid and draw lines perpendicular to the horizontal lines marked with the marker pen in the wells.

[0082] (3) After washing the non-adherent cells with PBS, add 10 μL of recombinant fibronectin solutions at concentrations of 5 μg / mL, 10 μg / mL, 20 μg / mL, 50 μg / mL, and 100 μg / mL respectively, and use an equal volume of PBS as the blank control group (control). Incubate at 37 °C and 5% CO2 for 48 h.

[0083] (4) Take photos using a fluorescence inverted microscope at 0 h, 12 h, 24 h, and 48 h of culture, and analyze the microscope imaging results using Image J software to calculate the cell migration rate. The results are as Figure 3 and 4 shown. In Figure 4 , * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, **** indicates P < 0.0001, and ns indicates no significant difference.

[0084] From Figure 3 and 4 The test results shown indicate that compared with the blank control group, treating L-929 fibroblasts with recombinant fibronectin at concentrations of 5 - 100 μg / mL significantly increased the cell migration area, that is, the recombinant fibronectin has a promoting effect on the migration of L-929 fibroblasts, achieving the effect of promoting scratch healing.

[0085] 2. Adhesion to L-929 fibroblasts: (1) Pre-coat a 96-well plate with 100 μL of recombinant fibronectin solution containing 0 μg / mL, 5 μg / mL, 10 μg / mL, 20 μg / mL, 50 μg / mL, and 100 μg / mL respectively. After blocking with 1% BSA, wash twice with PBS and set aside.

[0086] (2) Add L-929 fibroblasts to the 96-well plate at an inoculation density of 1×10 4 cells / well and culture at 37 °C under 5% CO2 for 2 h.

[0087] (3) Wash away the non-adherent cells with PBS, then fix the cells with 4% paraformaldehyde (Sangon Biotech, E672002) according to the instruction manual, and then stain the cells with 0.1% crystal violet (Macklin, C805209) according to the instruction manual. After staining, wash the residual crystal violet with PBS, and observe and photograph under an inverted microscope. The results are shown in Figure 5 and 6 as shown. In Figure 6 , * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, **** indicates P < 0.0001, and ns indicates no significant difference.

[0088] From Figure 5 and 6 the test results shown, compared with the blank control group, recombinant fibronectin has excellent cell adhesion ability to L-929 fibroblasts.

[0089] 3. Promoting cell migration of human umbilical cord mesenchymal stem cells (HUMSCs): (1) Use a marker pen to draw lines on the back of a six-well plate filled with DMEM / F12 medium, with 5 lines per well;

[0090] (2) Seed human umbilical cord mesenchymal stem cells (HUMSCs) at an inoculation density of 3×10 5 cells / well. After the cells form a confluent monolayer, use a 200 μL pipette tip to closely adhere to the edge of the six-well plate lid and draw a line perpendicular to the horizontal line marked by the marker pen in the well;

[0091] (3) After washing away the non-adherent cells with PBS, add 10 μL of recombinant fibronectin solution at concentrations of 5 μg / mL, 10 μg / mL, 20 μg / mL, 50 μg / mL, and 100 μg / mL respectively, and use an equal volume of PBS as the blank control group. Culture at 37 °C under 5% CO2 for 48 h.

[0092] (4) Photos were taken using a fluorescence inverted microscope at 0, 6 h, 12 h, and 24 h of culture, and the Image J software was used to analyze the microscope imaging results to calculate the cell migration area. The results are as Figure 7 and 8 shown. In Figure 8 , * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, **** indicates P < 0.0001, and ns indicates no significant difference.

[0093] From Figure 7 and 8 The test results shown, compared with the blank control group, treating human umbilical cord mesenchymal stem cells (HUMSCs) with recombinant fibronectin at a concentration of 5 - 100 μg / mL significantly increased the cell migration area, that is, recombinant fibronectin has a promoting effect on the migration of human umbilical cord mesenchymal stem cells (HUMSCs), achieving the effect of promoting scratch healing.

[0094] Although the embodiments of the present invention have been shown and described above, it can be understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those of ordinary skill in the art can make changes, modifications, substitutions, and variations to the above embodiments within the scope of the present invention without departing from the principles and purposes of the present invention.

Claims

1. A recombinant fibronectin, characterized in that, The recombinant fibronectin comprises an amino acid fragment having a sequence as shown in SEQ ID NO: 1 and / or a variant sequence having at least 80% homology with the amino acid fragment shown in SEQ ID NO:

1.

2. The recombinant fibronectin according to claim 1, wherein The recombinant fibronectin comprises a protein tag selected from one or more of a 6×His tag, a Flag tag, a GST tag, an MBP tag, and a Myc tag.

3. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the recombinant fibronectin according to claim 1 or 2.

4. A recombinant strain, characterized in that, The recombinant strain synthesizes and expresses the recombinant fibronectin according to claim 1 or 2.

5. The recombinant strain according to claim 4, characterized in that, The recombinant strain comprises the nucleic acid molecule according to claim 3.

6. The recombinant strain according to claim 4, wherein The chassis cell of the recombinant strain is selected from one or more of Saccharomyces cerevisiae, Pichia pastoris, Streptomyces, Bacillus subtilis, and Escherichia coli.

7. The recombinant strain according to claim 4, wherein The chassis cell of the recombinant strain is Bacillus subtilis WB800N.

8. The method for preparing the recombinant fibronectin according to claim 1 or 2, characterized in that, The preparation method comprises: taking the recombinant strain according to any one of claims 4 to 7 for induced expression to obtain the recombinant fibronectin.

9. The method for preparing recombinant fibronectin according to claim 8, wherein When the chassis cell of the recombinant strain is Bacillus subtilis WB800N, the temperature of the induced expression is 30-40 °C and the time is 6-48 h.

10. Use of the recombinant fibronectin according to claim 1 or 2 in the preparation of a product for promoting tissue or wound repair.

Images