Aspergillus, and metabolite and application thereof
By isolating Aspergillus udagawae from Guilin Huixian Wetland and preparing the secondary metabolite acetylaszonalenin, the problem of difficult to obtain structurally novel active natural products from ordinary microorganisms is solved, and ideas for developing anti-inflammatory drugs are provided.
Patent Information
- Application Number
- CN202510167510.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-16
- Publication Date
- 2025-07-04
AI Technical Summary
It is difficult to isolate the novel active natural products from plants and common microorganisms, and the fungal resources in wetlands are underutilized, affecting the development of drug-leading compounds.
Aspergillus udagawae was isolated from Guilin Huixian Wetland, and the secondary metabolite acetylaszonalenin was prepared by fermentation culture, silica gel column chromatography, reverse phase C18 column chromatography and semi-preparative HPLC separation.
The obtained secondary metabolite acetylaszonalenin has no obvious cytotoxicity to RAW264.7 cells, and its NO inhibitory activity is better than indomethacin, and it has the potential to develop an anti-inflammatory drug.
Smart Images

Figure CN120249064A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of microbial technology, in particular to an Aspergillus strain, its metabolites and applications. Background Art
[0002] The secondary metabolites of microorganisms have always been an important source of drug lead compounds due to their rich structural skeleton types and diverse biological activities. At present, it is becoming increasingly difficult to isolate novel active natural products from plants and common microorganisms, which has prompted researchers to turn their attention to microorganisms in some special habitats. Wetlands are precious natural resources with rich biological communities and important ecological functions, and are one of the most important living environments for humans. The spatial distribution of wetland fungi has significant habitat-dependent characteristics. Changes in environmental conditions can cause corresponding changes in the structure and function of soil microbial communities, leading to the generation of new genotypes and then the expression of novel secondary metabolites with novel structures.
[0003] Guilin is the most typical area with karst peak forest plain landform in the world and has rich biodiversity. Huixian Wetland in Guilin may contain special fungal resources due to its unique geographical location and environment. Further exploring the microorganisms in Huixian Wetland in Guilin is of great significance for exploring microorganisms to promote the development of drug lead compounds. Summary of the Invention
[0004] The present invention provides an Aspergillus strain, its metabolites and applications. The strain is isolated from Huixian Wetland in Guilin, which can provide more ideas for the preparation of anti-inflammatory drugs.
[0005] To achieve the above object, the technical solution of the present invention is as follows:
[0006] An Aspergillus strain, classified and named as: Aspergillus udagawae, was deposited at the Guangdong Provincial Culture Collection of Microorganisms (GDMCC) on February 5, 2025, and the deposit number is GDMCC No: 65859.
[0007] The present invention also provides the nucleotide sequence of the 16S rDNA of the above-mentioned strain, as shown in Sequence Listing SEQ ID NO: 1.
[0008] The present invention also provides the secondary metabolite obtained after fermentation and culture of the above-mentioned Aspergillus strain. The secondary metabolite is acetylaszonalenin, and its structural formula is as follows:
[0009]
[0010] The present invention also provides a method for preparing the secondary metabolite of the above-mentioned Aspergillus strain, including the following steps:
[0011] (1) Inoculate the Aspergillus into PDB liquid medium and culture it on a shaker at 26 - 30 °C for 2 - 4 days to obtain a seed solution;
[0012] (2) Inoculate the seed solution prepared in step (1) into the sterilized rice medium and statically culture it for 26 - 32 days to obtain the fermented rice medium;
[0013] (3) Take the fermented rice medium, add 1 - 1.2 times the volume of methanol and extract for 36 - 60 h, concentrate under reduced pressure to remove methanol, repeat 1 - 3 times to obtain an extract, then extract the extract with ethyl acetate, concentrate under reduced pressure to remove ethyl acetate after extraction, and dry to obtain an ethyl acetate fraction extract;
[0014] (4) The ethyl acetate fraction extract is separated by silica gel column chromatography to obtain 4 fractions, Fr.1 - Fr.4. Take Fr.3, subject it to reverse - phase C18 column chromatography on a rapid column purification system to obtain 10 sub - fractions, Fr.3.1 - Fr.3.10. Take sub - fraction Fr.3.8 and separate and purify it by semi - preparative HPLC to obtain the secondary metabolite acetylaszonalenin.
[0015] Preferably, in step (4), in the silica gel column chromatography separation, a gradient elution is carried out with a petroleum ether - ethyl acetate mobile phase system. The gradient, calculated by volume ratio, is successively 10:0, 9:1, 4:1, 2:1, 1:1, 0:1.
[0016] Preferably, in step (4), in the reverse - phase C18 column chromatography, a gradient elution is carried out with methanol - water, and the volume concentration gradient is 30 - 100%.
[0017] Preferably, in step (4), in the semi - preparative HPLC separation and purification, the mobile phase uses methanol - water with a volume ratio of 55:45.
[0018] Preferably, in step (2), the rice medium is made from the following raw materials in parts by weight: 100 parts of rice, 70 - 100 parts of water.
[0019] The present invention also provides the use of the above - mentioned secondary metabolite or the secondary metabolite obtained by the above - mentioned preparation method in the preparation of anti - inflammatory drugs.
[0020] A strain of Aspergillus was isolated from the soil sample collected from Huixian Wetland in Guilin, Guangxi. This Aspergillus is used for the preparation of secondary metabolites. The obtained secondary metabolite, acetylaszonalenin, has no obvious cytotoxicity to RAW264.7 cells, and its NO inhibitory activity on RAW264.7 cells is superior to that of indomethacin, indicating its potential to be developed into a lead compound for anti - inflammatory drugs and providing more ideas for the preparation of anti - inflammatory drugs. Brief Description of the Drawings
[0021] Figure 1 It is the hydrogen spectrum of Compound 1.
[0022] Figure 2 It is the carbon spectrum of Compound 1.
[0023] Figure 3 It is a schematic diagram of the anti-inflammatory activity test results. Detailed Implementation Modes
[0024] To make the objectives, technical solutions and advantages of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the scope of protection of the present invention.
[0025] Example 1 Isolation and Identification of Aspergillus
[0026] This strain was isolated from a soil sample collected from Huixian Wetland in Guilin, Guangxi in July 2022. After extracting the strain DNA and performing ITS sequencing analysis, the nucleotide sequence of 16S rDNA is as follows:
[0027] AGGGCCCTCACTCGGTAATCTACCTTAGGGTGACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTCGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACTCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCATAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGTCCCCGGTTTCCCCCGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAAAGCCCGGAGGGAA(SEQ ID NO:1)
[0028] Retrieval was performed by BLAST. The species with the highest similarity in the sequence alignment result is the similar genus of the strain. Combining morphological analysis, it was determined that the similar genus of the strain is the fungus Aspergillus udagawae, and the deposit name is recorded as Aspergillus udagawae W51.
[0029] Preparation of Secondary Metabolites in Example 2
[0030] (1) Under sterile conditions, the mycelia growing on the PDA plate were inoculated into a conical flask containing 200 mL of PDB liquid medium and cultured on a shaker (rotation speed 150 r / min) at 28 °C for 3 days to obtain a seed solution;
[0031] (2) Inoculate the seed solution prepared in step (1) into the sterilized rice medium (240 bottles), and statically culture for 30 days to obtain the fermented rice medium; wherein: each bottle of rice medium is made from the following raw materials in parts by weight: 100 g of rice and 80 g of purified water;
[0032] (3) Take the fermented rice medium, add methanol for extraction with a volume 1 time that of the medium, and filter and concentrate under reduced pressure to remove methanol. Repeat this process 3 times to obtain an extract. Then, extract the extract with ethyl acetate, concentrate under reduced pressure to remove ethyl acetate after extraction, and dry to obtain 193 g of an ethyl acetate fraction extract;
[0033] (4) The ethyl acetate fraction extract is separated by silica gel column chromatography (normal-phase silica gel column, 100 - 200 mesh, 400 g), and gradient elution is performed using a petroleum ether - ethyl acetate mobile phase system. The gradient is, by volume ratio, 10:0, 9:1, 4:1, 2:1, 1:1, 0:1 in sequence to obtain 4 fractions Fr.1 - Fr.4; Take Fr.3 (76.35 g), perform reverse-phase C18 column chromatography on a fast column purification system, and perform gradient elution using methanol - water. The volume concentration gradient is 30 - 100%, and the flow rate is 40 mL / min to obtain 10 sub-fractions Fr.3.1 - Fr.3.10; Take sub-fraction Fr.3.8 (869.4 mg) and separate and purify it by semi-preparative HPLC. The mobile phase uses methanol - water with a volume ratio of 55:45, and the flow rate is 3 mL / min to obtain 46.10 mg of the secondary metabolite compound 1 (retention time 40.35 min).
[0034] Compound 1: White crystal; ESI-MS: m / z 414 [M - H] - , with the molecular formula C 25 H 25 N3O3. 1H NMR (400MHz, DMSO-d6) δ: 7.82 (1H, d, J = 8.0Hz, H-18), 7.46 (1H, d, J = 7.5Hz, H-8), 7.45 (1H, t, J = 8.0Hz, H-16), 7.43 (1H, d , J=7.5Hz, H-5), 7.24 (1H, t, J=8.0Hz, H-17), 7.11 (1H, t, J=7.5Hz, H-7), 7.08 (1H, t, J=7.5Hz, H-6), 7.03 (1H, d, J=8.0Hz , H-15), 5.87 (1H, dd, J=17.3, 10.8Hz, H-23), 5.08 (1H, d, J=17.3Hz, H-24a), 5.05 (1H, d, J=10.8Hz, H-24b), 3.21 (1H, dd, J=13.7, 8.4Hz, H-10a), 2.42 (1H, dd, J=13.7, 8.4Hz, H-10b), 2.48 (3H, s, H3-28), 1.10 (3H, s, H3-26), 0.91 (3H, s, H3-25). 13 C NMR (100MHz, DMSO-d6) δ: 81.3 (C-2), 59.9 (C-3), 134.1 (C-4), 126.9 (C-5), 123.6 (C-6), 12 8.3(C-7), 117.7(C-8), 141.6(C-9), 9.4(C-10), 56.2(C-11), 169.7(C-12), 135.1(C-14), 120.9(C-15), 132.1(C-16), 124.2(C-17), 130.0(C-18), 125.1(C-19), 165.9(C-20), 41.0 (C-22), 143.6(C-23), 113.7(C-24), 23.0(C-25), 21.9(C-26), 168.7(C-27), 24.2(C-28).
[0035] The above data are basically consistent with the reference reported in the literature [Chen YG, Liu X, Zhao D, et al. Isolation and identification of chemical components of the fungus Aspergillus terra[D]. Journal of Shenyang Pharmaceutical University(沈阳药科大学), 2022, 39(10): 1189-1196.], so the compound was determined to be acetylaszonalenin, and the structural formula is shown below:
[0036]
[0037] Example 3 Anti-inflammatory Activity Test
[0038] 3.1 Test Method
[0039] 3.1.1 Detection of Cell Viability by MTT Method
[0040] RAW264.7 cells in the logarithmic growth phase were seeded in a 96-well plate at a density of 1*10 4 cells / well and cultured in an incubator at 37°C and 5% CO2 for 12 h until the cells adhered. In the experimental group, 200 μL of the test compound at different concentrations (10, 20, 40, 80, 100 μmol / L) was added, and in the blank group (without cells), an equal volume of complete medium was added. Each group had 5 replicate wells. After 24 h, 20 μL of MTT (5 mg / mL) was added to each well and incubated in the incubator (37°C, 5% CO2) for another 4 h. Then, the culture medium was removed, 150 μL of DMSO was added to each well, and the plate was shaken on a shaker at low speed for 10 min. The OD value of each well was measured at a wavelength of 490 nm using an enzyme-linked immunosorbent assay (ELISA) reader.
[0041] 3.1.2 Anti-inflammatory Activity Test
[0042] RAW264.7 cells in the logarithmic growth phase were seeded in a 24-well plate at a density of 5*10 -1 mL / well and cultured in an incubator at 37°C and 5% CO2 for 24 h. Then, in the experimental group, 500 μL of the compound at different concentrations (10, 20, 40, 80 μmol / L) was added, in the control group, 500 μL of the positive drug (indomethacin at a concentration of 40 μmol / L) was added, and in the negative group (only cells) and the model group (cells + LPS), 500 μL of complete medium was added. Each group had 3 replicates. After incubation for 4 h, 10 μL of LPS (51 μg / mL) was added to all groups except the negative group. After administration, the cells were cultured for another 24 h. Then, 50 μL of the supernatant was taken, and each reagent was added successively according to the instructions of the Griess kit. The absorbance value was measured at a wavelength of 540 nm using an ELISA reader to detect the NO content. Data processing was performed using software SPSS20.0.
[0043] 3.2 Test Results
[0044] 3.2.1 Determination of the Survival Rate of Compound 1 on RAW264.7 Cells
[0045] The MTT method was used to detect the effect of monomeric compound 1 on the viability of RAW264.7 cells. As shown in Table 1, the results indicated that compared with the positive control group, at a concentration of 40 μmol / L, the cell viability of compound 1 was above 90% (as shown in Table 1). It can be considered that the tested compound had no cytotoxic effect on RAW264.7 cells at this concentration. Therefore, indomethacin at a concentration of 40 μmol / L was selected for the anti-inflammatory activity assay.
[0046] Table 1 Cytotoxic effect of compound 1 on RAW264.7 cells ( , n = 3)
[0047]
[0048] Note: Compared with the control group, * P < 0.05; ** P < 0.01; *** P < 0.001.
[0049] 3.2.2 Anti-inflammatory activity of the compound
[0050] Combined with Figure 3 shown, in the experiment to determine the inhibitory effect of compound 1 on NO production in LPS-induced RAW264.7 cells, indomethacin was used as the positive control (IC 50 = 31.59 ± 0.44 μmol / L). At a concentration of 40 μmol / L, the NO inhibitory activity of compound 1 on RAW264.7 cells was better than that of indomethacin, and the IC 50 values were 26.47 ± 0.53 μmol / L (see Table 2).
[0051]
[0052] Note: Compared with the control group, * P < 0.05; ** P < 0.01; *** P < 0.001.
[0053] 3.3 Result analysis
[0054] In the anti-inflammatory activity experiment, the results showed that at a concentration of 40 μmol / L, the NO inhibitory activity of compound 1 on RAW264.7 cells was better than that of indomethacin, and the IC 50 value was 26.47 ± 0.53 μmol / L, and there was no obvious cytotoxicity at the tested concentrations.
Claims
1. An Aspergillus strain was deposited at the Guangdong Microbial Culture Collection Center (GDMCC) on February 5, 2025, with the deposit number GDMCC No: 65859.
2. The strain according to claim 1, characterized in that: The nucleotide sequence of the 16S rDNA of the said strain is as shown in Sequence Listing SEQ ID NO:
1.
3. The secondary metabolite obtained after fermentation and culture of the Aspergillus strain according to claim 1 or 2, characterized in that: The secondary metabolite is acetylaszonalenin, and its structural formula is as follows: 。 4. The method for preparing secondary metabolites by Aspergillus according to claim 1 or 2, characterized in that It includes the following steps: (1) Inoculate the said Aspergillus strain into a PDB liquid medium and culture it on a shaker at 26 - 30 °C for 2 - 4 days to obtain a seed solution; (2) Inoculate the seed solution prepared in step (1) into a sterilized rice medium and statically culture it for 26 - 32 days to obtain a fermented rice medium; (3) Take the fermented rice medium, add 1 - 1.2 times the volume of methanol and extract for 36 - 60 h, concentrate under reduced pressure to remove methanol, repeat 1 - 3 times to obtain an extract, then extract the extract with ethyl acetate, concentrate under reduced pressure to remove ethyl acetate after extraction, and dry to obtain an ethyl acetate fraction extract; (4) The ethyl acetate fraction extract is separated by silica gel column chromatography to obtain 4 fractions, Fr. 1 - Fr.
4. Take Fr. 3, and perform reverse-phase C18 column chromatography on a rapid column purification system to obtain 10 sub-fractions, Fr. 3.1–Fr. 3.
10. Take sub-fraction Fr.3.8 and separate and purify it by semi-preparative HPLC to obtain the secondary metabolite acetylaszonalenin.
5. The method for preparing a secondary metabolite from the Aspergillus strain according to claim 4, characterized in that: In step (4), in the silica gel column chromatography separation, a gradient elution is carried out with a petroleum ether - ethyl acetate mobile phase system. The gradient is, by volume ratio, successively 10:0, 9:1, 4:1, 2:1, 1:1, 0:
1.
6. The method for preparing a secondary metabolite from the Aspergillus strain according to claim 4, characterized in that: In step (4), in the reverse-phase C18 column chromatography, a gradient elution is carried out with methanol - water, and the volume concentration gradient is 30 - 100%.
7. The method for preparing a secondary metabolite from the Aspergillus strain according to claim 4, characterized in that: In step (4), in the semi-preparative HPLC separation and purification, the mobile phase uses methanol - water with a volume ratio of 55:
45.
8. The method for preparing a secondary metabolite from the Aspergillus strain according to claim 4, characterized in that: In step (2), the rice medium is made from the following raw materials in parts by weight: 100 parts of rice, 70 - 100 parts of water.
9. The application of the secondary metabolite according to claim 3 or the secondary metabolite prepared by the preparation method according to any one of claims 4 - 8 in the preparation of anti-inflammatory drugs.