Penicillium oxalicum as well as fungicide, preparation method and application thereof

Through Penicillium oxalate MJ1 and its compound bacteria agent, the problem of low compost efficiency of waste crops is solved, efficient resource utilization of waste crops is achieved, and the quality and fertilizer efficiency of compost products are improved.

CN120249068APending Publication Date: 2025-07-04HUNAN INST OF MICROBIOLOGY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510396767.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-31
Publication Date
2025-07-04

AI Technical Summary

Technical Problem

There are shortcomings in the resource utilization methods of waste crops in the prior art. Compost technology is inefficient in degrading organic solid waste, making it difficult to achieve harmless and resource utilization.

Method used

P. oxalate MJ1 and its compound bacterial agent, including Neurosporus intertype and/or Bacillus licheniformis, are prepared by fermentation and culture, and are used for crop composting, secreting extracellular enzymes such as cellulase, protease, etc., and decomposing complex organic substances in waste crops.

Benefits of technology

The aerobic compost process of waste crops has been accelerated, ammonia emissions have been reduced, nitrogen, phosphorus, potassium and organic matter content of compost products has been improved, and the fertilizer efficiency of compost products has been improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120249068A_ABST
    Figure CN120249068A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biology, in particular to penicillium oxalicum as well as a microbial agent, a preparation method and application thereof, the penicillium oxalicum is named as MJ1, and the preservation number is CGMCC No: 41820. The penicillium oxalicum MJ1 is obtained by screening and separating from soil at a vegetable waste stacking place, and has the advantages that the penicillium oxalicum MJ1 can be used for preparing the microbial agent; penicillium oxalicum can secrete multiple extracellular enzymes such as cellulase, protease and amylase, the enzymes can decompose complex organic matters such as cellulose, protein and lignin in waste crops into small molecular substances, emission of harmful gases such as ammonia gas is reduced, and the fertilizer efficiency of fermentation products is improved; the penicillium oxalicum MJ1 is compounded with neurospora intermedia and / or bacillus licheniformis, so that the process of aerobic composting of the waste crops can be accelerated, the quality of a compost product is improved, and the penicillium oxalicum MJ1 has certain application potential in the aspects of harmlessness and recycling of the waste crop compost.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and specifically to a Penicillium oxalicum, its microbial agent, preparation method and application. Background Art

[0002] With the steady improvement of China's grain production capacity and the continuous improvement of the industrial development level, the abandoned agricultural crops show trends such as stable scale, centralized generation, and high-value utilization. However, there are still shortfalls in the resource utilization path of abandoned agricultural crops, and there is still room for improvement in the utilization level. The importance and urgency of accelerating the construction of a circular utilization system for abandoned agricultural crops and promoting the green and low-carbon circular development of agriculture are more prominent.

[0003] At present, the main ways of resource utilization of abandoned agricultural crops include direct field return, composting, energy utilization, and feed utilization, etc. Among them, the composting technology is an important means and technology for reducing the amount, resource utilization, and harmless treatment of abandoned agricultural crops. This not only effectively solves the environmental pollution caused by abandoned agricultural crops, but also can recycle the waste resources. Screening strains that can efficiently degrade organic solid waste is one of the effective ways to realize the resource utilization of abandoned agricultural crops. Summary of the Invention

[0004] Object of the Invention: Aiming at the above technical problems, the present invention provides a Penicillium oxalicum, its microbial agent, preparation method and application.

[0005] The technical solution adopted is as follows:

[0006] A Penicillium oxalicum, named Penicillium oxalicum MJ1, with a preservation number of CGMCC No: 41820, a preservation date of February 28, 2025, and a preservation unit of the General Microbiological Center of the China Committee for Culture Collection of Microorganisms, located in Beijing, China.

[0007] Further, the Penicillium oxalicum is isolated from soil.

[0008] The present invention also provides a microbial agent containing the above Penicillium oxalicum.

[0009] Further, the microbial agent further includes Neurospora intermedia and / or Bacillus licheniformis.

[0010] Further, the microbial agent is in the form of powder, solution, suspending agent, tablet or granule.

[0011] The present invention also provides a preparation method of the microbial agent:

[0012] Inoculate Penicillium oxalicum into a PDA medium to obtain a seed solution, load a fermentation medium into a fermentation tank, and inoculate the seed solution, and then stir and culture to obtain the microbial agent.

[0013] Furthermore, the fermentation medium composition is as follows by weight parts:

[0014] 8 - 15 parts of CMC-Na, 0.5 - 1.5 parts of NH4NO3, 0.5 - 1.5 parts of K2HPO4, 0.1 - 1 part of MgSO4·7H2O, and 800 - 1200 parts of water.

[0015] Furthermore, the inoculation amount of the seed liquid is 1 - 5% of the volume of the fermentation medium.

[0016] Furthermore, when stirring and culturing, the rotation speed is 140 - 160 rpm, the air flow rate is 1.5 - 2 m 3 / h, the tank pressure is 0.01 - 0.05 MPa, and the stirring and culturing time is 120 - 240 h.

[0017] The present invention also provides the application of the above-mentioned bacterial agent in crop composting.

[0018] The technical solution of the present invention has the following beneficial effects:

[0019] Penicillium oxalicum MJ1 in the present invention is screened and isolated from the soil at the vegetable waste stacking site. Penicillium oxalicum can secrete various extracellular enzymes such as cellulase, protease, amylase, etc. These enzymes can decompose complex organic substances such as cellulose, protein, and lignin in the waste crops into small molecule substances, reduce the emission of harmful gases such as ammonia, and improve the fertilizer efficiency of the fermentation products. Moreover, by compounding Penicillium oxalicum MJ1 with Neurospora intermedia and / or Bacillus licheniformis, the present invention can accelerate the aerobic composting process of waste crops, improve the quality of the compost products, and has certain application potential in the harmlessness and resource utilization of waste crop composting. Description of the Drawings

[0020] Figure 1 It is a photograph of the colony morphological characteristics of Penicillium oxalicum MJ1;

[0021] Figure 2 It is a photograph of the mycelial morphological characteristics of Penicillium oxalicum MJ1.

[0022] Figure 3 It is the observation of the antagonistic test of Penicillium oxalicum MJ1, Neurospora intermedia, and Bacillus licheniformis. Through the test, it is determined that there is no obvious antagonistic effect among the three strains, and the strains will not inhibit each other's growth, and they can be used for the preparation of compound bacterial agents. Detailed Embodiments

[0023] For those without specific conditions noted in the examples, they are carried out according to conventional conditions or the conditions recommended by the manufacturer. For reagents or instruments without the manufacturer noted, they are all conventional products that can be obtained through commercial purchase. Technologies not mentioned in the present invention refer to the prior art. Unless otherwise specified, the following examples and comparative examples are parallel tests and adopt the same treatment steps and parameters.

[0024] I. Culture media and reagents

[0025] (1) Enrichment medium: KH2PO4 0.34 g, K2HPO4 1.20 g, MgSO4·7H2O 0.25 g, NH4NO3 0.60 g, CMC-Na 10.00 g, CaCl2·2H2O 0.07 g, MnSO4·H2O 0.025 mg.

[0026] (2) CMC-Na screening medium: CMC-Na 10 g, yeast extract 1 g, agar 20 g, distilled water 1000 mL, pH value 7.0 - 7.5.

[0027] (3) CMC-Na differential medium: CMC-Na 5.5 g, NH4NO3 0.6 g, MgSO4·7H2O 0.2 g, KH2PO4 0.34 g, yeast extract 0.5 g, NaCl 0.5 g, agar 20.0 g, distilled water 1000 mL, pH value 7.2 - 7.4.

[0028] (4) Filter paper disintegration medium: (NH4)2SO4 1.0 g, MgSO4·7H2O 0.5 g, KH2PO4 1.0 g, yeast extract 0.1 g, filter paper strips (1 cm × 6 cm) 3 strips per Erlenmeyer flask (500 mL), distilled water 1000 mL, pH value 7.0 - 7.2.

[0029] (5) Enzyme-producing medium: (NH4)2SO4 2.0 g, KH2PO4 3.0 g, CaCl2 0.5 g, MgSO4 0.5 g, CoCl2 3.0 mg, FeSO4·7H2O 7.5 mg, ZnSO4·7H2O 2.0 mg, MnSO4·H2O 2.5 mg, distilled water 1000 mL, natural pH value.

[0030] All of the above culture media are used after being sterilized at 121 °C for 20 min.

[0031] II. Enrichment culture of strains

[0032] 1. Take 100 g of soil from the vegetable waste piles in different places and place them in 1000 mL of phosphate buffer solution. Add 4 drops of Tween-80, stir well with a glass rod to remove obvious impurities in the liquid, centrifuge at 2000 r / min for 5 min, and retain the supernatant. Then centrifuge the supernatant at 8000 r / min for 10 min, and retain the bacteria at the bottom of the centrifuge tube. Wash the bacteria with sterile phosphate buffer solution and store them in a refrigerator at 4°C for later use. Measure 10 mL of the reserved bacterial liquid and place it in 250 mL of enrichment medium, and incubate it at 30°C with constant shaking at 180 r / min for 10 d.

[0033] 2. Dilute the enriched bacterial liquid with sterile water to 10 -7 times, suck 0.1 mL and spread it evenly on the screening medium plate, incubate it upside down at 30°C for 7 d, observe and record the colony growth situation. Pick colonies with different morphologies, inoculate them on the slant medium, incubate for 3 d, and then store them at 4°C at low temperature.

[0034] 3. After activating the initially screened and isolated strains, inoculate them on the differential medium by the spot inoculation method, with 2 replicates for each strain, incubate them upside down in an incubator at 30°C for 2 d, stain them with 0.1% Congo red for 15 min, and then decolorize them with 1 mol / L NaCl solution. Through the size of the transparent circle D c value (D c = hydrolysis circle diameter / colony diameter), preliminarily judge the cellulose degradation ability of the strains. The initially selected strains are labeled and stored for later experiments. The results are shown in Table 1 below:

[0035] Table 1: Congo red staining D c value

[0036] Number MJ1 MJ3 MJ8 MJ9 HN1 HN5 <![CDATA[D c value]]> 5.06±0.04 3.15±0.07 2.67±0.10 1.84±0.05 3.36±0.02 3.82±0.05

[0037] 4. Inoculate the strains on the beef extract peptone medium respectively, and prepare the bacterial suspension after culturing for 24 h. Take 1 mL of each bacterial liquid and inoculate it into a triangular flask containing 100 mL of sterile filter paper disintegration medium, culture at 28°C and 100 r / min, observe the disintegration situation of the filter paper regularly, with 3 replicates for each strain. Preliminarily judge the cellulose degradation ability of the strains according to the degree of filter paper disintegration.

[0038] "+" indicates that the edge of the filter paper has swollen, "++" indicates that the whole filter paper has swollen and bent down, "+++" indicates that the filter paper is in an irregular block shape, and "++++" indicates that the filter paper is in a paste shape.

[0039] Table 2: Filter paper degradation test

[0040]

[0041]

[0042] 5. Inoculate the enzyme-producing medium with the bacterial suspension of the strain with strong filter paper disintegration ability at an inoculation amount of 2%. After culturing at 28 °C and 180 r / min for 7 d, centrifuge at 4000 r / min for 10 min, and the supernatant is used as the crude enzyme solution. Each strain is repeated 3 times.

[0043] Definition of cellulase activity unit: Under the condition of 50 °C, 1 mL of enzyme solution hydrolyzes the corresponding substrate within 60 min, and the amount of reducing sugar produced equivalent to 1 mg of glucose is defined as 1 enzyme activity unit, expressed as U / mL.

[0044] CMC enzyme activity = Bn × volume of enzyme solution fixed before determination (mL) / [0.5 mL × time (h)], where: B represents the net glucose amount (mg) obtained from the standard curve; n represents the dilution factor of the enzyme solution; 0.5 represents the volume of diluted enzyme solution taken during determination (mL). The results are shown in Table 3 below:

[0045] Table 3: CMC enzyme activity

[0046] Number MJ1 MJ3 MJ8 MJ9 HN1 HN5 CMC enzyme activity 124±0.12 69±0.05 55±0.26 34±0.16 120±0.15 116±0.08

[0047] Combined with colony morphology, physiological and biochemical characteristics and 16S rDNA sequence analysis, the dominant strain MJ-1 of the present invention was identified as Penicillium oxalicum.

[0048] The following sequence is the 16S rDNA of Penicillium oxalicum MJ-1, as shown in SEQ ID NO: 1:

[0049] TGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATCGTACCTTGTTGCTTCGGCGGGCCCGCCTCACGGCCGCCGGGGGGCATCCGCCCCCGGGCCCGCGCCCGCCGAAGACACACAAACGAACTCTTGTCTGAAGATTGCAGTCTGAGTACTTGACTAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCAAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCTCGCCCCCCGCTTCCGGGGGGCGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTGTAGGCCCGGCCGGCGCCCGCCGGCGAACACCATCAATCTTAACCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA。

[0050] Example 1:

[0051] A preparation method of a bacterial agent:

[0052] Inoculate Penicillium oxalicum MJ1 into the sterilized PDA medium, and culture it at 28 - 35 °C and a rotation speed of 180 rpm for 96 h to obtain a seed solution. Fill 30 L of fermentation medium (10 g of CMC-Na, 1 g of NH4NO3, 1 g of K2HPO4, 0.5 g of MgSO4·7H2O, 1000 mL of water) into a 50 L fermenter. After high-temperature and high-pressure steam sterilization, wait for the temperature to drop to 28 - 30 °C, and inoculate the seed solution accounting for 3% of the medium volume. At a rotation speed of 150 rpm and an air flow rate of 1.8 m 3 / h, the tank pressure is 0.01 - 0.05 MPa, and after aeration and stirring culture for 120 h, the bacterial agent can be obtained, and the effective viable count is 1.5×10 8 CFU / mL.

[0053] Example 2:

[0054] Penicillium oxalicum MJ1 and Neurospora intermedia (BNCC144684) were respectively inoculated into the sterilized PDA medium and cultured for 96 h at 28 - 35 °C with a rotation speed of 180 rpm to obtain their respective seed liquids. 30 L of fermentation medium (10 g of CMC-Na, 1 g of NH4NO3, 1 g of K2HPO4, 0.5 g of MgSO4·7H2O, 1000 mL of water) was filled into a 50 L fermenter. After high-temperature and high-pressure steam sterilization and the temperature dropped to 28 - 30 °C, the seed liquids accounting for 3% of the medium volume were respectively inoculated. At a rotation speed of 150 rpm and an air flow rate of 1.8 m 3 / h, with a tank pressure of 0.01 - 0.05 MPa, after aeration and stirring culture for 120 h, two kinds of bacterial liquids could be obtained. The effective viable count in the Penicillium oxalicum bacterial liquid was 1.5×10 8 CFU / mL, and the effective viable count in the Neurospora intermedia bacterial liquid was 1.2×10 8 CFU / mL. The two were mixed at a volume ratio of 1:1 to obtain the microbial agent.

[0055] Example 3:

[0056] Penicillium oxalicum MJ1 and Bacillus licheniformis (ZKCC25630) were respectively inoculated into the sterilized PDA medium and cultured for 96 h at 28 - 35 °C with a rotation speed of 180 rpm to obtain their respective seed liquids. 30 L of fermentation medium (10 g of CMC-Na, 1 g of NH4NO3, 1 g of K2HPO4, 0.5 g of MgSO4·7H2O, 1000 mL of water) was filled into a 50 L fermenter. After high-temperature and high-pressure steam sterilization and the temperature dropped to 28 - 30 °C, the seed liquids accounting for 3% of the medium volume were respectively inoculated. At a rotation speed of 150 rpm and an air flow rate of 1.8 m 3 / h, with a tank pressure of 0.01 - 0.05 MPa, after aeration and stirring culture for 120 h, two kinds of bacterial liquids could be obtained. The effective viable count in the Penicillium oxalicum bacterial liquid was 1.5×10 8 CFU / mL, and the effective viable count in the Bacillus licheniformis bacterial liquid was 1.6×10 8 CFU / mL. The two were mixed at a volume ratio of 1:1 to obtain the microbial agent.

[0057] Example 4:

[0058] Penicillium oxalicum MJ1, Neurospora intermedia (BNCC144684), and Bacillus licheniformis (ZKCC25630) were respectively inoculated into the sterilized PDA medium and cultured at 28 - 35 °C with a rotation speed of 180 rpm for 96 h to obtain their respective seed solutions. 30 L of fermentation medium (10 g of CMC-Na, 1 g of NH4NO3, 1 g of K2HPO4, 0.5 g of MgSO4·7H2O, and 1000 mL of water) was filled into a 50 L fermenter. After autoclaving at high temperature and high pressure and waiting for the temperature to drop to 28 - 30 °C, the seed solutions accounting for 3% of the medium volume were respectively inoculated. At a rotation speed of 150 rpm and an air flow rate of 1.8 m 3 / h, with a tank pressure of 0.01 - 0.05 MPa, and after aeration and stirring culture for 120 h, three kinds of bacterial solutions can be obtained. Among them, the effective viable count in the Penicillium oxalicum bacterial solution is 1.5×10 8 CFU / mL, the effective viable count in the Bacillus licheniformis bacterial solution is 1.6×10 8 CFU / mL, and the effective viable count in the Neurospora intermedia bacterial solution is 1.2×10 8 CFU / mL. The three were mixed in a volume ratio of 1:1:1 to obtain the microbial agent.

[0059] Comparative Example 1:

[0060] Penicillium oxalicum (XG-J5286, Sigma) was inoculated into the sterilized PDA medium and cultured at 28 - 35 °C with a rotation speed of 180 rpm for 96 h to obtain the seed solution. 30 L of fermentation medium (10 g of CMC-Na, 1 g of NH4NO3, 1 g of K2HPO4, 0.5 g of MgSO4·7H2O, and 1000 mL of water) was filled into a 50 L fermenter. After autoclaving at high temperature and high pressure and waiting for the temperature to drop to 28 - 30 °C, the seed solution accounting for 3% of the medium volume was inoculated. At a rotation speed of 150 rpm and an air flow rate of 1.8 m 3 / h, with a tank pressure of 0.01 - 0.05 MPa, and after aeration and stirring culture for 120 h, the microbial agent can be obtained, and the effective viable count is 1.5×10 8 CFU / mL.

[0061] Composting test:

[0062] Dry chicken manure, rice husk, green vegetable waste, and rice bran with a mass ratio of 3:1:5:1 were fully mixed to obtain a material pile. The blank group did not add any exogenous microbial agent, and Test Groups 1 - 5 were respectively added with the microbial agents prepared in Examples 1 - 4 and Comparative Example 1, and the dosage of the microbial agent was 3% of the mass of the material pile.

[0063] Samples were taken 7 days after the composting fermentation. When sampling, five positions including the top, bottom, left, right, and middle were selected, and three layers including the upper, middle, and lower layers at the corresponding positions were sampled. The samples were taken by the quartering method, and a total of 300 ± 5 g of samples were collected. The collected samples were divided into two parts. One part was ground and passed through a 100-mesh nylon sieve for the detection tests of various indicators, and the other part was preserved.

[0064] The total nitrogen, total phosphorus, total potassium, and organic matter of the compost were detected by the methods in "Organic Fertilizer" NY / T 525-2021. The detection results are shown in Table 4 below:

[0065] Table 4:

[0066] Total nitrogen / % Total phosphorus / % Total potassium / % Organic matter / % Test group 1 4.12 5.10 3.58 58.2 Test group 2 4.23 5.13 3.62 60.1 Test group 3 4.41 5.16 3.66 61.2 Test group 4 4.60 5.21 3.84 63.6 Test group 5 3.79 5.08 3.40 54.3 Blank group 3.45 5.06 3.27 49.5

[0067] As can be seen from Table 4 above, the addition of the bacterial agent of the present invention effectively increased the contents of nitrogen, phosphorus, potassium, and organic matter after the composting fermentation, and the fertilizer efficiency of the fermentation product was improved.

[0068] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that: they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements on some of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A Penicillium oxalicum, characterized in that, The Penicillium oxalicum is named MJ1 and has a deposit number of CGMCC No: 41820.

2. The Penicillium oxalicum according to claim 1, wherein The Penicillium oxalicum is isolated from soil.

3. A bacterial agent, characterized in that, It contains the Penicillium oxalicum as described in claim 1.

4. The microbial agent according to claim 3, wherein It also includes Neurospora intermedia and / or Bacillus licheniformis.

5. The microbial agent according to claim 4, wherein The microbial agent is in the form of powder, solution, suspending agent, tablet or granule.

6. A preparation method of the microbial agent according to claim 5, characterized in that, The seed liquid is prepared by inoculating Penicillium oxalicum into PDA medium. The fermentation medium is filled into a fermentation tank and inoculated with the seed liquid, and then stirred and cultured to obtain the microbial agent.

7. The preparation method according to claim 6, characterized in that, By weight, the fermentation medium is composed of the following: 8 - 15 parts of CMC-Na, 0.5 - 1.5 parts of NH4NO3, 0.5 - 1.5 parts of K2HPO4, 0.1 - 1 part of MgSO4·7H2O, and 800 - 1200 parts of water.

8. The preparation method according to claim 6, characterized in that, The inoculation amount of the seed liquid is 1 - 5% of the volume of the fermentation medium.

9. The preparation method according to claim 6, characterized in that, When stirring and culturing, the rotation speed is 140 - 160 rpm, the air flow rate is 1.5 - 2 m 3 / h, the tank pressure is 0.01 - 0.05 MPa, and the stirring and culturing time is 120 - 240 h.

10. Application of the microbial agent as described in claim 3 or 4 in crop compost.