Annular transposon and application thereof
By designing the cyclic transposon structure and detection primers, the spreading problem of blaKPC gene in Pseudomonas aeruginosa was solved, efficient transmission and detection of blaKPC-2 gene was achieved, and the accuracy and depth of drug resistance detection were improved.
Patent Information
- Application Number
- CN202510393141.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-31
- Publication Date
- 2025-07-04
AI Technical Summary
Pseudomonas aeruginosa rapidly develops resistance to a variety of antibiotics, and the prior art is difficult to effectively control the spread and spread of blaKPC genes, resulting in the problem of multidrug resistance in clinical infection.
A circular transposon was designed, including sequentially linked IS26 transposable elements, Tn3 dissociable enzymes, ISKpn27 and ΔISKpn6, carrying the blaKPC-2 gene, forming the simplest circular structure to promote the horizontal transmission of drug-resistant genes and provide corresponding detection primers and host cells.
The efficient transmission and detection of blaKPC-2 gene has been achieved, the understanding of blaKPC transmission mode has been broadened, the more comprehensive genomic map has been provided, complex transposable structures have been identified, and the accuracy and depth of drug resistance detection have been enhanced.
Smart Images

Figure CN120249277A_ABST
Abstract
Description
Technical Field
[0001] The present application relates to the field of biomedical technologies, and particularly to a circular transposon and its application. Background Art
[0002] Pseudomonas aeruginosa is a Gram-negative opportunistic pathogen, and the fact that it rapidly develops resistance to a variety of antibiotics has been an established fact in the front line of clinical anti-infection. Among them, carbapenem-resistant Pseudomonas aeruginosa is a common and important multi-drug resistant Gram-negative bacillus.
[0003] bla KPC The most common mutant type is bla KPC-2 , and others include bla KPC-3 , bla KPC-33 , etc. At present, the plasmids carrying the bla KPC gene found in Pseudomonas aeruginosa are generally about 50 kb or 400 - 500 kb, or are embedded in the genome in the form of a linear arrangement of transposons. The environment of the bla KPC gene is mostly combined with transposases such as Tn1721, Tn1403 or Tn4401 to achieve the transfer of drug resistance genes, and often relies on typical transposases and with the help of IS26 to increase the copy number or change the position of drug resistance genes, enhancing the drug resistance of clinical strains. Summary of the Invention
[0004] The purpose of the present application is to overcome the deficiencies of the above-mentioned prior art and provide a circular transposon and its application.
[0005] To achieve the above purpose, the technical solution adopted in the present application is as follows:
[0006] The present application provides a circular transposon, which includes an IS26 transposable element, a Tn3 resolvase (ΔTn3 resolvase, ΔtnpR Tn3 ), an ISKpn27, a resistance gene, and a ΔISKpn6 connected in sequence.
[0007] As a preferred embodiment of the circular transposon of the present application, the resistance gene includes one of the bla KPC gene, the bla NDM gene, and the bla OXA gene. The bla KPC gene in the present application is preferably the bla KPC-2 gene.
[0008] As a preferred embodiment of the circular transposon of the present application, the structure of the circular transposon is IS26-ΔtnpR Tn3 -ISKpn27-blaKPC-2 -ΔISKpn6;
[0009] The nucleotide sequence of the circular transposon is as shown in SEQ ID NO: 1.
[0010] This application relates to a carbapenemase resistance gene bla KPC A new form of transfer and spread - The IS26 transposable element can mediate the recombination of the double-stranded DNA sequence carrying the bla KPC-2 gene into the structure of a circular transposon (4746 bp), helping the bla KPC-2 gene to achieve transfer and spread.
[0011] bla KPC is most common in Klebsiella pneumoniae, and mostly achieves its horizontal spread in the form of plasmids or composite transposons embedded in the chromosome. The bla KPC-2 gene involved in this application was isolated from Pseudomonas aeruginosa in China, and its MLST typing belongs to ST2483. This application is the first to disclose both the transfer form of the bla KPC-2 gene and the type of the strain to which it belongs.
[0012] This application also provides primers for detecting the circular transposon described above, and the primers include amplification primers or sequencing primers.
[0013] As a preferred embodiment of the primers of this application, the nucleotide sequences of the amplification primers are as shown in SEQ ID NO: 2 - 5;
[0014] The nucleotide sequences of the sequencing primers are as shown in SEQ ID NO: 6 - 11.
[0015] Using the primers for detecting the circular transposon described above can better identify the circular transposon of the resistance gene (bla KPC-2 gene).
[0016] This application also provides a circular dsDNA, and the circular dsDNA includes the circular transposon described above.
[0017] This application also provides a host cell, and the host cell includes the circular transposon as described above.
[0018] As a preferred embodiment of the host cell of this application, the host cell includes at least one of Pseudomonas aeruginosa, Staphylococcus aureus, Escherichia coli, and Klebsiella.
[0019] The host cell also includes common host cells in the art.
[0020] This application also provides the use of the above circular transposon, plasmid, and host cell in the preparation of products for detecting biological drug resistance.
[0021] The present application also provides the use of the above-mentioned circular transposon, plasmid, and host cell in the preparation of a drug resistance detection model.
[0022] Compared with the prior art, the present application has the following beneficial effects:
[0023] The present application provides a circular transposon and its application. The circular transposon carrying the bla KPC-2 gene in Pseudomonas aeruginosa has a simplest circular structure "IS26-ΔtnpR KPC-2 -ISKpn27-bla Tn3 -ΔISKpn6" compared with the structures where all other discovered bla KPC-2 genes are located. It belongs to the latest discovery of IS26-mediated circularization of drug resistance genes to promote the horizontal transmission of drug resistance genes. The present application also comprehensively elaborates the methods for detection at the gene level and protein level. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 Phylogenetic tree of plasmids carrying bla KPC in Pseudomonas aeruginosa uploaded to NCBI globally, MLST typing of the strains where the plasmids are located, regions where the strains are isolated, and plasmid sizes;
[0025] Figure 2 Typical gene environment and structural element display of bla KPC carried by the chromosome or plasmid of Pseudomonas aeruginosa;
[0026] Figure 3 Statistical graph of plasmid sizes of Pseudomonas aeruginosa carrying bla KPC gene;
[0027] Figure 4 Element display diagram of the circular transposon containing bla KPC gene in PA100;
[0028] Figure 5 Electrophoresis diagram of PCR products amplified in the method for detecting bla KPC nucleic acid;
[0029] Figure 6 Sequencing depth diagram of the corresponding region (4746bp) of circular dsDNA by whole genome sequencing;
[0030] Figure 7 Agarose gel electrophoresis diagram of PCR products of two pairs of primers amplifying circular intermediates;
[0031] Figure 8 Result diagram of sequencing using pPA100-S-F1187;
[0032] Figure 9 It is the result diagram of sequencing with pPA100 - S - R4027;
[0033] Figure 10 It is the result diagram of sequencing with W2F0220 - W196 - A03;
[0034] Figure 11 It is the result diagram of sequencing with W2R0220 - W196 - B03;
[0035] Figure 12 It is the result diagram of sequencing with W1R0218 - W194 - F04;
[0036] Figure 13 It is the result diagram of sequencing with W1F0218 - W194 - E04;
[0037] Figure 14 It is the gel electrophoresis diagram for the extraction of the circular transposon structure (C - KPC) (circular transposon (C - KPC): 4746bp; digestion with BamH I and Not I restriction endonucleases: 1872bp + 2804bp);
[0038] Figure 15 It is the result diagram for the detection of KPC copy number and mRMA expression;
[0039] Figure 16 It is the result diagram for the induction effect of carbapenem drugs (meropenem, MEM) on the expression level of KPC mRNA;
[0040] Figure 17 It is the detection diagram for the expression level of carbapenemase protein;
[0041] Figure 18 It is the schematic diagram of the genomic formation of circular dsDNA intermediate. Detailed implementation manners
[0042] To better illustrate the purpose, technical solution and advantages of this application, the following will further explain this application in combination with the accompanying drawings and specific embodiments.
[0043] In the following embodiments, unless otherwise specified, the experimental methods used are all conventional methods, and the materials, reagents, etc. used, unless otherwise specified, can all be obtained from commercial channels, and the component raw materials used in each parallel experiment are all of the same kind.
[0044] Currently, as Figures 1-3 shown, bla KPCGenes are mostly found in plasmids in Pseudomonas aeruginosa, and a small part is embedded in the genome. This application collected plasmids carrying bla KPC and its mutants in Pseudomonas aeruginosa uploaded to NCBI, a total of 63 from 2006 to the present. Among them, 10 plasmids are large plasmids, ranging from 392.2 kb to 510.7 kb. Most of the remaining plasmids are about 50 kb in size, with a median of 48.37 kb, a 25% percentile of 40.18 kb, a 75% percentile of 62.58 kb, and an average of 106.5 kb. The smallest plasmid has 7,995 base pairs (NCBI: KC799322), which was discovered in Colombia, South America in 2013, and the gene environment is "IS26-bla KPC -ΔISKpn6".
[0045] In this application, a circular transposon structure carrying the bla KPC gene was found in Pseudomonas aeruginosa isolated from clinically infected patients in Guangzhou, China (the strain PA100 was isolated from a 90-year-old male with urinary tract infection in the ICU of the Second Affiliated Hospital of Guangzhou Medical University. The CRPA with positive midstream urine culture was selected, and the strain carrying bla KPC was screened). The size is only 4,746 bp, which is the smallest circular structural unit carrying the bla KPC gene discovered so far.
[0046] The element composition of the circular transposon containing the bla KPC gene in this application is mainly "IS26-ΔtnpR Tn3 -ISKpn27-bla KPC-2 -ΔISKpn6". The circular structure is shown in Figure 4 .
[0047] Although the bla KPC gene is widely present in Klebsiella pneumoniae, it has also gradually spread in other clinical pathogens, especially Pseudomonas aeruginosa.
[0048] In this application, specific primers of the bla KPC gene were used to screen and identify carbapenem-resistant Pseudomonas aeruginosa. Among them, PA3, PA100, and PA328 carry bla KPCPseudomonas aeruginosa strains of genes. Then, whole-genome sequencing was performed on these 3 strains in this application. The complete genome sequencing of bacteria was carried out using paired-end sequencing of Illumina Novaseq (2150bp paired-end reads) and long-read sequencing of PacBio Sequel II, which was completed by Shanghai Lingen Biotechnology Co., Ltd. (Shanghai, China). PacBio reads were assembled using Unicycler (version 0.4.8). Then, Pilon (version 1.22) was used to polish the assembly with Illumina reads. The assembled genome of strain PAE100 was submitted to the NCBI GenBank database and annotated using NCBI prokaryotic annotation (PGAP). Through the whole-genome sequence, this application found that PA3 is a composite transposon mediated by Tn1721 and embedded in the chromosome; PA328 is carried by an IncU-type plasmid and transposes in the Tn6296 type. In this invention, these two strains were used as control strains for functional analysis.
[0049] It should be particularly noted that in the splicing result of strain PA100, bla KPC gene is in a small circular structure of 4746bp. Through gene annotation in this application, this application predicted that the gene bla KPC belongs to an intermediate of a circular transposon formed by IS26 mediation.
[0050] Based on the existing identification methods, this application proposed to combine multiple molecular biology techniques (such as genome assembly, long-read sequencing, genome comparative analysis) to verify the circular transposon structure where the bla KPC gene is located. By using long-read sequencing technologies such as PacBio or Oxford Nanopore, the accuracy and depth of transposon structure analysis can be further improved. This move can provide a more comprehensive genome map and identify complex transposon structures that may be missed by traditional technologies.
[0051] Among them, the mobile genetic element IS26 is located upstream or downstream of the bla KPC variant, suggesting that IS26 is related to the spread of the bla KPC variant.
[0052] This application mainly identified and isolated the circular transposon structure containing the bla KPC-2 gene, the smallest structural unit in clinical Pseudomonas aeruginosa PA100, which contains the simplest structure "IS26-ΔtnpR Tn3 -ISKpn27-bla KPC-2-ΔISKpn6". When the IS26 family transposes, it is suspected to form a circular double-stranded intermediate. This application confirms that IS26 carrying the inserted drug resistance gene forms a circular dsDNA intermediate, which has the mobility of the intermediate. This application shows the characteristics of the IS26 transposase and broadens the understanding of the bla KPC transmission mode and the function of the IS26 family.
[0053] The circular transposon is as shown in SEQ ID NO:1.
[0054] Example 1, Method for Identifying Circular Transposons
[0055] 1. Method for detecting bla KPC nucleic acid, comprising the following steps:
[0056] In this application, DNA extracted from a single colony (PA100 Pseudomonas aeruginosa) isolated from clinical patient cultures on blood agar plates was used as a template for PCR drug resistance genotype identification.
[0057] bla KPC Specific amplification primers (target fragment size: approximately 800 bp)
[0058] KPC-F: TGTCACTGTATCGCCGTC;
[0059] KPC-R: CTCAGTGCTCTACAGAAAACC;
[0060] The system of colony PCR is shown in Table 1.
[0061] Table 1
[0062]
[0063]
[0064] Take the PCR product for electrophoresis, and the result is as Figure 5 shown. This figure shows that the PA100 strain carries the drug resistance gene bla KPC .
[0065] 2. Verify the circular transposon
[0066] Using the trace bacteria picked from the blood agar plate in step 1 above as a template, and without adding a template as a control, PCR amplification was performed using two pairs of amplification primers (annealing at 57 °C and extending for 2 min). The amplification system is as shown in Table 2 below:
[0067] Primer1:
[0068] pPA100KPC-F: AAGTGCCACCTGACGTCTAA (SEQ ID NO:2);
[0069] pPA100KPC-R: TGGCACGGCAAATGACTATG (SEQ ID NO:3);
[0070] Primer2:
[0071] pKPC-R-F: GGTTTTCTGTAGAGCACTGAG (SEQ ID NO:4);
[0072] pKPC-F-R: GACGGCGATACAGTGACA (SEQ ID NO:5).
[0073] Table 2
[0074] Component Dosage Bacterial DNA 1 μL 2×Premix Taq 25 μL Forward Primer 2 μL Reverse Primer 2 μL <![CDATA[ddH2O]]> 20 μL Total System 50 μL
[0075] During the transposition process, the transposase in IS26 first cleaves both ends of IS26, releasing the IS26 transposable element. During this process, after the formation of a circular dsDNA intermediate, IS26 will use its transposase to recognize and bind to a specific position on the target DNA again. The transposase will insert IS26 by cleaving the target DNA again, thus achieving the final effect of transposition. The cleavage and repair of the target DNA usually result in local rearrangement of the target DNA sequence. Once the IS26 transposable element is successfully inserted into the target DNA, the incision of the target DNA is usually repaired through the cell's DNA repair mechanism. In some cases, short insertion sequences or repeated sequences of gene sequences will be left during the repair process, which provides new targets for subsequent transposition.
[0076] Figure 6 It is the sequencing depth map of the corresponding region (4746bp) of the circular dsDNA for whole-genome sequencing, indicating that it is a high-copy region corresponding to an independent circular dsDNA intermediate.
[0077] Take 10 μl of the PCR product for electrophoresis, and the result is as Figure 7 shown, Figure 7 It is the agarose gel electrophoresis map of the PCR product amplified by the above two pairs of primers for the circular intermediate.
[0078] Furthermore, the following sequencing primers are used to sequence the PCR product:
[0079] pPA100-S-F1187: GCGTCGAGTTCCTGATTTCC (SEQ ID NO:6);
[0080] The sequencing result is as Figure 8 shown.
[0081] pPA100 - S - R4027: TGGCACGGCAAATGACTATG (SEQ ID NO:7);
[0082] The sequencing results are as Figure 9 shown.
[0083] W2F0220 - W196 - A03: TCAGTTACCGTGAGCTGCAG (SEQ ID NO:8);
[0084] The sequencing results are as Figure 10 shown.
[0085] W2R0220 - W196 - B03: GTTGCCAGTGAAGAGTCGGA (SEQ ID NO:9);
[0086] The sequencing results are as Figure 11 shown.
[0087] W1R0218 - W194 - F04: ATCTTGACGGGACAGGCTTG (SEQ ID NO:10);
[0088] The sequencing results are as Figure 12 shown.
[0089] W1F0218 - W194 - E04: GCTGTGTACCCGTTGTAGCT (SEQ ID NO:11);
[0090] The sequencing results are as Figure 13 shown.
[0091] The circular dsDNA intermediate carried by this strain was extracted, subjected to gel electrophoresis, and further digested with enzymes for identification to obtain the circular transposon structure (C - KPC). The gel electrophoresis results are as Figure 14 shown.
[0092] The specific steps are as follows:
[0093] 1. Prepare the DNA sample: Extract the dsDNA intermediate using a plasmid extraction kit and obtain pure DNA by column purification.
[0094] 2. Select restriction endonucleases: Select restriction endonucleases BamH I and Not I to cut at specific sequence positions of the intermediate.
[0095] 3. Configure the enzyme digestion reaction system: Add 1 μg of DNA, 2 μL of enzyme digestion buffer (10×), 1 μL of restriction endonuclease, and supplement water to 20 μL.
[0096] 4. Reaction conditions: Carry out the enzyme digestion reaction in a constant temperature water bath at 37 °C for 1 - 2 h
[0097] 5. Stop the reaction: Stop the reaction by incubating at 70 °C for 10 min.
[0098] 6. Analyze the digested products: Analyze the digested products by agarose gel electrophoresis to confirm the DNA cleavage. According to the electrophoresis pattern (BamH I and Not I: 1872 bp + 2804 bp), verify the successful digestion. The gel electrophoresis results of the circular transposon structure (C-KPC) are as Figure 14 shown.
[0099] Example 2, Function Detection of Circular Transposon Structure (C-KPC)
[0100] 1. Transformation experiment:
[0101] (1) Mix 5 μL of the extracted circular transposon structure C-KPC (100 ng / μL) with 100 μL of Escherichia coli DH5α competent cells, transform by heat shock at 42 °C for 60 s, add broth and resuscitate at 37 °C at 120 rpm / min for 60 min, and screen with 0.5 μg / ml, 2 μg / ml, and 8 μg / ml meropenem (Mreoprnem, MEM) respectively. No transformants were screened out.
[0102] (2) Mix 100 μL each of DH5α and Pseudomonas aeruginosa PAO1 with 10 ng of C-KPC, add to a 2 mm electroporation cuvette, perform electroporation at 2.5 kV for 6 ms, add broth and resuscitate at 37 °C at 120 rpm / min for 60 min, and screen with 0.5 μg / mL, 2 μg / mL, and 8 μg / mL MEM respectively. No transformants were screened out either.
[0103] The above indicates that C-KPC cannot be independently expressed and cannot confer carbapenem resistance when separated from the original host strain.
[0104] 2. Conjugation experiment:
[0105] Mix PA100 and EC600 in a 1:1 ratio at the logarithmic growth phase and culture in a 37 °C constant temperature incubator for 12 h. Screen with 200 μg / ml rifampicin (Rifampicin, RIF) and 0.5 μg / mL, 2 μg / mL, and 8 μg / mL MEM respectively. This experiment was repeated 3 times, and no conjugants were screened out. It shows that the KPC gene cannot be transferred between bacteria by conjugation.
[0106] Example 3, Detection of KPC Copy Number and mRNA Expression
[0107] Using 16sRNA as an internal reference, the qPCR technique was used to detect the PA100 strain (the strain PA3 carrying bla KPC on the chromosome and the strain carrying bla KPCThe strain PA328 was used as a control), bla in KPC The relative levels of DNA and mRNA of the circular intermediate of the gene. It was found in this application that both the copy number of the circular intermediate and the mRNA expression level were significantly increased, as Figures 15-16 shown.
[0108] In summary, first, the method of Example 1 was used to determine that the strain PA100 carried bla KPC , and it was sent to a sequencing company for whole-genome sequencing and splicing to obtain the complete genomic sequence of the strain.
[0109] Then, the sequence of the circular dsDNA was amplified by two pairs of inverse PCR primers of bla KPC , and the result of the first-generation sequencing was verified.
[0110] Finally, the circular dsDNA intermediate carried by the strain was extracted and identified by enzymatic digestion, and it was proved that the mRNA expression level of KPC in the strain carrying this intermediate was significantly increased under antibiotic pressure.
[0111] Example 4, Detection of Carbapenemase Protein Expression
[0112] In this example, the commercially available product carbapenemase detection kit (colloidal gold immunochromatography method) produced by Danna Company can detect the expression of carbapenemases such as KPC, NDM, VIM, IMP, and OXA-48-like. In this example, this kit was used to detect the expression of KPC in the strains (PA100, PA328, Pseudomonas aeruginosa strain carrying the bla KPC gene), and the result was positive, as Figure 17 shown; therefore, both this intermediate and the strain had the expression of KPC protein level.
[0113] The detection method includes the following steps:
[0114] 1. Sample collection:
[0115] (1) Add 300 μL of lysis buffer to an EP tube.
[0116] (2) Use an inoculation loop to pick up a loop of bacterial sample and place it in an EP tube containing 300 μL of lysis buffer. Shake the inoculation loop to elute the bacterial sample with the lysis buffer.
[0117] (3) Fasten the EP tube and use a vortex oscillator to mix and shake for about 10 s to make the bacterial sample as evenly dispersed as possible in the lysis solution (if the sample is viscous, the shaking time needs to be extended), and place it at room temperature for 10 min.
[0118] 2. Sample detection:
[0119] (1) Take out the kit and let it stand at room temperature for at least 10 min. Open the aluminum foil bag, take out the test card and place it on a flat and clean workbench.
[0120] (2) Use a disposable pipette to suck up the prepared bacterial lysate and slowly drip about 200 μL into the sample addition hole of the test card.
[0121] (3) After adding the sample, let the test card stand at room temperature for 15 min, observe the displayed result. The result displayed after 30 min is unreliable.
[0122] Moreover, the drug sensitivity results of the PA100 strain are shown in Table 3.
[0123] Table 3
[0124]
[0125]
[0126] Example 5, MLST Typing of Strain PA100 Containing Circular Transposon
[0127] This example provides the MLST typing of the strain PA100 where the circular transposon is located.
[0128] Using the MLST 2.0 software, upload the PA100 genome sequence, and use multilocus sequence typing (MLST) to align the 7 housekeeping genes acsA, aroE, guaA, mutL, nuoD, ppsA, and trpE of this Pseudomonas aeruginosa, and then perform sequence typing on the strain.
[0129] The results are shown in Table 4. The absorption of drug resistance genes by the strain is affected by the bacterial genome. This example analyzes the MLST typing of the strain where the bla KPC-2 gene is located.
[0130] Table 4
[0131]
[0132]
[0133] This application also designs the following specific primers to perform PCR amplification on the gene environment at both ends of KPC on the chromosome respectively, and verifies the sequence by Sanger first-generation sequencing. This application predicts that the circular intermediate structure originates from 2 bla KPC drug resistance regions of the genome, and recombines under the mediation of IS26 to form a circular dsDNA intermediate to complete the subsequent transfer and spread of drug resistance genes.
[0134] Chromosomal bla KPCGene environment 5'-end amplification primer:
[0135] pncB-F: GCATTTCACCTGCGACCTG (SEQ ID NO:12);
[0136] pncB-R: GGTATCCATCGCGTACACA (SEQ ID NO:13);
[0137] 3'-end sequencing primer:
[0138] pncB-F: GCATTTCACCTGCGACCTG (SEQ ID NO:12);
[0139] W1F0118-W171-A12: TCAGTTACCGTGAGCTGCAG (SEQ ID NO:14);
[0140] W1R0114-W163-D02: ATTCCAGTTCGGCAGCTGAA (SEQ ID NO:15);
[0141] pncB-R: GGTATCCATCGCGTACACA (SEQ ID NO:13);
[0142] Chromosome bla KPC Gene environment 3'-end amplification primer:
[0143] InaA-F: CAAAAATGCGCTGGTTCCGTG (SEQ ID NO:16);
[0144] InaA-R: CTACCATTGCCCGGATGAATC (SEQ ID NO:17);
[0145] 3'-end sequencing primer:
[0146] InaA-F: CAAAAATGCGCTGGTTCCGTG (SEQ ID NO:18);
[0147] W1R0118-W171-D11: CGGGATCTGCCACTTCTTCA (SEQ ID NO:19);
[0148] W1F0119-W172-H12: TGTAGAGCACTGACGATGGC (SEQ ID NO:20);
[0149] W2F0121-W175-C06: TTCAACAGATCGGGAAGGGC (SEQ ID NO:21);
[0150] InaA-R: CTACCATTGCCCGGATGAATC (SEQ ID NO:22).
[0151] As Figure 18 , from the whole genome sequencing and assembly results, it was found that there were two insertions of bla KPC genes in the chromosome genome of strain PA100: The first insertion was between pncB2 and InaA at nucleotide positions 5523051 - 5540382 of the genome sequence, where 3 "IS26-ΔtnpR Tn3 -ISKpn27-bla KPC-2 -ΔISKpn6-IS26" repeated drug resistance region sequences were inserted. This repeated structure was 100% similar to the sequence of the circular intermediate. The second insertion was also a drug resistance region with the same structure as the circular dsDNA intermediate at nucleotide positions 6215392 - 6223231 of the genome sequence.
[0152] The circular transposon carrying the bla KPC-2 gene in the Pseudomonas aeruginosa described in this application has the simplest circular structure "IS26-ΔtnpR KPC-2 -ISKpn27-bla Tn3 -ΔISKpn6" compared to all other structures where the bla KPC-2 gene is located. It is the latest discovery of IS26-mediated circularization of drug resistance genes to promote the horizontal transmission of drug resistance genes. This application also comprehensively describes the methods for detecting at the gene level and protein level.
[0153] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of this application and not to limit the protection scope of this application. Although this application has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of this application can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of this application.
Claims
1. A circular transposon, characterized in that, The circular transposon includes an IS26 transposable element, ΔtnpR, connected in sequence Tn3 , ISKpn27, a resistance gene, and ΔISKpn6.
2. The circular transposon according to claim 1, wherein The resistance genes include bla KPC gene, bla NDM gene, and bla OXA gene, and is one of them.
3. The circular transposon according to claim 2, wherein The structure of the circular transposon is IS26-ΔtnpR Tn3 -ISKpn27-bla KPC-2 -ΔISKpn6; The nucleotide sequence of the circular transposon is shown in SEQ ID NO:
1.
4. Primers for detecting the circular transposon according to any one of claims 1 to 3, characterized in that, The primers include amplification primers or sequencing primers.
5. The primer according to claim 4, wherein The nucleotide sequences of the amplification primers are shown in SEQ ID NOs: 2 to 5; The nucleotide sequences of the sequencing primers are shown in SEQ ID NOs: 6 to 11.
6. A circular dsDNA, characterized in that, The circular dsDNA includes the circular transposon according to any one of claims 1 to 3.
7. A host cell, characterized in that, The host cell includes the circular transposon according to claim 1.
8. The host cell according to claim 7, characterized in that, The host cell includes at least one of Pseudomonas aeruginosa, Staphylococcus aureus, Acinetobacter, Enterobacter, and Klebsiella.
9. Use of the circular transposon according to any one of claims 1 to 3, the circular dsDNA according to claim 6, and the host cell according to claim 7 or 8 in the preparation of a product for detecting biological drug resistance.
10. Use of the circular transposon according to any one of claims 1 to 3, the circular dsDNA according to claim 6, and the host cell according to claim 7 or 8 in the preparation of a model for constructing drug resistance detection.