Method for regulating and controlling rice root length through OsBZR4 gene and application

By expressing the OsBZR4 gene in rice, using the OsBZR4 gene high expression vector and Agrobacterium-mediated genetic transformation method, the insufficient regulation of rice root system development was solved, and the significant improvement of rice root length was achieved, and breeding tools for long-root rice varieties were provided.

CN120249306APending Publication Date: 2025-07-04WUHAN INST OF BIOENG +2
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510378851.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-28
Publication Date
2025-07-04

AI Technical Summary

Technical Problem

In the prior art, the function and application potential of the OsBZR4 gene in rice root development has not been fully studied, and it is difficult to effectively regulate rice root growth.

Method used

By expressing the OsBZR4 gene in rice, using the OsBZR4 gene high expression vector and Agrobacterium-mediated genetic transformation method, the activity of the OsBZR4 protein was improved, and the recombinant expression vector OsBZR4-OE was constructed to obtain highly expressed transgenic plants, achieving a significant improvement in rice root length.

Benefits of technology

It significantly improves the root length of rice, provides breeding methods for long-root rice varieties, and has huge application potential.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120249306A_ABST
    Figure CN120249306A_ABST
Patent Text Reader

Abstract

The invention discloses a method for regulating and controlling the rice root length through an OsBZR4 gene and application, and belongs to the technical field of crop gene engineering. The nucleotide sequence of the OsBZR4 gene and the amino acid sequence of the encoded protein of the OsBZR4 gene are shown as SEQ ID NO.3 and SEQ ID NO.4 respectively. By cloning the OsBZR4 gene, constructing an overexpression vector, cultivating transgenic rice and verifying the function of the transgenic rice, the invention reveals the key effect of the OsBZR4 in the development of the rice root system for the first time. Therefore, the OsBZR4 gene provides a powerful means and tool for molecular marker-assisted breeding and cultivation of varieties with excellent root systems by using a genetic engineering method, and has huge application potential.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of crop genetic engineering, and specifically relates to a method for regulating rice root length by the OsBZR4 gene and its application. Background Art

[0002] Rice (Oryza sativa) is one of the most important food crops globally, and its root development directly affects the plant's ability to absorb water and nutrients, thereby determining yield and stress resistance. In recent years, studies have shown that transcription factors play a key regulatory role in plant growth and development. OsBZR4 is an important transcription factor in rice, involved in regulating various biological processes, but its specific function and application potential in rice root development have not been fully studied. Therefore, developing a method to improve rice root development by regulating OsBZR4 expression has important theoretical and practical significance. Summary of the Invention

[0003] The present invention takes the BR signaling gene OsBZR4, a member of the BES1 gene family in rice, as the research object, and clones the cDNA sequence of OsBZR4 from rice Yue Tai B (YB). Increasing the expression of this transcript can significantly increase rice root length. This provides new genetic and genetic engineering means for regulating rice root length and can be widely applied to the breeding and utilization of long-rooted rice varieties.

[0004] The purpose of the present invention is to provide a method for regulating rice root length, and further provide the application of the OsBZR4 gene in breeding.

[0005] To achieve the above purpose, the present invention provides the following technical solutions:

[0006] In the first aspect of the present invention, a method for regulating rice root length is provided, and the method includes:

[0007] Highly expressing the OsBZR4 gene in rice or increasing the activity of the OsBZR4 protein in rice; wherein, the nucleotide sequence of the OsBZR4 gene is as shown in SEQ ID NO.3. The regulation of rice root length is to increase the length of rice roots, and further, to increase the length of the main roots of rice.

[0008] Further, the highly expressing the OsBZR4 gene in rice includes:

[0009] Constructing a high-expression vector of the OsBZR4 gene; transforming the high-expression vector of the OsBZR4 gene into rice tissues or cells.

[0010] Further, the basic vector of the OsBZR4 gene overexpression vector includes a crop transformation vector, and the crop transformation vector includes any one of a binary Agrobacterium vector and a vector applicable to crop microprojectile bombardment. The binary Agrobacterium vector includes, but is not limited to, pCAMBIA1301.

[0011] Further, the transformation method includes microinjection, Agrobacterium-mediated genetic transformation, and genetic transformation mediated by any one of a Ti plasmid, an Ri plasmid, or a viral vector.

[0012] Further, the overexpression of the OsBZR4 gene in rice specifically includes:

[0013] obtaining a gene fragment with a nucleotide sequence as shown in SEQ ID NO.3;

[0014] inserting the gene fragment into the expression vector pCAMBIA1301-35SN containing a strong promoter, screening positive clones using the marker gene on the expression vector, and obtaining the recombinant expression vector OsBZR4-OE;

[0015] transferring the recombinant expression vector OsBZR4-OE into Agrobacterium EHA105, and screening to obtain a positive Agrobacterium strain that can be used to infect rice tissues by using the expression vector and the characteristics of the Agrobacterium itself;

[0016] infecting rice callus with the positive Agrobacterium strain, and performing dark culture on a screening medium containing hygromycin to obtain positive transgenic callus;

[0017] performing differentiation, rooting, and transplanting culture on the positive callus to obtain T0 generation transgenic plants;

[0018] obtaining T1 generation plants with increased rice root length through conventional molecular marker detection and rice cultivation methods.

[0019] In the second aspect of the present invention, a root length regulatory gene OsBZR4 is provided, and the nucleotide sequence of the root length regulatory gene OsBZR4 is as shown in SEQ ID NO.3.

[0020] In the third aspect of the present invention, an OsBZR4 protein is provided, and the amino acid sequence of the OsBZR4 protein is as shown in SEQ ID NO.4.

[0021] In the fourth aspect of the present invention, a recombinant vector containing the root length regulatory gene OsBZR4 is provided.

[0022] Further, the recombinant vector includes the above-mentioned recombinant expression vector OsBZR4-OE.

[0023] In the fifth aspect of the present invention, a biological material containing the gene or recombinant vector is provided, and the biological material includes cells, transformants, and transgenic lines.

[0024] In the sixth aspect of the present invention, applications of the root length regulatory gene OsBZR4, the OsBZR4 protein, and the biological material in the cultivation of rice root length are provided.

[0025] The present invention has at least the following technical effects or advantages:

[0026] The present invention provides a method for regulating rice root length. By overexpressing OsBZR4, the main root length of rice is increased, indicating that this gene can be used as a marker for regulating rice root length in the breeding of long-rooted rice crops. Therefore, the OsBZR4 gene provides a powerful means and tool for cultivating new long-rooted rice varieties by using molecular marker-assisted breeding and genetic engineering methods, and has great application potential. Description of the Drawings

[0027] Figure 1 It is the model structure of the OsBZR4 gene in high-expression rice materials.

[0028] Figure 2 It is the root length detection result of OsBZR4 gene overexpression plants; where a is the root length phenotype of OsBZR4 overexpression materials under different concentrations of 24-epibrassinolide treatment, b is the detection of the expression level of OsBZR4 overexpression materials, and c is the root length data of OsBZR4 overexpression materials under different concentrations of 24-epibrassinolide treatment. Detailed Embodiments

[0029] The following will specifically describe the present invention in combination with specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly presented therefrom. Those skilled in the art should understand that these specific embodiments and examples are used to illustrate the present invention, rather than to limit the present invention.

[0030] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as having the meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as the general understanding of those skilled in the art to which the present invention pertains. In case of conflict, this specification shall prevail.

[0031] Unless otherwise specifically stated, various raw materials, reagents, instruments, and equipment used in the present invention can be obtained through market purchases or can be obtained by existing methods.

[0032] The rice in the following embodiments was cultivated according to normal management methods: First, fresh rice seeds need to be soaked and germinated. After the seeds show white tips, they are sown in the prepared seedling fields, and the seedlings are transplanted to the large fields at the four-leaf and one-heart stage.

[0033] The technical solution of the present invention for solving the above technical problems has the following general idea:

[0034] In the previous research on the root length mechanism of rice in this laboratory, the BR signaling gene OsBZR4 was identified. Research has shown that this gene is involved in the regulation of rice root length.

[0035] By differentially expressing the OsBZR4 gene in rice, the present invention found that: when OsBZR4 is highly expressed in rice, the root length of rice is significantly longer than that of Yuetai B (YB), indicating that OsBZR4 is closely related to rice root length.

[0036] Therefore, according to a typical embodiment of the present invention, there is provided an OsBZR4 gene involved in the regulation of rice root length, and the OsBZR4 gene has a nucleotide sequence as shown in SEQ ID NO.3.

[0037] The OsBZR4 gene has the following characteristics:

[0038] (1) Its nucleotide sequence is the genomic base sequence shown in SEQ ID NO.1;

[0039] (2) Its nucleotide sequence is the transcribed sequence shown in SEQ ID NO.2;

[0040] (3) Its nucleotide sequence is the cDNA sequence shown in SEQ ID NO.3.

[0041] The nucleotide sequence shown in SEQ ID NO.1 consists of 3491 bases, including exons, introns, and 3'UTR.

[0042] The nucleotide sequence shown in SEQ ID NO.2 is the transcribed sequence.

[0043] The nucleotide sequence shown in SEQ ID NO.3 is the cDNA coding sequence.

[0044] According to another typical embodiment of the present invention, there is provided an OsBZR4 protein, a protein involved in the regulation of rice root length. In order to facilitate the research and utilization of the OsBZR4 protein, a tag shown in Table 1 can be connected to the amino terminus or carboxyl terminus of the protein sequence. The amino acid sequence of the OsBZR4 protein is as shown in SEQ ID NO.4.

[0045] Table 1 - Tags and Their Amino Acid Sequences

[0046]

[0047]

[0048] OsBZR4 is a gene that can regulate rice root length and is of great significance in the cultivation of rice varieties with long root systems.

[0049] According to another typical embodiment of the present invention, a method for regulating rice root length is provided. The method includes the following steps: highly expressing the OsBZR4 gene in rice, wherein the nucleotide sequence of the OsBZR4 gene is as shown in SEQ ID NO.3.

[0050] In the above technical solution, the highly expressing the OsBZR4 gene in rice includes:

[0051] Constructing a high-expression vector of the OsBZR4 gene;

[0052] Transforming the high-expression vector of the OsBZR4 gene into rice tissues or cells.

[0053] The basic vector of the high-expression vector of the OsBZR4 gene includes a crop transformation vector, and the crop transformation vector includes one of a binary Agrobacterium vector and a vector for crop microprojectile bombardment. The binary Agrobacterium vector includes pCAMBIA1301; the transformation methods include microinjection, Agrobacterium-mediated genetic transformation, and genetic transformation mediated by any one of Ti plasmids, Ri plasmids, or viral vectors.

[0054] In order to achieve the purpose of improving rice roots using the OsBZR4 gene, any promoter that helps enhance the expression of the OsBZR4 gene, such as the cauliflower mosaic virus (CAMV) 35S promoter, the ubiquitin (Ubiquitin) gene promoter (pUbi), etc., can be added before the gene start site when constructing the vector. In addition, the purpose of differential expression can be achieved by adding enhancers. No matter which method is adopted, the correctness of the coding sequence must be ensured to obtain the correct OsBZR4 protein structure.

[0055] Vectors containing marker genes such as GUS gene, GFP gene, hygromycin resistance gene, herbicide resistance gene, etc. can be used to construct recombinant vectors, which is more conducive to experimental operations and subsequent crop screening and selection.

[0056] As a specific embodiment, the highly expressing the OsBZR4 gene in rice specifically includes:

[0057] Obtaining a gene fragment with the nucleotide sequence as shown in SEQ ID NO.3; specifically, the gene fragment with the nucleotide sequence as shown in SEQ ID NO.3 can be directly synthesized or obtained by PCR.

[0058] Insert the gene fragment into the expression vector pCAMBIA1301-35SN containing a strong promoter, and screen for positive clones using the marker gene on the expression vector to obtain the recombinant expression vector OsBZR4-OE;

[0059] Transfer the recombinant expression vector OsBZR4-OE into Agrobacterium tumefaciens EHA105, and screen for positive Agrobacterium strains that can be used to infect rice tissues using the expression vector and the characteristics of the Agrobacterium itself;

[0060] Infect rice callus with the positive Agrobacterium strain, and perform dark culture on a selection medium containing hygromycin to obtain positive transgenic callus;

[0061] Differentiate, root, and transplant the positive callus to obtain T0 generation transgenic plants;

[0062] Obtain T1 generation plants with increased rice root length through conventional molecular marker detection and rice cultivation methods.

[0063] The root length regulatory gene OsBZR4, and biological materials containing the OsBZR4 gene (recombinant vectors, cells, transformants, transgenic lines) can all be applied in the cultivation of rice varieties with long roots.

[0064] The following will combine examples and experimental data to elaborate in detail on a method for regulating rice root length according to the present invention.

[0065] Example 1

[0066] 1. Obtaining the OsBZR4 gene fragment

[0067] Using rice Yue Tai B (YB) cDNA as a template, design primer pair OsBZR4-F / R and add corresponding recombination sequences to their 5' ends (primer sequences are shown in Table 2), perform PCR amplification, and conduct sequencing analysis on the product. The nucleotide sequence of the amplified gene fragment is as shown in SEQ ID NO.3. In other embodiments, a gene fragment with a nucleotide sequence as shown in SEQ ID NO.3 can be directly synthesized.

[0068] Table 2 - Primer sequences

[0069]

[0070] 2. Construction of the OsBZR4 gene overexpression vector

[0071] The gene fragment obtained by PCR amplification using the primer pair OsBZR4-F / R was inserted into the expression vector pCAMBIA1301-35SN containing a strong promoter (which can be purchased from Miaoling Plasmid Platform, product number P0380) through a recombination reaction. Positive clones were screened using the marker gene on the vector to obtain the recombinant expression vector OsBZR4-OE.

[0072] 3. Obtaining transgenic plants with high expression of the OsBZR4 gene

[0073] The constructed OsBZR4-OE vector can be transferred into Agrobacterium tumefaciens EHA105 by electroporation or heat shock methods, and positive Agrobacterium strains that can be used to infect rice tissues were screened using the characteristics of the vector and Agrobacterium itself.

[0074] The recombinant Agrobacterium strain containing the recombinant plasmid OsBZR4-OE was used to infect the callus of rice Yuetai B (YB). It was cultured in the dark on a screening medium containing 50 mg / L hygromycin to obtain positive transgenic callus. The positive callus was differentiated, rooted, and transplanted to obtain T0 generation transgenic plants. T1 generation plants were obtained through conventional molecular marker detection and rice cultivation methods. The model structure of the OsBZR4 gene in the high-expression rice material is as Figure 1 shown.

[0075] 4. Root length detection of plants with high expression of the OsBZR4 gene

[0076] (1) Detection of the expression level of the OsBZR4 gene by qRT-PCR:

[0077] As a strong plant promoter, the 35S promoter can increase the expression level of the target gene in plants. Total RNA of OsBZR4 high-expression plants and wild-type plants was obtained using conventional RNA extraction methods, and the corresponding cDNA was obtained using a reverse transcription kit (purchased from Invitrogen). The expression level of OsBZR4 was detected by qRT-PCR using the primer pair OsBZR4-RT-F / R; the PCR product amplified by the primer pair Actin-RT-F / R was used as an internal reference; the above primer sequences are shown in Table 3.

[0078] Table 3 - Primer sequences

[0079] Primer Name Primer Sequence (5’-3’) OsBZR4-RT-F GAAACTACACGCTCCCGAAG OsBZR4-RT-R TGCATCCTTTTGTCTCCATA Actin-RT-F GGAAGTACAGTGTCTGGATTGGAG Actin-RT-R TCTTGGCTTAGCATTCTTGGGT

[0080] (2) Root length detection of plants with high expression of the OsBZR4 gene:

[0081] After the seeds of OsBZR4 high-expression materials and wild-type Yuetai B (YB) were disinfected by conventional methods, they were spread on MS medium containing different concentrations of 24-epibrassinolide (0.01μM, 0.1μM, 1μM, 10μM). The treated seeds were placed in a dark box and cultured at 25±1℃ for 8 days, and then the root length of each germinated seed was measured using a vernier caliper. Figure 2 As shown in a, the root length of the OsBZR4 high-expression materials on MS medium was significantly longer than that of the control Yuetai B (YB). Figure 2 c The experimental results showed that low concentrations of 24-epibrassinolide can promote the growth of seed root length, while high concentrations significantly inhibit root length growth. It is worth noting that the root length of seeds with high expression of OsBZR4 was significantly longer than that of the control Yuetai B under all concentration treatments, indicating that OsBZR4 regulates the growth and development of rice root length by responding to the 24-epibrassinolide signaling pathway.

[0082] Finally, it should be noted that the terms "comprises," "includes," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements that are inherent to such process, method, article, or apparatus.

[0083] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0084] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A method for regulating rice root length, characterized in that, The method includes: highly expressing the OsBZR4 gene in rice or enhancing the activity of the OsBZR4 protein in rice; wherein, the nucleotide sequence of the OsBZR4 gene is as shown in SEQ ID NO.3; the regulation of rice root length is to increase the length of rice roots.

2. The method for regulating rice root length according to claim 1, characterized in that The highly expressing the OsBZR4 gene in rice includes: constructing a high-expression vector of the OsBZR4 gene and transforming it into rice tissues or cells.

3. The method for regulating rice root length according to claim 2, characterized in that, The basic vector of the high-expression vector of the OsBZR4 gene includes a crop transformation vector, and the crop transformation vector includes one of a binary Agrobacterium vector and a vector for crop microprojectile bombardment; the transformation methods include microinjection, Agrobacterium-mediated genetic transformation, and genetic transformation mediated by any one of a Ti plasmid, an Ri plasmid, or a viral vector.

4. The method for regulating rice root length according to claim 1, characterized in that, The highly expressing the OsBZR4 gene in rice includes: obtaining a gene fragment with the nucleotide sequence as shown in SEQ ID NO.

3. Inserting the gene fragment into the expression vector pCAMBIA1301-35SN containing a strong promoter, screening positive clones using the marker gene on the expression vector, and obtaining the recombinant expression vector OsBZR4-OE. Transferring the recombinant expression vector OsBZR4-OE into Agrobacterium EHA105, and screening to obtain a positive Agrobacterium strain that can be used to infect rice tissues using the characteristics of the expression vector and the Agrobacterium itself. Infecting rice callus with the positive Agrobacterium strain and performing dark culture on a screening medium containing hygromycin to obtain positive transgenic callus. Performing differentiation, rooting, and transplanting culture on the positive callus to obtain T0 generation transgenic plants. Obtaining T1 generation plants with increased rice root length through conventional molecular marker detection and rice cultivation methods.

5. A root length regulatory gene OsBZR4, characterized in that, The nucleotide sequence of the gene OsBZR4 is as shown in SEQ ID NO.

3.

6. An OsBZR4 protein, characterized in that, The amino acid sequence of the OsBZR4 protein is as shown in SEQ ID NO.

4.

7. A recombinant vector containing the root length regulation gene OsBZR4 as claimed in claim 5.

8. A biological material comprising the gene according to claim 5 or the recombinant vector according to claim 7, characterized in that, The biological materials include cells, transformants, and transgenic lines.

9. Use of the gene as claimed in claim 5 or the protein as claimed in claim 6 in the cultivation of rice varieties with long root systems.

10. Use of the recombinant vector as claimed in claim 7 or the biological material as claimed in claim 8 in the cultivation of rice varieties with long root systems.