In-vitro transcription vector with long poly A tail and capable of being stably copied and application of in-vitro transcription vector
By constructing in vitro transcription vectors with poly A tails of different lengths, the problem of low mRNA stability and expression efficiency in traditional in vitro transcription technology is solved, and the high stability and long-term expression of mRNA in vivo is achieved, which is suitable for protein purification and functional research.
Patent Information
- Application Number
- CN202510240607.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-03
- Publication Date
- 2025-07-04
AI Technical Summary
Traditional in vitro transcription technology has problems such as poor mRNA stability, low transcription efficiency, insufficient product integrity and low capping efficiency, which affects the application and production complexity of mRNA.
In vitro transcription vectors with poly A tails of different lengths were constructed, including promoters, 5'UTR, target protein gene sequences and 3'UTR elements. The vector was constructed by segmented co-transcriptional method to improve the stability and expression efficiency of mRNA.
It has achieved high stability and long-term expression of mRNA in vivo, with an expression time of up to 312 hours, which is suitable for subsequent protein purification and functional studies.
Smart Images
Figure CN120249339A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of bioengineering technology, and particularly relates to an in vitro transcription vector with a long poly A tail that can stably replicate and its application. Background Art
[0002] In Vitro Transcription (IVT) plays an important role in mRNA vaccines and other gene therapy applications. Through in vitro transcription, a large amount of mRNA can be synthesized for expressing specific proteins or antigens. However, traditional in vitro transcription has problems such as poor mRNA stability, low transcription efficiency, insufficient product integrity, and low capping efficiency. Among them, the poor mRNA stability is easily degraded by nucleases in the body, which limits its development and application; while the low transcription efficiency and insufficient product integrity are because some templates may prematurely produce terminated products, resulting in smaller discrete bands or trailing / degraded products, which are not suitable for applications that require full-length mRNA; in addition, the insufficient capping efficiency requires optimizing reaction conditions and using specific enzymes to increase the capping rate, which increases the complexity of research and development and production. At the same time, traditional in vitro transcription also requires high-quality DNA templates, and impurities or secondary structures in the templates may affect transcription efficiency and product quality. Therefore, strict quality control and optimization of the templates are required.
[0003] Based on this, there is an urgent need for a suitable delivery vector to protect mRNA and improve its stability and half-life in the body. Summary of the Invention
[0004] Aiming at the defects of the prior art, the present invention constructs vectors with poly A tails of different lengths and capable of observing transfection efficiency in vivo, compares their stability and expression efficiency after transfection in cells, screens out vector sequences for in vitro transcription of poly A of various different lengths, and constructs a stably expressing poly A vector that can obtain different RNA products by in vitro transcription, which can meet the needs of most mRNA in vitro transcription, and the obtained mRNA products can be used for downstream in vitro functional verification experiments.
[0005] In order to achieve the above object, the present invention adopts the following technical solutions to solve the technical problems: In a first aspect, the present invention provides an in vitro transcription vector with a long polyA that can stably replicate, which is characterized by comprising a promoter element, a 5'UTR element, a target protein gene sequence, a 3'UTR element, and a poly A tail element.
[0006] In some embodiments, the 5'UTR element is the nucleotide sequence shown in SEQ ID NO:1.
[0007] In some of these embodiments, the 3'UTR element is the nucleotide sequence shown in SEQ ID NO:2.
[0008] In some of these embodiments, the length of the Poly A tail element is 50 - 180 A bases.
[0009] For example, the Poly A tail element may consist of 50 A bases; or the Poly A tail element may consist of 100 A bases; or the Poly A tail element may consist of 120 A bases; or the Poly A tail element may consist of 180 A bases.
[0010] In some of these embodiments, the nucleotide sequence of the in vitro transcription vector is any one of those shown in SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, and SEQ ID No.6.
[0011] For example, the nucleotide sequence of the in vitro transcription vector is as shown in SEQ ID No.3; or the nucleotide sequence of the in vitro transcription vector is as shown in SEQ ID No.4; or the nucleotide sequence of the in vitro transcription vector is as shown in SEQ ID No.5; or the nucleotide sequence of the in vitro transcription vector is as shown in SEQ ID No.6.
[0012] In some of these embodiments, the target protein is GFP, and its nucleotide sequence is as shown in SEQ ID NO:7.
[0013] In some of these embodiments, the promoter is the T7 promoter, and its sequence is the nucleotide sequence shown in SEQ ID NO:8.
[0014] In a second aspect, the present invention provides a genetically engineered cell obtained by transfection with the in vitro transcription vector described above.
[0015] In some of these embodiments, the cell is a HEK - 293T cell.
[0016] In a third aspect, the present invention also provides the application of the in vitro transcription vector described above in in vitro transcription of mRNA.
[0017] Compared with the prior art, the present invention has the following beneficial effects: The present invention prepared four in vitro transcription vectors with poly A tails of 50 - 180 A bases in length. The plasmids with different lengths of poly A structures separate the poly A sequences, significantly reducing recombination events during plasmid DNA amplification, maintaining the tail length, and at the same time not affecting the translation efficiency and half-life of the mRNA generated by in vitro transcription. Then, plasmid vectors suitable for stable passage and high expression were screened through experiments.
[0018] The vector also includes a promoter element, a 5'UTR element, a target protein gene sequence, and a 3'UTR element, which can be stably passaged in Escherichia coli, avoiding the deletion of the A tail, and having high stability and long-term expression. The expression maintenance time is up to 312 h, which is beneficial to subsequent protein purification and functional research. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] In order to more clearly illustrate the technical solutions of the present invention, the drawings required for the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.
[0020] Figure 1 It is the plasmid map of pMRNA-GFP-poly A50 in the embodiment of the present invention.
[0021] Figure 2 It is the plasmid map of pMRNA-GFP-poly A100 in the embodiment of the present invention.
[0022] Figure 3 It is the plasmid map of pMRNA-GFP-poly A2X60_6 in the embodiment of the present invention.
[0023] Figure 4 It is the plasmid map of pMRNA-GFP-poly A3X60_6 in the embodiment of the present invention.
[0024] Figure 5 It is the agarose gel electrophoresis identification map of the digested vector pMRNA-GFP in the embodiment of the present invention.
[0025] Figure 6 It is the streak plate map of different plasmids in the embodiment of the present invention.
[0026] Figure 7 It is the sequencing result map of pMRNA-GFP-poly A50 in the embodiment of the present invention.
[0027] Figure 8 It is the sequencing result map of pMRNA-GFP-poly A100 in the embodiment of the present invention.
[0028] Figure 9 It is the sequencing result map of pMRNA-GFP-poly A2X60_6 in the embodiment of the present invention.
[0029] Figure 10It is the sequencing result diagram of the pMRNA-GFP-poly A3X60_6 plasmid in the embodiment of the present invention.
[0030] Figure 11 It is the immunofluorescence detection result diagram after 24 hours of transfection of the mRNA product in the embodiment of the present invention. In the figure, A and B are without mRNA; C and D are poly A50; E and F are poly A100; G and H are poly A 2X60_6; I and J are poly A 3X60_6.
[0031] Figure 12 It is the immunofluorescence detection result diagram after 48 hours of transfection of the mRNA product in the embodiment of the present invention. In the figure, A and B are without mRNA; C and D are poly A50; E and F are poly A100; G and H are poly A 2X60_6; I and J are poly A 3X60_6.
[0032] Figure 13 It is the immunofluorescence detection result diagram after 72 hours of transfection of the mRNA product in the embodiment of the present invention. In the figure, A and B are without mRNA; C and D are poly A50; E and F are poly A100; G and H are poly A 2X60_6; I and J are poly A 3X60_6.
[0033] Figure 14 It is the immunofluorescence detection result diagram after 96 hours of transfection of the mRNA product in the embodiment of the present invention. In the figure, A and B are without mRNA; C and D are poly A50; E and F are poly A100; G and H are poly A 2X60_6; I and J are poly A 3X60_6.
[0034] Figure 15 It is the immunofluorescence detection result diagram after 120 hours of transfection of the mRNA product in the embodiment of the present invention. In the figure, A and B are without mRNA; C and D are poly A50; E and F are poly A100; G and H are poly A 2X60_6; I and J are poly A 3X60_6.
[0035] Figure 16 It is the immunofluorescence detection result diagram after 312 hours of transfection of the mRNA product in the embodiment of the present invention. In the figure, A and B are the blank group without mRNA; C and D are poly A50; E and F are poly A100; G and H are poly A 2X60_6; I and J are poly A 3X60_6. Detailed implementation mode
[0036] The following describes the technical solutions in the embodiments of the present invention clearly and completely in conjunction with specific embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.
[0037] Unless otherwise specified, the test methods used in the following embodiments are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, are reagents and materials that can be obtained from commercial channels.
[0038] Green fluorescent protein (GFP for short) is a protein composed of about 238 amino acids, which can be excited from blue light to ultraviolet light to emit green fluorescence.
[0039] Example 1: Construction of mRNA transcription plasmid vector by molecular cloning When synthesizing mRNA by IVT, the methods for adding poly(A) tails mainly include: one is enzymatic synthesis, adding poly(A) polymerase derived from Escherichia coli after mRNA transcription is completed; the other is co-transcription, directly transcribing from the poly(A) sequence already present on the template plasmid DNA or PCR product; the third is to use phi29 DNA polymerase to amplify the plasmid by in vitro rolling circle amplification (RCA) technology.
[0040] Due to the instability of long poly A in Escherichia coli amplification, for 120 A and 180 A, a segmented poly(A) co-transcription method is selected, which can reduce the deletion of poly(A). Use 6bp BamHI to divide 120 A bases into two equal-length regions of 60 A bases each; 50 A and 100 A are constructed according to conventional complete A.
[0041] The specific operation steps are as follows: 1. Select Poly A sequences with lengths of 50nt, 100nt, 120nt, and 180nt respectively, named poly A50, poly A100, poly A2X60_6, and poly A3X60_6.
[0042] 2. Gene synthesis of 5’UTR-GFP-3’UTR, clone 5’UTR-GFP-3’UTR into the MCS region of vector pMRNA. The upstream of this MCS sequence has a T7 promoter (SEQ ID NO:7) to obtain pMRNA-GFP.
[0043] 5’-UTR and 3’-UTR design: The 5’-UTR sequence of the human HBA2 gene (geneBank accession number AF230076.1) was selected in the present invention; meanwhile, a partial functional sequence of the 3’-UTR of the human isolated mitochondrion (C310) was introduced as an auxiliary element, and this natural structure was then assembled into the 3’-UTR part of the transcription plasmid.
[0044] 5’UTR sequence: 5’–GAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC-3’ (SEQ ID NO:1); 3’UTR sequence: 5’–GAAATATGTCTGATAAAAGAGTTACTTTGATAGAGTAAATAATAGGAGCTTAAACCCCTTCAAGGCAGTAGCCTCCAAGACTTTAGCCAGAGT-3’ (SEQ ID NO:2).
[0045] GFP sequence: 5’–ATGGAGAGCGACGAGAGCGGCCTGCCCGCCATGGAGATCGAGTGCCGCATCACCGGCACCCTGAACGGCGTGGAGTTCGAGCTGGTGGGCGGCGGAGAGGGCACCCCCAAGCAGGGCCGCATGACCAACAAGATGAAGAGCACCAAAGGCGCCCTGACCTTCAGCCCCTACCTGCTGAGCCACGTGATGGGCTACGGCTTCTACCACTTCGGCACCTACCCCAGCGGCTACGAGAACCCCTTCCTGCACGCCATCAACAACGGCGGCTACACCAACACCCGCATCGAGAAGTACGAGGACGGCGGCGTGCTGCACGTGAGCTTCAGCTACCGCTACGAGGCCGGCCGCGTGATCGGCGACTTCAAGGTGGTGGGCACCGGCTTCCCCGAGGACAGCGTGATCTTCACCGACAAGATCATCCGCAGCAACGCCACCGTGGAGCACCTGCACCCCATGGGCGATAACGTGCTGGTGGGCAGCTTCGCCCGCACCTTCAGCCTGCGCGACGGCGGCTACTACAGCTTCGTGGTGGACAGCCACATGCACTTCAAGAGCGCCATCCACCCCAGCATCCTGCAGAACGGGGGCCCCATGTTCGCCTTCCGCCGCGTGGAGGAGCTGCACAGCAACACCGAGCTGGGCATCGTGGAGTACCAGCACGCCTTCAAGACCCCCATCGCCTTCGCCAGATCCCGCGCTCAGTCGTCCAATTCTGCCGTGGACGGCACCGCCGGACCCGGCTCCACCGGATCTCGC-3’ (SEQ ID NO:7).
[0046] T7 promoter: 5’–TAATACGACTCACTATAGG-3’ (SEQ ID NO:8).
[0047] 3. Cloning (1) Double digest the vector pMRNA-GFP with SmaI and PacI at 37°C for 1 h, run gel electrophoresis and recover the product. As shown in the identification, the digestion system is as shown in Table 1 below. Figure 5 As shown, the digestion system is as shown in Table 1 below.
[0048] Table 1 Restriction Enzyme Digestion System Table of Vector pMRNA-GFP
[0049] Reagents, Instruments: Restriction enzymes: SmaI, PacI (Thermo Scientific) and their matching buffers; Agarose: Andygene, Lot: HTCH006; Electrophoresis buffer, Gel Extraction Kit, Marker (DL2000) were all provided by Guangzhou Aiji Biotechnology Co., Ltd. (IGE); Water bath: Changfeng brand, model XMTD-6000; Electrophoresis apparatus: Junyi brand, model JY 300E; Gel imaging system: Junyi brand, model JY02G.
[0050] (2)Design a pair of primers for poly A50, poly A100, poly A2X60_6, and poly A3X60_6 respectively for PCR amplification (using a 20 μL PCR amplification system, and the PCR amplification is shown in Table 2-3 below). After annealing, clone them into the SmaI and PacI restriction sites of vector pMRNA-GFP, and connect at 16 °C for 30 min (the ligation system is shown in Table 4 below) to obtain GFP vectors with different poly A tails, such as Figures 1-4 shown, which are pMRNA-GFP-poly A50, pMRNA-GFP-poly A100, pMRNA-GFP-poly A2X60_6, and pMRNA-GFP-poly A3X60_6 respectively, and their nucleotide sequences are shown in SEQ ID NO: 3-6.
[0051] Table 2 PCR Amplification System Table
[0052] Table 3 PCR Amplification Program Table
[0053] Reagents, Instruments: Oligos Mix Template, amplification primers, 2x PCR Master Mix, and PCR enhancer were all provided by Guangzhou Aiji Biotechnology Co., Ltd. (IGE); PCR instrument: GENEStar Triple-32TS.
[0054] Table 4 Ligation System Table
[0055] mRNA-F: 5’–TAATACGACTCACTATAGGGGGTCGACGAGAATAAAC-3’ (SEQ ID NO:9).
[0056] mRNA-R: 5’–GGAGGTCAGGTATGATTTAAATGGTCAGTATTGAGC-3’ (SEQ ID NO:10).
[0057] Example 2: Verification of mRNA Transcription Plasmid The plasmids pMRNA-GFP-poly A50, pMRNA-GFP-poly A100, pMRNA-GFP-poly A2X60_6, and pMRNA-GFP-poly A3X60_6 carrying GFP were separately re-transformed into competent Escherichia coli DH5α cells. Four single colonies were picked, expanded in culture, and then sent to a sequencing company for sequencing.
[0058] As Figures 6-10 shown, after streaking and extraction at 4 time intervals, the sequenced sequences were consistent with the original map sequences. After they were consistent with the map sequences, the bacteria were preserved and the original seed bank, master seed bank, and working seed bank were established. One month later, the bacteria in the working seed bank were streaked, 4 clones were picked for sequencing verification. After obtaining sequences consistent with the map sequences, the bacteria were preserved and the working seed bank was established. Two months later, the bacteria in the working seed bank were streaked, 4 clones were picked for sequencing verification. After obtaining sequences consistent with the map sequences, the bacteria were preserved and the working seed bank was established. Four months later, the bacteria in the working seed bank were streaked, 4 clones were picked for sequencing verification. After obtaining sequences consistent with the map sequences, the bacteria were preserved and the working seed bank was established. And six months later, the bacteria in the working seed bank were streaked, 4 clones were picked for sequencing verification. After obtaining sequences consistent with the map sequences, the bacteria were preserved and the working seed bank was established.
[0059] Example 3: In Vitro Synthesis of mRNA The 4 GFP vectors pMRNA-GFP-poly A50, pMRNA-GFP-poly A100, pMRNA-GFP-poly A2X60_6, and pMRNA-GFP-poly A3X60_6 with different A tails were linearized by restriction endonucleases. After verifying the number of polyA by first-generation sequencing and obtaining consistent results, 4 mRNA products of GFP with different A tails were transcribed in vitro, and 10 μg of RNA was obtained respectively.
[0060] The specific operation steps are as follows: Using the linearized recombinant plasmid as a template, templates with different polyA tails were amplified separately, and PCR amplification was performed using Taq high-fidelity DNA polymerase (provided by Guangzhou Aiji Biotechnology Co., Ltd.). Reaction conditions: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s; extension at 72°C for 45 s, 30 cycles; final extension at 72°C for 10 min. The amplified products were analyzed by 10 g / L agarose gel electrophoresis, the target fragments were recovered using a recovery kit, and the A260 / A280 ratio and concentration of the recovered products were measured.
[0061] In this example, the primer sequences used for amplification were the same as those shown in SEQ ID NO:9-10 above.
[0062] Example 4: mRNA transfection of 293T cells and protein expression mRNA products of GFP without A and with four different A tails were transfected into HEK-293T cells respectively. The fluorescence coverage rates at 24h, 48h, 72h, 96h, 120h, and 312h were observed by fluorescence microscopy to analyze the stability of mRNA products with different poly A lengths transfected into cells.
[0063] The specific operation steps are as follows: HEK-293T cells were seeded in a six-well cell culture plate for culture. When the cell density reached 50%, mRNA (2.5 μg / well) was transfected into HEK-293T cells according to the TransIT®-mRNA Transfection Kit instructions. The transfection reagent (Lipofectamine3000) was used as the negative control group, and HEK-293T cells (without polyA) were used as the blank control group. The fluorescence intensity and changes were observed by microscope.
[0064] It can be seen from Figures 11-16 that the fluorescence intensity from high to low is poly A 3X60_6, poly A 2X60_6, polyA100, poly A50, and no polyA, indicating that after the products of in vitro transcription of GFP-mRNA with different lengths of polyA tails were transfected into HEK-293T cells, the mRNA products had obvious fluorescence after transfection, and the fluorescence increased with the extension of time, and still had strong fluorescence after 312h of transfection. It was proved that among the 4 in vitro transcription vectors, the longer the polyA tail, the higher the fluorescence coverage rate and the stronger the expression stability in cells, which can reduce the variability in experiments and improve the reliability and repeatability of experimental results.
[0065] In summary, the four vector backbones with poly A tails of different lengths modified by the present invention all carry 5’UTR-GFP-3’UTR. The mRNA products after in vitro transcription have high expression levels and long fluorescence maintenance times, and the RNA is stably expressed in cells and not easily degraded.
[0066] After testing, it was found that these four GFP plasmids with long polyA can be stably passaged in Escherichia coli without the deletion of the A tail, and their transcription products can maintain protein expression in the conventional tumor cell 293T for up to 312 hours. In addition, different gene sequences can be inserted into this in vitro transcription vector, and the transcribed lncRNA or the encoded gene can be more stably expressed in cells.
[0067] In addition, it should be understood that although this specification is described according to the embodiments, not every embodiment only contains an independent technical solution. This narrative way of the specification is only for clarity. Those skilled in the art should regard the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.
Claims
1. An in vitro transcription vector with a long polyA that can be stably replicated, characterized in that, It includes a promoter element, a 5'UTR element, a target protein gene sequence, a 3'UTR element, and a poly A tail element.
2. The in vitro transcription vector with a long polyA and capable of stable replication according to claim 1, characterized in that, The 5'UTR element is the nucleotide sequence shown in SEQ ID NO:
1.
3. The in vitro transcription vector with a long polyA and capable of stable replication according to claim 1, characterized in that, The 3'UTR element is the nucleotide sequence shown in SEQ ID NO:
2.
4. An in vitro transcription vector with a long polyA that can be stably replicated according to claim 1, characterized in that, The length of the Poly A tail element is 50 - 180 A bases.
5. An in vitro transcription vector with a long polyA that can be stably replicated according to claim 1, characterized in that, Its nucleotide sequence is any one of those shown in SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, and SEQ ID No.
6.
6. The in vitro transcription vector with a long polyA that can be stably replicated according to claim 1, characterized in that, The target protein is GFP, and its nucleotide sequence is as shown in SEQ ID NO:
7.
7. An in vitro transcription vector with a long polyA that can be stably replicated according to claim 1, characterized in that, The promoter is the T7 promoter, and its sequence is the nucleotide sequence shown in SEQ ID NO:
8.
8. An engineered cell, characterized in that, It is obtained by transfection with the in vitro transcription vector described in any one of claims 1 - 6.
9. The engineered cell according to claim 8, wherein The cell is a HEK-293T cell.
10. Use of the in vitro transcription vector described in any one of claims 1 - 7 in in vitro transcription of mRNA.