Application of GmTC1a-1 protein and coding gene thereof in improving soybean oil content or / and increasing soybean seed weight
Knocking out or mutating the GmTC1a-1 gene in soybeans through CRISPR/Cas9 gene editing technology solves the problem of insufficient soybean oil and seed weight, achieving a significant increase in soybean oil and seed weight, and providing soybean mutants with high oil and seed weight.
Patent Information
- Application Number
- CN202510367228.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-26
- Publication Date
- 2025-07-04
- Estimated Expiration
- 2045-03-26
AI Technical Summary
my country's soybean varieties have low oil content and low processing efficiency, resulting in insufficient market competitiveness. How to increase the soybean oil content and seed weight is the key to solving the soybean demand gap.
The GmTC1a-1 gene in soybeans was knocked out or mutated by CRISPR/Cas9 gene editing technology, and the sgRNA was designed using the amino acid sequence and nucleotide sequence of the GmTC1a-1 protein to construct the CRISPR/Cas9 gene editing vector, and Agrobacterium-mediated genetic transformation was carried out to obtain soybean mutants with high oil content and seed weight.
The oil content and seed weight of soybeans have been significantly improved, providing a material basis for creating soybean mutants with high oil content and seed weight, and providing new materials for subsequent research and breeding.
Smart Images

Figure CN120249359A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and particularly relates to an GmTC1a-1 application of a protein and its coding gene in increasing soybean oil content and / or increasing soybean seed weight. Background Art
[0002] Soybean ( Glycine max ), an annual herb, is an important food crop and oil crop, and also a source of high-quality plant protein food. Soybean is rich in nutrients, with a high protein content, containing essential amino acids for the human body, fat, and various mineral nutrient elements.
[0003] By 2024, the planting area of soybeans in China exceeded 155 million mu, and the soybean output reached 20.65 million tons. However, the yield per unit area of soybeans still has an obvious gap, and the demand gap for soybeans is still huge. The reasons are that in addition to the fact that the yield per unit area of soybean varieties in China is lower than the world average level, another important reason is that the oil content of soybean varieties in China is generally lower than that of imported soybeans, and the relative processing efficiency is also lower, lacking market competitiveness. Therefore, how to increase the oil content of soybeans and the weight of soybean seeds is of great significance and application value for solving the demand gap of soybeans. Summary of the Invention
[0004] The technical problem to be solved by the present invention is to overcome the above-mentioned deficiencies and defects in the background art, and provide an GmTC1a-1 application of a protein and its coding gene in increasing soybean oil content or increasing soybean seed weight.
[0005] To solve the above technical problem, the technical solution proposed by the present invention is: GmTC1a-1 Application of a protein in increasing soybean oil content and / or increasing soybean seed weight, wherein the GmTC1a-1 amino acid sequence of the protein is shown as SEQ ID NO: 4.
[0006] Based on a general inventive concept, the present invention also provides an GmTC1a-1 application of a protein coding gene in increasing soybean oil content and / or increasing soybean seed weight, wherein the GmTC1a-1 nucleotide sequence of the protein coding gene is shown as SEQ ID NO: 3.
[0007] For the above application, preferably, soybean GmTC1a-1 protein expression or activity is inhibited to screen or create soybean varieties with high oil content or heavy seed weight.
[0008] For the above application, preferably, the method for inhibiting soybean GmTC1a-1 protein expression or activity includes: using gene editing technology to knockout or mutate GmTC1a-1Gene.
[0009] For the above application, preferably, the gene editing technology is CRISPR / Cas9 technology. GmTC1a-1 The sgRNA target sequences of the gene include SG1 and SG2. The nucleotide sequence of SG1 is as shown in SEQ ID NO: 5, and the nucleotide sequence of SG2 is as shown in SEQ ID NO: 6.
[0010] Based on a general inventive concept, the present invention also provides a CRISPR / Cas9 gene editing vector for implementing the above application. The vector at least contains the following elements: A double sgRNA tandem expression cassette as shown in SEQ ID NO: 7, targeting GmTC1a-1 The SG1 and SG2 sites of the gene.
[0011] Based on a general inventive concept, the present invention also provides a method for cultivating soybeans with high oil content and / or heavy seed weight, including the following steps: (1) Construct GmTC1a-1 A gene editing vector; (2) Introduce the vector obtained in step (1) into Agrobacterium, and use Agrobacterium to transfer it into soybeans for genetic transformation; (3) Identify the soybeans obtained in step (2) to obtain soybeans with high oil content and / or heavy seed weight.
[0012] For the above method, preferably, the GmTC1a-1 Gene editing vector contains pCBSG015 and two sgRNA expression cassettes SG1 and SG2; the nucleotide sequence of SG1 is as shown in SEQ ID NO: 5; the nucleotide sequence of SG2 is as shown in SEQ ID NO: 6.
[0013] For the above method, preferably, in the soybeans with high oil content and / or heavy seed weight GmTC1a-1 The expression of the gene is inhibited or inactivated.
[0014] For the above method, preferably, the soybeans with high oil content and / or heavy seed weight GmTC1a-1 The mutation types of the gene include: a frameshift mutation caused by a 460bp deletion downstream of the target site SG1; or a frameshift mutation caused by a 4bp deletion downstream of the target site SG2.
[0015] Compared with the prior art, the beneficial effects of the present invention are: (1) The present invention determines that GmTC1a-1 The gene is a target gene for creating soybeans with high oil content and / or heavy seed weight traits. For soybeans GmTC1a-1Two sgRNA expression cassettes SG1 and SG2 designed based on the conserved regions of the gene were used to construct a set of CRISPR-Cas9 vectors. Through Agrobacterium-mediated genetic transformation, soybean mutants with high oil content or / and heavy seed weight can be obtained, providing GmTC1a-1 the application of the gene in creating soybean mutants with high oil content or / and heavy seed weight; it also provides the application of the vector for knocking out GmTC1a-1 the gene in creating soybean mutants, which can significantly improve the economic traits of soybeans.
[0016] (2) This invention provides a material basis for subsequent research on soybean oil synthesis and the creation of new high-oil soybean materials. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.
[0018] Figure 1 is GmTC1a-1 a schematic diagram of the construction of the gene editing vector.
[0019] Figure 2 is the PCR detection diagram of the T2 generation CRISPR / Cas9 gene-edited plants for Cas9 the gene.
[0020] Figure 3 is the PCR detection diagram of the T2 generation CRISPR / Cas9 gene-edited plants for GmActin the gene.
[0021] Figure 4 is the PCR detection diagram of the T2 generation CRISPR / Cas9 gene-edited plants for GmTC1a-1 the gene.
[0022] Figure 5 is a schematic diagram of the CRISPR / Cas9 gene editing target site.
[0023] Figure 6 is a flow chart of soybean genetic transformation.
[0024] Figure 7 is the analysis and comparison result of the mutation types of the T2 generation CRISPR / Cas9 gene-edited plants.
[0025] Figure 8 is a bar chart of the oil content of the CRISPR / Cas9 gene-edited plants.
[0026] Figure 9It is a bar chart of 100-seed weight for CRISPR / Cas9 gene-edited plants. Detailed implementation mode
[0027] To facilitate the understanding of the present invention, the following will describe the present invention more comprehensively and meticulously in combination with the accompanying drawings of the specification and preferred embodiments. However, the protection scope of the present invention is not limited to the following specific embodiments.
[0028] Unless otherwise defined, all professional terms used hereinafter have the same meaning as commonly understood by those skilled in the art. The professional terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the protection scope of the present invention.
[0029] Unless otherwise specifically stated, various raw materials, reagents, instruments, and equipment used in the present invention can be obtained through market purchases or can be prepared by existing methods.
[0030] Example 1: GmTC1a-1 Cloning of genes and construction of editing vectors 1. GmTC1a-1 Cloning of genes Primer design: Download the https: / / phytozome-next.jgi.doe.gov / gene sequence in the Phytozome public database ( GmTC1a-1 ), and design the following primers: Glyma.06G066900 GmTC1a-1 F: 5’-ATGAAGCAAGCTTCTTCGGAG-3’ (shown in SEQ ID NO: 1); GmTC1a-1 R: 5’-TCAAGAGTGATTAAACCAGGGTC-3’ (shown in SEQ ID NO: 2); PCR Amplification: Novoprotein High-Fidelity Enzyme Amplification System: 25 μL of 2×Phanta-Master Mix; 18 μL of ddH2O; 2.5 μL of forward primer; 2.5 μL of reverse primer; 2 μL of cDNA template. The PCR reaction conditions are as follows: Pre-denaturation at 98°C for 5 min; 30 sec at 98°C, 30 sec at 58°C, 4 min at 72°C, for 30 cycles; Extension at 72°C for 5 min. After DNA purification and recovery, it is ligated to a cloning vector for sequencing. 4 μL of DNA purification product; 1 μL of pEASY-Blunt T vector, incubated in a water bath at 24°C for 25 min. Add 5 μL of the ligation reaction system to the freshly thawed Escherichia coli competent cells Trans1-T1, incubate on ice for 5 min, heat shock in a water bath at 42°C for 1 min, and then place back on ice. Add 1 mL of LB liquid medium pre-cooled at 4°C, shake and culture at 37°C for 1 h, pipette 200 μL of the bacterial solution and spread it on an LB + Kan plate, and culture it in an incubator at 37°C for 16 h. Pick a single colony and perform colony PCR. PCR system: 7.5 μL of 2×Rapid Taq Master Mix; 5.5 μL of ddH2O; 0.5 μL each of forward primer ( 35s F: 5’-TCATTCAAGATCTCTCTGCCGACAG-3’) and reverse primer ( JCGmTC1a-1 R: 5’-GCCGTGTGATTTCTTCTTGCTAGAG-3’). The reaction conditions for PCR amplification are: Pre-denaturation at 98°C for 5 min; 25 sec at 98°C, 25 sec at 58°C, 25 sec at 72°C, for 30 cycles; Extension at 72°C for 5 min. Pick out the positive single colonies, shake and culture in 10 mL of LB + Kan liquid medium at 37°C for 16 h, and send the bacterial solution sample for sequencing.
[0031] (1) GmTC1a-1 The nucleotide sequence is as follows: (5040 bp) as shown in SEQ ID NO: 3 (2) GmTC1a-1 Amino acid sequence: (1680 aa) as shown in SEQ ID NO: 4 2. sgRNA Design and GmTC1a-1 Construction of Gene Editing Vector Target Site Prediction: Download the https: / / phytozome-next.jgi.doe.gov / gene sequence from the Phytozome public database ( GmTC1a-1 ). Use the website (http: / / crispr.hzau.edu.cn / CRISPR2 / ) to Glyma.06G066900 predict and analyze the potential target sites of 19nt + PAM (NGG) on the GmTC1a-1 gene, and select: The nucleotide sequence of SG1 is shown as SEQ ID NO: 5 (TTTCCAAGTGAACTTCCCACTGG); The nucleotide sequence of SG2 is shown as SEQ ID NO: 6 (ATGGGGCTGTGATTGCCGGGAGG).
[0032] Vector Construction: The method for constructing a recombinant vector containing the sgRNA composition includes the method for constructing pCBSG015- GmTC1a-1 , and the specific steps include: A. Gene synthesis containing a promoter + GmTC1a-1
[0033] B. Two expression cassettes were ligated to the linearized plasmid pCBSG015 obtained by digestion with HindIII and SmaI to obtain the pCBSG015- GmTC1a-1 recombinant vector.
[0034] The vector used in the present invention is pCBSG015 (Basta), which is provided by Weimi Biotechnology Co., Ltd. Its resistance in prokaryotes is kanamycin, and its resistance in eukaryotes is glufosinate (Basta; PPT). The schematic diagram of vector construction is as Figure 1 shown.
[0035] The pCBSG015- GmTC1a-1 recombinant vector was introduced into EHA105 Agrobacterium. Add 2 μL of the pCBSG015- GmTC1a-1 recombinant vector to the freshly thawed EHA105 Agrobacterium competent cells, incubate on ice for 5 min, freeze in liquid nitrogen for 1 min, heat shock in a 37°C water bath for 3 min, and then incubate on ice for 3 min. Add 1 mL of LB liquid medium and culture with shaking at 28°C for 90 min. Pipette 200 μL of the bacterial solution and spread it on an LB+Kan+Rif+Gen plate. Incubate in a 28°C incubator for 48 h. Pick a single colony and perform colony PCR. The PCR system: 1 μL of template DNA; 7.5 μL of 2×Rapid Taq Master Mix; 0.5 μL each of forward and reverse primers; 5.5 μL of ddH2O. The reaction conditions for PCR amplification are as follows: pre-denaturation at 98°C for 5 min; 30 cycles of 98°C for 30 sec, 60°C for 30 sec, 72°C for 3 sec; extension at 72°C for 5 min.
[0036] Example 2: Soybean genetic transformation (1) Seed disinfection: Put the seeds into a sterilized 100 mL Erlenmeyer flask, add 75% alcohol, and rinse twice. Add 25 mL of 84 disinfectant, 75 mL of sterilized water, and 3 drops of Tween-20, and soak for 15 min. After rinsing three times with sterilized water, place the seeds with the hilum facing down on the germination medium (GM) and germinate under light for 2 d (26°C, 18 h light / 6 h dark photoperiod). The germination medium (GM): 1 / 2 MS salt ions + 20 g / L sucrose + 7 g / L agar, pH 5.8, autoclaved.
[0037] (2) Preparation of Agrobacterium bacterial solution: Pick a positive monoclonal colony into 2 mL of YEP medium containing antibiotics and culture with shaking (250 rpm, 28°C) until growth saturation (about 12 h). Take 0.2 mL of the saturated bacterial solution and add it to 250 mL of YEP medium containing antibiotics and culture overnight until the logarithmic growth phase (OD 650= 0.3 - 0.6). Centrifuge to collect the colonies, and resuspend the precipitate with liquid co-culture medium (CM) to an OD 650 of 0.6. YEP medium: 5 g / L NaCl + 5 g / L yeast extract + 10 g / L peptone + 15 g / L agar, autoclaved.
[0038] (3) Preparation of explants: Pour 30 ml of Agrobacterium suspension into a Petri dish. Use a scalpel blade to make a longitudinal cut along the hilum to separate the cotyledons and remove the seed coat. The embryonic axis at the junction of the hypocotyl and cotyledon is excised to obtain semi-seed explants. Prepare 50 explants for each Petri dish of Agrobacterium suspension. Ensure that the entire explant is suspended in the suspension. After 30 min of infection, transfer the explants to solid co-culture medium with sterilized forceps, 15 explants per dish, placed horizontally. Seal the Petri dish with breathable tape and transfer them to an incubator (23 °C) for 4 d of dark culture.
[0039] Co-culture medium (CM): 1 / 2 MS salt ions + 3.9 g / L MES + 30 g / L sucrose + B5 vitamins + 153 mg / L DTT + 2 mg / L zeatin + 40 mg / L AS + 7 g / L agar, pH 5.4, autoclaved.
[0040] (4) Shoot induction and screening: Place the explants on SI medium without a screening agent (15 explants per dish). Seal the Petri dish with breathable tape and culture under light for 7 d (26 °C, 18 h light / 6 h dark photoperiod). Then cut off the elongated hypocotyls under the cotyledons and transfer the explant tissues to SI medium containing a screening agent for 21 d of light culture (7 explants per dish).
[0041] Shoot induction medium (SI): B5 salt ions + 0.98 g / L MES + 30 g / L sucrose + B5 vitamins + 150 mg / L cefotaxime + 450 mg / L ticarcillin + 1 mg / L 6-BA + 50 mg / L asparagine + 50 mg / L glutamine + 6 mg / L glufosinate + 7 g / L agar, pH 5.7, autoclaved.
[0042] (5) Shoot elongation: Transfer the differentiated explants to SE medium. Cut off the cotyledons from the explants and make a new cut at the base of the developing node. Transfer the explants to fresh shoot elongation (SE) medium and culture under light at 26 °C for 6 weeks. Replace the fresh SE medium every 2 weeks. Make a fresh horizontal cut at the base of the explant each time the medium is changed.
[0043] Stem elongation (SE) medium: MS salts + 0.6 g / L MES + 30 g / L sucrose + B5 vitamins + 150 mg / L cefotaxime + 450 mg / L ticarcillin + 0.1 mg / L IAA + 0.5 mg / L GA + 1 mg / L zeatin + 50 mg / L asparagine + 50 mg / L glutamine + 6 mg / L glufosinate + 7 g / L agar, pH 5.7, autoclaved.
[0044] (6) Rooting: When the stems grow to 3 cm in length, cut them from the tissue, soak them in IBA (1 mg / ml) for 2 min, and then transfer them to a glass bottle containing rooting medium (RM) for further cultivation. After 2 weeks, when the stems have grown more than 2 roots, transplant them into the soil and acclimatize the seedlings. Cultivate them under light at 26°C for about 1 week, and the seedlings will survive.
[0045] Rooting medium (RM): 1 / 2 MS salts + 0.6 g / L MES + 20 g / L sucrose + B5 vitamins + 3 mg / L glufosinate + 7 g / L agar, pH 5.7, autoclaved.
[0046] Example 3: Screening and identification of transgenic plants Extract the DNA of the resistant plants obtained by tissue culture, and perform PCR amplification on their DNA using the corresponding upstream and downstream primers of the vector. The reaction conditions for PCR amplification are: pre-denaturation at 98°C for 5 min; 98°C for 30 sec, 60°C for 30 sec, 72°C for 3 sec, for 30 cycles; extension at 72°C for 5 min. The plants that amplify the target fragment size band are transgenic plants. The positive detection method uses the forward primer Cas9-detection F (5’-CCGACGAGTACAAGGTGCCCA-3’) and the reverse primer Cas9-detectionR (5’-GGCGATCAGATTTTCCAGCC-3’) for PCR amplification detection respectively. The electrophoresis detection results are as Figure 2 shown. The transgenic plants that obtain the target amplification product have inserted the T-DNA fragment, while the transgenic plants without the target product have not inserted the T-DNA fragment.
[0047] Extract the DNA of positive plants, and use the primers GmActin F (5’-CGGTGGTTCTATCTTGGCATC-3’) / GmActin R (5’-GTCTTTCGCTTCAATAACCCTA-3’) to detect the quality of the DNA by PCR. The reaction system is as follows: template DNA 1 μL; 2×Rapid Taq Master Mix 7.5 μL; 0.5 μL of each upstream and downstream primer; ddH2O 5.5 μL. The PCR reaction conditions are: pre-denaturation at 98°C for 5 min; 30 sec at 98°C, 30 sec at 56°C, 30 sec at 72°C, for 30 cycles; extension at 72°C for 5 min. The electrophoresis pattern of the PCR reaction product is as shown in Figure 3 shown.
[0048] Use GmTC1a-1 the primers TC1a-1 F (5’-CCAAATTGGGTTACCTCTTCAACAC-3’) / TC1a-R (5’-TAAGTCGACAATCCCTATTGCCAAT-3’) at 160 bp upstream of the gene target site to perform PCR amplification on its DNA, and sequence and analyze the obtained PCR product. The reaction system is preferably as follows: template DNA 1 μL, 2×Rapid Taq Master Mix 7.5 μL, 0.5 μL of each upstream and downstream primer, ddH2O 5.5 μL; the reaction conditions are: pre-denaturation at 98°C for 5 min; 30 sec at 98°C, 30 sec at 58°C, 30 sec at 72°C, for 30 cycles; extension at 72°C for 5 min. The electrophoresis result of the PCR reaction product is as shown in Figure 4 shown.
[0049] Example 4: Construction of CRISPR / Cas9 gene editing vector and soybean genetic transformation Using the cloned GmTC1a-1 as the target gene, two 19nt+PAM (NGG) sequences with GC contents of 65% and 47% respectively, which are located within the first exon of the GmTC1a gene, were selected as the target sequences. The CRISPR / Cas9 gene editing target sites are as shown in Figure 5 shown. Referring to the CRISPR / Cas9 vector construction process and system, the CRISPR / Cas9 gene editing vector pCBSG015- 35S::GmTC1a-1 -Cas9 was successfully constructed, and it was respectively transformed into Agrobacterium tumefaciens EHA105 . Positive monoclonal colonies were selected for the genetic transformation of Tianlong No. 1. The soybean genetic transformation process is as shown in Figure 6 shown.
[0050] Example 5: Phenotype and function verification After sequencing and alignment analysis, the results are as shown inFigure 7 As shown, among the 4 obtained T2-generation CRISPR / Cas9 gene-edited plants without exogenous Cas9 genes, the genes in plants numbered TC1a-03, TC1a-04, and TC1a-07 GmTC1a-1 were all effectively edited and were homozygous mutants. In plants TC1a-03 and TC1a-04, GmTC1a-1 the gene was deleted by 460bp (-460bp deletion), resulting in a frameshift mutation in the gene reading frame. At the 81st base after the PAM site of the target sequence SG1, the stop codon "TGA" was encountered and translation terminated; while in plant TC1a-07, GmTC1a-1 the gene was deleted by 4bp (-4bp deletion). At the 73rd base after the PAM site of the target sequence SG2, the stop codon "TGA" was encountered and translation terminated prematurely.
[0051] Analysis of the seed oil content of CRISPR / Cas9 gene-edited materials: The seed oil content of the obtained CRISPR / Cas9 gene-edited homozygous mutant plants was measured by a near-infrared analyzer. The results showed that the crude fat contents of the seeds of gene-edited materials TC1a-03, TC1a-04, and TC1a-07 were 25.32%, 25.41%, and 23.91% respectively ( Figure 8 ), which were significantly higher than those of the control (WT, Tianlong No. 1, with a crude fat content of 22.15%). Among them, the crude fat contents of the seeds of TC1a-03 and TC1a-04 were significantly higher than those of the control ( Figure 8 ), indicating that the oil content of soybean seeds increased after the GmTC1a-1 protein was deleted.
[0052] Analysis of the 100-seed weight of CRISPR / Cas9 gene-edited materials: The 100-seed weight of the obtained CRISPR / Cas9 gene-edited homozygous mutant seeds was measured. The results showed that the 100-seed weights of the seeds of gene-edited materials TC1a-03, TC1a-04, and TC1a-07 were 23.2g, 22.8g, and 21.3g respectively, which were significantly higher than those of the control (WT, Tianlong No. 1, with a 100-seed weight of 20.5g). Among them, the 100-seed weights of the seeds of TC1a-03 and TC1a-04 were significantly higher than those of the control ( Figure 9 ), indicating that the 100-seed weight of soybean seeds also increased after the GmTC1a-1 protein was deleted.
[0053] In soybean breeding, in the later stage, plants with high oil content or heavy seed weight can be screened by detecting the GmTC1a-1 gene mutation for use in the breeding of hybrid offspring.
Claims
1. GmTC1a-1 Use of a protein in increasing the oil content of soybeans and / or increasing the weight of soybean seeds, characterized in that The GmTC1a-1 amino acid sequence of the protein is shown in SEQ ID NO:
4.
2. GmTC1a-1 Use of a protein-coding gene in increasing soybean oil content or / and increasing soybean seed weight, characterized in that The GmTC1a-1 nucleotide sequence of the protein-coding gene is shown in SEQ ID NO:
3.
3. The application according to claim 1 or 2, characterized in that, By suppressing the expression or activity of GmTC1a-1 proteins in soybeans to screen or create soybean varieties with high oil content or heavy seed weight.
4. The application according to claim 3, characterized in that, The method for inhibiting the expression or activity of GmTC1a-1 protein in soybeans includes: knocking out or mutating GmTC1a-1 genes by using gene editing technology.
5. The application according to claim 4, characterized in that, The gene editing technology is the CRISPR / Cas9 technology, GmTC1a-1 The sgRNA target sequences of the gene include SG1 and SG2. The nucleotide sequence of SG1 is as shown in SEQ ID NO: 5, and the nucleotide sequence of SG2 is as shown in SEQ ID NO:
6.
6. A CRISPR / Cas9 gene editing vector for implementing the application as described in claim 5, characterized in that, The vector contains at least the following elements: The dual sgRNA tandem expression cassette shown in SEQ ID NO:7 targets GmTC1a-1 the SG1 and SG2 sites of the 7. A method for cultivating soybeans with high oil content and / or heavy seed weight, characterized in that, including the following steps: (1) Construct GmTC1a-1 a gene editing vector; (2) Introduce the vector obtained in step (1) into Agrobacterium, and use Agrobacterium to transfer it into soybeans for genetic transformation; (3) Identify the soybeans obtained in step (2) to obtain soybeans with high oil content or / and heavy seed weight.
8. The method according to claim 7, wherein The GmTC1a-1 The gene editing vector comprises pCBSG015 and two sgRNA expression cassettes SG1 and SG2; the nucleotide sequence of SG1 is as shown in SEQ ID NO: 5; the nucleotide sequence of SG2 is as shown in SEQ ID NO:
6.
9. The method according to claim 7, wherein In soybeans with high oil content or / and heavy seed weight GmTC1a-1 The expression of the gene is inhibited or inactivated.
10. The method according to claim 7, characterized in that, Soybeans with high oil content or / and heavy seed weight GmTC1a-1 The mutation types of the gene include: a frameshift mutation caused by a 460 bp deletion downstream of the target site SG1; or a frameshift mutation caused by a 4 bp deletion downstream of the target site SG2.
Citation Information
Patent Citations
Application of GmASHH2a / b protein and coding gene thereof in regulation and control of late flowering of soybean
CN115960192A
Soybean internode length and plant height related protein and biological material and application thereof
CN118344450A