Use of gm tc1a-1 protein and its encoding gene in improving soybean oil content and / or increasing soybean seed weight

Abstract

This invention belongs to the field of biotechnology and discloses a... GmTC1a-1 The application of proteins and their encoding genes in increasing soybean oil content and / or increasing soybean seed weight, the GmTC1a-1 The amino acid sequence of the protein is shown in SEQ ID NO: 4. GmTC1a-1 The nucleotide sequence of the protein-coding gene is shown in SEQ ID NO: 3. This invention also discloses a CRISPR / Cas9 gene-editing vector for application in increasing soybean oil content and / or increasing soybean seed weight, and a method for cultivating soybeans with high oil content and / or heavy seed weight. This invention identifies... GmTC1a-1 The gene provides a target gene for creating soybeans with high oil content and / or high seed weight traits. GmTC1a-1 GmTC1a-1 The application of proteins and their encoding genes in increasing soybean oil content and / or increasing soybean seed weight can significantly improve the economic traits of soybeans.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to an application of a protein and a coding gene thereof in increasing oil content or / and seed weight of soybean. GmTC1a-1 The application belongs to the technical field of biotechnology, and particularly relates to an application of a protein and a coding gene thereof in increasing oil content or / and seed weight of soybean. BACKGROUND

[0002] Soybean (Glycine max), as an annual herb, is an important food crop and oil crop, and is also a high-quality plant protein food source. Glycine max Soybean is rich in nutrients and high in protein content, and contains essential amino acids, fats and various mineral nutrients for human body.

[0003] Therefore, how to increase the oil content and seed weight of soybean has important significance and application value for solving the demand gap of soybean. SUMMARY

[0004] The application belongs to the technical field of biotechnology, and particularly relates to an application of a protein and a coding gene thereof in increasing oil content or / and seed weight of soybean. GmTC1a-1 The application belongs to the technical field of biotechnology, and particularly relates to an application of a protein and a coding gene thereof in increasing oil content or / and seed weight of soybean.

[0005] To solve the above technical problems, the technical scheme provided by the application is as follows:

[0006] GmTC1a-1 The application belongs to the technical field of biotechnology, and particularly relates to an application of a protein and a coding gene thereof in increasing oil content or / and seed weight of soybean. GmTC1a-1 The amino acid sequence of the protein is shown in SEQ ID NO: 4.

[0007] Based on the overall inventive concept, the application further provides an application of a protein coding gene in increasing oil content or / and seed weight of soybean. GmTC1a-1 The nucleotide sequence of the protein coding gene is shown in SEQ ID NO: 3. GmTC1a-1 The application belongs to the technical field of biotechnology, and particularly relates to an application of a protein and a coding gene thereof in increasing oil content or / and seed weight of soybean.

[0008] The application belongs to the technical field of biotechnology, and particularly relates to an application of a protein and a coding gene thereof in increasing oil content or / and seed weight of soybean. GmTC1a-1 The application belongs to the technical field of biotechnology, and particularly relates to an application of a protein and a coding gene thereof in increasing oil content or / and seed weight of soybean.

[0009] The application belongs to the technical field of biotechnology, and particularly relates to an application of a protein and a coding gene thereof in increasing oil content or / and seed weight of soybean. GmTC1a-1 The method for inhibiting the expression or activity of the protein in soybean preferably comprises knocking out or mutating the gene by using a gene editing technology. GmTC1a-1 The gene editing technology is preferably CRISPR / Cas9 technology.

[0010] The gene editing technology is preferably CRISPR / Cas9 technology. GmTC1a-1The sgRNA target sequence of the gene comprises SG1 and SG2, wherein the nucleotide sequence of SG1 is shown as SEQ ID NO: 5, and the nucleotide sequence of SG2 is shown as SEQ ID NO: 6.

[0011] Based on one general inventive concept, the present application also provides a CRISPR / Cas9 gene editing vector for implementing the application as described above, wherein the vector comprises at least the following elements:

[0012] The double-sgRNA tandem expression cassette shown as SEQ ID NO: 7 targets GmTC1a-1 SG1 and SG2 sites of the gene.

[0013] Based on one general inventive concept, the present application also provides a method for breeding soybeans with high oil content or / and heavy seed weight, comprising the following steps:

[0014] (1) constructing GmTC1a-1 a gene editing vector;

[0015] (2) introducing the vector obtained in step (1) into Agrobacterium, and using the Agrobacterium to perform genetic transformation into soybeans;

[0016] (3) identifying the soybeans obtained in step (2) to obtain soybeans with high oil content or / and heavy seed weight.

[0017] Preferably, in the method, GmTC1a-1 the gene editing vector comprises pCBSG015 and two sgRNA expression cassettes SG1 and SG2, wherein the nucleotide sequence of SG1 is shown as SEQ ID NO: 5, and the nucleotide sequence of SG2 is shown as SEQ ID NO: 6.

[0018] Preferably, in the method for obtaining soybeans with high oil content or / and heavy seed weight, GmTC1a-1 the expression of the gene is inhibited or inactivated.

[0019] Preferably, in the method for obtaining soybeans with high oil content or / and heavy seed weight, GmTC1a-1 the mutation type of the gene comprises a 460bp deletion downstream of the target site SG1 to cause a frameshift mutation, or a 4bp deletion downstream of the target site SG2 to cause a frameshift mutation.

[0020] Compared with the prior art, the present application has the following beneficial effects:

[0021] (1) The present application determines GmTC1a-1 the gene as a target gene for creating soybeans with high oil content or / and heavy seed weight, and targets soybeans GmTC1a-1The application discloses a CRISPR-Cas9 vector set, and provides a method for creating a soybean mutant with high oil content or / and heavy seed weight. GmTC1a-1 The application further provides a knockout vector of the gene. Figure 1 The application further provides an application of the vector of the gene in creating the soybean mutant.

[0022] (2) The application provides a material basis for subsequent research on soybean oil synthesis and creation of a new high-oil soybean material. BRIEF DESCRIPTION OF DRAWINGS

[0023] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or the prior art description. Obviously, the drawings in the following description are some embodiments of the application, and other drawings can be obtained by those skilled in the art without any creative effort on the basis of these drawings.

[0024] GmTC1a-1 For Figure 2 A schematic diagram of a gene editing vector construction.

[0025] Cas9 For T2 generation CRISPR / Cas9 gene editing plants Figure 3 A gene PCR detection diagram.

[0026] GmActin For T2 generation CRISPR / Cas9 gene editing plants Figure 4 A gene PCR detection diagram.

[0027] GmTC1a-1 For T2 generation CRISPR / Cas9 gene editing plants Figure 5 A gene PCR detection diagram.

[0028] Figure 6 A schematic diagram of a CRISPR / Cas9 gene editing target site.

[0029] Figure 7 A flow chart of soybean genetic transformation.

[0030] Figure 8 For T2 generation CRISPR / Cas9 gene editing plant mutation type analysis comparison results.

[0031] Figure 9 For CRISPR / Cas9 gene editing plant oil content column chart.

[0032] GmTC1a-1Bar graph of 100-seed weight for CRISPR / Cas9 gene edited plants. DETAILED DESCRIPTION

[0033] In order to facilitate the understanding of the present application, a more complete, detailed description of the present application will be given below in conjunction with the accompanying drawings and preferred embodiments. However, the scope of the protection of the present application is not limited to the following specific embodiments.

[0034] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. The technical terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present application.

[0035] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present application can be purchased from the market or can be prepared by existing methods.

[0036] Example 1 GmTC1a-1 Cloning and editing of genes

[0037] 1、 https: / / phytozome-next.jgi.doe.gov / Cloning of genes

[0038] Primer design: The gene sequence of OsSPL16 was downloaded from the Phytozome public database (http: / / phytozome.jgi.doe.gov / pz / portal.html) and the primers were designed as follows: GmTC1a-1 Glyma.06G066900 GmTC1a-1 F: 5'-ATGAAGCAAGCTTCTTCGGAG-3' (shown in SEQ ID NO: 1);

[0039] GmTC1a-1 F: 5'-ATGAAGCAAGCTTCTTCGGAG-3' (shown in SEQ ID NO: 1);

[0040] JCGmTC1a-1 F: 5'-ATGAAGCAAGCTTCTTCGGAG-3' (shown in SEQ ID NO: 1);

[0041] ​​PCR amplification: NOVA high-fidelity enzyme amplification system: 2x Phanta- Master Mix 25 μL; 18 μL ddH2O; 2.5 μL forward primer; 2.5 μL reverse primer; 2 μL cDNA template. PCR reaction conditions are as follows: 98°C pre-denaturation 5 min; 98°C 30 sec, 58°C 30 sec, 72°C 4 min, 30 cycles; 72°C extension 5 min. After DNA purification and recovery, the pEASY-Blunt T vector was sequenced. DNA purification product 4 μL; pEASY-Blunt T vector 1 μL, 24°C water bath 25 min. 5 μL of the ligation reaction system was added to the initial melting E. coli competent cells Trans1-T1, ice bath 5 min, 42°C water bath heat shock 1 min, put back on ice. Add 1 mL of pre-cooled LB liquid medium at 4°C, 37°C shaking culture for 1 h, and 200 μL of bacterial solution was inoculated on LB + Kan plate and cultured in 37°C incubator for 16 h. Single colonies were picked and colony PCR was performed. PCR system: 2x Rapid Taq Master Mix 7.5 μL; 5.5 μL ddH2O; forward primer (F: 5'-TCATTCAAGATCTCTCTGCCGACAG-3') and reverse primer (R: 5'-GCCGTGTGATTTCTTCTTGCTAGAG-3') each 0.5 μL. The reaction conditions for PCR amplification are as follows: 98°C pre-denaturation 5 min; 98°C 25 sec, 58°C 25 sec, 72°C 25 sec, 30 cycles; 72°C extension 5 min. Positive single colonies were picked out, 10 mL of LB + Kan liquid medium was cultured at 37°C for 16 h, and the bacterial solution sample was sequenced. 35s F: 5'-TCATTCAAGATCTCTCTGCCGACAG-3') and reverse primer (R: 5'-GCCGTGTGATTTCTTCTTGCTAGAG-3') each 0.5 μL. The reaction conditions for PCR amplification are as follows: 98°C pre-denaturation 5 min; 98°C 25 sec, 58°C 25 sec, 72°C 25 sec, 30 cycles; 72°C extension 5 min. Positive single colonies were picked out, 10 mL of LB + Kan liquid medium was cultured at 37°C for 16 h, and the bacterial solution sample was sequenced. GmTC1a-1 F: 5'-TCATTCAAGATCTCTCTGCCGACAG-3') and reverse primer (R: 5'-GCCGTGTGATTTCTTCTTGCTAGAG-3') each 0.5 μL. The reaction conditions for PCR amplification are as follows: 98°C pre-denaturation 5 min; 98°C 25 sec, 58°C 25 sec, 72°C 25 sec, 30 cycles; 72°C extension 5 min. Positive single colonies were picked out, 10 mL of LB + Kan liquid medium was cultured at 37°C for 16 h, and the bacterial solution sample was sequenced.

[0042] (1) GmTC1a-1 The nucleotide sequence is as follows: (5040 bp) SEQ ID NO: 3

[0043]

[0044] (2) GmTC1a-1 Amino acid sequence: (1680 aa) shown in SEQ ID NO: 4

[0045]

[0046] 2. sgRNA design and https: / / phytozome-next.jgi.doe.gov / Gene editing vector construction

[0047] Target site prediction: The gene sequence was downloaded in the Phytozome public database (https: / / phytozome.jgi.doe.gov / pz / portal.html#). The potential target sites of 19 nt + PAM (NGG) on the gene were predicted and analyzed by using the website (http: / / crispr.hzau.edu.cn / CRISPR2 / ), and the following were selected: GmTC1a-1 Glyma.06G066900 GmTC1a-1 GmTC1a-1

[0048] The nucleotide sequence of SG1 is shown as SEQ ID NO: 5 (TTTCCAAGTGAACTTCCCACTGG).

[0049] The nucleotide sequence of SG2 is shown as SEQ ID NO: 6 (ATGGGGCTGTGATTGCCGGGAGG).

[0050] Vector construction: the method for constructing a recombinant vector containing an sgRNA composition includes the method for constructing pCBSG015- GmTC1a-1 , and the specific steps include:

[0051] A. Gene synthesis contains a promoter GmTC1a-1 ​​​​

[0052] B. Linking 2 expression cassettes with pCBSG015 linearized by HindIII and Smal enzyme to get pCBSG015- Figure 1 Recombinant vector.

[0053] The vector used in the present application is pCBSG015 (Basta) provided by Genencor International Inc. The resistance in prokaryotes is kanamycin and in eukaryotes is glufosinate ammonium (Basta; PPT). The schematic diagram of vector construction is shown in GmTC1a-1 .

[0054] pCBSG015- EHA105 Recombinant vector was introduced into GmTC1a-1 Agrobacterium. 2 μL pCBSG015- EHA105 Recombinant vector was introduced into Figure 2 Agrobacterium. 2 μL pCBSG015-

[0055] Example 2: Genetic transformation of soybean

[0056] (1) Seed sterilization: Put the seeds into sterilized 100 mL triangular flask, add 75% alcohol, rinse twice. Add 25 mL 84 disinfectant, 75 mL sterilized water, 3 drops of Tween-20, soak for 15 min. After washing with sterilized water for three times, place the seeds with the navel facing down on the germination medium (GM) for light germination for 2 d (26°C, 18 h light / 6 h dark light cycle). The germination medium (GM) is 1 / 2MS salt ions + 20 g / L sucrose + 7 g / L agar, pH 5.8, autoclaved.

[0057] (2) Preparation of Agrobacterium liquid: pick positive single clone in 2 mL YEP medium containing antibiotics and shake culture (250 rpm, 28°C) until saturated growth (about 12 h). Take 0.2 mL saturated bacterial liquid and add to 250 mL YEP medium containing antibiotics for overnight culture to logarithmic growth phase (OD600=0.6-0.8).650 =0.3~0.6). Collect colonies by centrifugation, and resuspend the precipitate in liquid co-culture medium (CM) to OD. 650 The value was 0.6. YEP medium: 5 g / L NaCl + 5 g / L yeast extract + 10 g / L peptone + 15 g / L agar, autoclaved.

[0058] (3) Explant preparation: Pour 30 ml of Agrobacterium tumefaciens culture into a petri dish. Use a scalpel blade to make a longitudinal cut along the hilum to separate the cotyledons and remove the seed coat. The embryonic axis at the junction of the hypocotyl and cotyledons is removed to obtain semi-seed explants. Prepare 50 explants per Agrobacterium tumefaciens culture dish. Ensure that the entire explant is suspended in the culture solution. After immersion for 30 min, use sterilized forceps to transfer the explants to a solid co-culture medium, 15 explants per dish, placed horizontally. Seal the culture dishes with breathable tape and transfer them to an incubator (23℃) for dark incubation for 4 days.

[0059] Co-culture medium (CM): 1 / 2 MS salt ions + 3.9 g / L MES + 30 g / L sucrose + vitamin B5 + 153 mg / L LTT + 2 mg / L zeatin + 40 mg / L AS + 7 g / L agar, pH 5.4, autoclaved.

[0060] (4) Stem induction and selection: Explants were placed on SI medium without selection agent (15 explants per dish). The culture dishes were sealed with breathable tape and cultured under light for 7 days (26℃, 18h light / 6h dark light cycle). The elongated cotyledon hypocotyls were then removed, and the explant tissues were replaced with SI medium containing selection agent and cultured under light for 21 days (7 explants per dish).

[0061] Stem induction medium (SI): B5 salt ions + 0.98 g / L MES + 30 g / L sucrose + B5 vitamin + 150 mg / L cephalosporin + 450 mg / L temetidine + 1 mg / L 6-BA + 50 mg / L asparagine + 50 mg / L glutamine + 6 mg / L glufosinate + 7 g / L agar, pH 5.7, autoclaved.

[0062] (5) Stem elongation: Transfer differentiated explants to SE medium. Remove the cotyledons from the explants and make a fresh incision at the base of the developing node. Transfer the explants to fresh stem elongation (SE) medium and culture at 26°C for 6 weeks. Change the SE medium every 2 weeks. Make a fresh horizontal incision at the base of the explant each time the medium is changed.

[0063] Stem elongation (SE) medium: MS salt ions + 0.6 g / L MES + 30 g / L sucrose + B5 vitamins + 150 mg / L cefotaxime + 450 mg / L thidiazuron + 0.1 mg / L IAA + 0.5 mg / L GA + 1 mg / L zeatin + 50 mg / L asparagine + 50 mg / L glutamine + 6 mg / L phosphinothricin + 7 g / L agar, pH 5.7, autoclaved.

[0064] (6) Rooting: when the stems grow to 3 cm long, they are cut from the tissue, immersed in IBA (1 mg / ml) for 2 min, and then transferred to a glass bottle containing rooting medium (RM) for further culture. After 2 weeks, when the stems grow more than 2 roots, they are transplanted into soil for seedling raising. The seedlings are grown in light at 26°C for about 1 week, and the seedlings survive.

[0065] Rooting medium (RM): 1 / 2 MS salt ions + 0.6 g / L MES + 20 g / L sucrose + B5 vitamins + 3 mg / L phosphinothricin + 7 g / L agar, pH 5.7, autoclaved.

[0066] Example 3: Screening and identification of transgenic plants

[0067] The DNA of the resistant plants obtained by tissue culture is extracted, and the DNA is subjected to PCR amplification using the corresponding vector upstream and downstream primers. The reaction conditions for PCR amplification are as follows: 98°C pre-denaturation for 5 min; 98°C for 30 sec, 60°C for 30 sec, 72°C for 3 sec, 30 cycles; 72°C extension for 5 min. The plants with the target fragment size band amplified are transgenic plants. The positive detection method uses forward primer Cas9-detection F (5'-CCGACGAGTACAAGGTGCCCA-3') and reverse primer Cas9-detection R (5'-GGCGATCAGATTTTCCAGCC-3') for PCR amplification detection, and the electrophoresis detection result is shown in Figure 3 The transgenic plants with the target amplification product are inserted with T-DNA fragments, and the transgenic plants without the target product are not inserted with T-DNA fragments.

[0068] DNA was extracted from positive plants, and its quality was assessed by PCR using primers GmActin F (5'-CGGTGGTTCTATCTTGGCATC-3') / GmActin R (5'-GTCTTTCGCTTCAATAACCCTA-3'). The reaction mixture was as follows: template DNA 1 μL; 2×Rapid Taq Master Mix 7.5 μL; forward and reverse primers 0.5 μL each; ddH2O 5.5 μL. The PCR conditions were: 98℃ pre-denaturation for 5 min; 30 cycles of 98℃ for 30 sec, 56℃ for 30 sec, and 72℃ for 30 sec; extension at 72℃ for 5 min. The electrophoresis results of the PCR products are shown below. GmTC1a-1 As shown.

[0069] use Figure 4 The DNA was amplified by PCR using primers TC1a-1F (5'-CCAAATTGGGTTACCTCTTCAACAC-3') / TC1a-R (5'-TAAGTCGACAATCCCTATTGCCAAT-3') located 160 bp upstream of the gene target site. The PCR products were then sequenced for analysis. The optimal reaction system was as follows: 1 μL template DNA, 7.5 μL 2×Rapid Taq Master Mix, 0.5 μL each of forward and reverse primers, and 5.5 μL ddH2O; the reaction conditions were: 98℃ pre-denaturation for 5 min; 30 cycles of 98℃ for 30 sec, 58℃ for 30 sec, and 72℃ for 30 sec; extension at 72℃ for 5 min. The electrophoresis results of the PCR products are shown below. GmTC1a-1 As shown.

[0070] Example 4: Construction of CRISPR / Cas9 gene editing vector and soybean genetic transformation

[0071] cloned GmTC1a For the target gene, two segments located in Figure 5 Within the first exon of the gene, the 19nt+PAM(NGG) sequence with GC contents of 65% and 47% respectively is used as the target sequence. CRISPR / Cas9 gene editing target sites are as follows: 35S::GmTC1a-1 As shown. Following the CRISPR / Cas9 vector construction process and system, the CRISPR / Cas9 gene editing vector pCBSG015- was successfully constructed. EHA105 -Cas9, and transformed into Agrobacterium tumefaciens respectively. Figure 6 Positive monoclonal antibodies were selected for genetic transformation of Tianlong No. 1 soybean. The soybean genetic transformation process is as follows: Figure 7 As shown.

[0072] Example 5: Phenotypic and Functional Verification

[0073] Sequencing alignment analysis results are shown in Cas9 GmTC1a-1 Among the obtained 4 strains of T2 generation CRISPR / Cas9 gene editing plants without exogenous genes, the plants numbered TC1a-03, TC1a-04 and TC1a-07 were effectively edited, and were homozygous mutations. GmTC1a-1 In the plants TC1a-03 and TC1a-04, GmTC1a-1 The gene was deleted by 460bp (-460bp deletion), resulting in a frame shift mutation of the gene reading frame, and a stop codon "TGA" was encountered at the 81st base after the PAM site of the target sequence SG1, and translation was terminated; and in the plant TC1a-07, Figure 8 The gene was deleted by 4bp (-4bp deletion), and a stop codon "TGA" was encountered at the 73rd base after the PAM site of the target sequence SG2, and translation was terminated.

[0074] Seed oil content analysis of CRISPR / Cas9 gene editing material:

[0075] The seed oil content of the obtained CRISPR / Cas9 gene editing homozygous mutant plant was determined by near-infrared analyzer, and the results showed that the seed crude fat content of the gene editing materials TC1a-03, TC1a-04 and TC1a-07 was 25.32%, 25.41% and 23.91% respectively (P<0.05), which was significantly higher than that of the control (WT, Tianlong No. 1, crude fat content was 22.15%). Figure 8 GmTC1a-1 Therefore, the seed oil content of soybean was increased after the deletion of the FAD2-1A protein. Figure 9

[0076] Seed hundred seed weight analysis of CRISPR / Cas9 gene editing material: The seed hundred seed weight of the obtained CRISPR / Cas9 gene editing homozygous mutant was determined, and the results showed that the seed hundred seed weight of the gene editing materials TC1a-03, TC1a-04 and TC1a-07 was 23.2g, 22.8g and 21.3g respectively, which was significantly increased compared with the control (WT, Tianlong No. 1, hundred seed weight was 20.5g). GmTC1a-1 GmTC1a-1 Therefore, the seed hundred seed weight of soybean was also increased after the deletion of the FAD2-1A protein.

[0077] In soybean breeding, the mutation of the FAD2-1A gene can be detected in the later stage, and plants with high oil content or heavy seed weight can be screened for hybrid offspring breeding. ​ ​​​​​

Claims

1. By suppression or deletion GmTC1a-1 The application of protein in increasing soybean oil content and / or increasing soybean seed weight is characterized by, The GmTC1a-1 The amino acid sequence of the protein is shown in SEQ ID NO:

4.

2. By suppression or deletion GmTC1a-1 The application of protein-coding genes in increasing soybean oil content and / or increasing soybean seed weight is characterized by, The GmTC1a-1 The nucleotide sequence of the protein-coding gene is shown in SEQ ID NO:

3.

3. The application as described in claim 1 or 2, characterized in that, By inhibiting soybeans GmTC1a-1 Protein expression or activity can be used to screen for or create soybean varieties with high oil content or heavy seed weight.

4. The application as described in claim 3, characterized in that, The inhibition of soybeans GmTC1a-1 Methods for protein expression or activity include: knockout or mutation using gene editing technology. GmTC1a-1 Gene.

5. The application as described in claim 4, characterized in that, The gene editing technology mentioned is CRISPR / Cas9 technology. GmTC1a-1 The sgRNA target sequences of the gene include SG1 and SG2, the nucleotide sequence of SG1 is shown in SEQ ID NO: 5, and the nucleotide sequence of SG2 is shown in SEQ ID NO:

6.

6. A method for cultivating soybeans with high oil content and / or heavy seed weight, characterized in that, Includes the following steps: (1) Construction GmTC1a-1 CRISPR / Cas9 knockout vector; GmTC1a-1 The gene nucleotide sequence is shown in SEQ ID NO: 3; (2) The vector obtained in step (1) is introduced into Agrobacterium and then transferred into soybeans for genetic transformation. (3) Identify the soybeans obtained in step (2) to obtain soybeans with high oil content and / or high seed weight.

7. The method as described in claim 6, characterized in that, The GmTC1a-1 The gene CRISPR / Cas9 knockout vector contains pCBSG015 and two sgRNA expression cassettes SG1 and SG2; the nucleotide sequence of SG1 is shown in SEQ ID NO: 5; the nucleotide sequence of SG2 is shown in SEQ ID NO:

6.

8. The method as described in claim 6, characterized in that, To obtain soybeans with high oil content and / or high seed weight GmTC1a-1 Gene expression is suppressed or inactivated.

9. The method as described in claim 6, characterized in that, To obtain soybeans with high oil content and / or heavy seed weight GmTC1a- 1 The mutation types of the gene include: a frameshift mutation caused by a 460bp deletion downstream of the target site SG1; or a frameshift mutation caused by a 4bp deletion downstream of the target site SG2, wherein the nucleotide sequence of SG1 is shown in SEQ ID NO: 5 and the nucleotide sequence of SG2 is shown in SEQ ID NO: 6.

Images