Application of soybean GmSRO5 gene in promoting generation of leguminous plant root nodules
By overexpressing the GmSRO5 gene in soybeans and using Agrobacterium-mediated genetic transformation technology, the problem of insufficient number of soybean rhizombia was solved, and the soybean yield and nitrogen fixation capacity were improved, which has important application value.
Patent Information
- Application Number
- CN202510736355.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-04
- Publication Date
- 2025-07-04
- Estimated Expiration
- 2045-06-04
AI Technical Summary
The lack of effective means in the prior art to improve the number of soybean nodules and nitrogen fixation capabilities, resulting in insufficient nitrogen nutrition, affecting soybean yield and environmental pollution problems.
By identifying the soybean GmSRO5 gene and using Agrobacterium-mediated genetic transformation technology, overexpressing the GmSRO5 gene will increase the number of soybean rhizombas and enhance nitrogen fixation ability.
Significantly increasing the number of soybean nodules, improving soybean yield and nitrogen fixation capacity, reducing planting costs, and reducing environmental pollution, has important application value.
Smart Images

Figure CN120249373A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and specifically relates to the application of soybean GmSRO5 genes in promoting nodulation in leguminous plants. Background Art
[0002] Soybean is an important crop for both oil and grain, and is also an important industrial raw material and good roughage for livestock. Nitrogen is an essential macronutrient for plant growth and development, and is a constituent element of important components such as proteins, nucleic acids, and chlorophyll in organisms. The protein content of soybean is about 40%, and the nitrogen requirement is huge. Its nitrogen nutrition has three sources: soil nitrogen, fertilizer nitrogen, and nodule nitrogen fixation. Among them, nodule nitrogen fixation can provide 50-60% of the nitrogen for soybean plants (Hou Huiyun et al., 2022). Nodule nitrogen fixation can not only increase soybean yield, but also reduce planting costs and environmental pollution. Therefore, improving the nitrogen fixation ability of soybean itself has important production significance.
[0003] As a unique structure of leguminous plants, nodules can convert free nitrogen in the air into ammonium nitrogen and nitrate nitrogen, which can then be directly absorbed and utilized by organisms. The establishment of the soybean-rhizobium symbiotic nitrogen fixation system includes processes such as signal recognition, infection, formation of infection threads, formation of nodule primordia, and nodule maturation. First, soybean roots secrete flavonoid signal substances into the soil. After being recognized by rhizobia, nodulation factors are released, which stimulate the formation of infection threads inside root hairs and generate nodule primordia, and finally form mature nodules (Svistoonoff et al., 2014; Soyano et al., 2021).
[0004] Publicly disclosed literature includes that the soybean nucleoporin gene GmNup96 can regulate nodulation, and the mutation of the GmARF16 gene in soybean hairy roots can inhibit nodulation. As an application of nodule nitrogen fixation, there is an urgent need for the research and development of more types of technologies with more effective improvement effects.
[0005] SRO (Similar to radical-induced cell death) proteins are a class of small protein family transcription factors unique to plants and play important roles in processes such as plant resistance to biotic / abiotic stresses and growth and development. Existing studies have shown that rice OsSRO1c promotes stomatal closure and H2O2 accumulation through abscisic acid and jasmonic acid signaling pathways, thereby regulating drought and oxidative stresses in rice (You et al., 2013); maize ZmSRO1e promotes the elongation of maize mesocotyls by interacting with ZmbZIP61 (Qin et al., 2024); wheat TaSRO1 regulates redox homeostasis and maintains genomic stability, thereby regulating seedling vigor and tolerance to abiotic stresses (Liu et al., 2014). Analysis of the SRO family in Brassica napus found that BnaSRO1 and BnaSRO11 are potential major drought-responsive members and may be target genes of NACs involved in drought regulation (Jiang et al., 2024). However, there has been no report on the functional study of the SRO family in soybean. By performing a homology alignment with the SRO family gene sequences in Arabidopsis thaliana, we identified GmSRO5 genes and studied their functions in regulating nodulation in soybean. Summary of the Invention
[0006] To address the deficiencies of the prior art, the present invention provides the application of a soybean GmSRO5 gene in promoting nodulation in leguminous plants.
[0007] By performing a homology alignment with the SRO family gene sequences in Arabidopsis thaliana, we identified GmSRO5 a gene (Glyma.04G183100), and the CDS sequence of the soybean GmSRO5 gene is shown in SEQ ID NO.1. The amino acid sequence of the encoded protein is shown in SEQ ID NO.2.
[0008] During the process of identifying the function of the above soybean nodulin GmSRO5 gene, the present invention utilized an overexpression vector to rapidly obtain chimeric transgenic plants through Agrobacterium-mediated genetic transformation of soybean hairy roots, and successfully overexpressed the GmSRO5 gene. The results showed that overexpression of the GmSRO5 gene could increase the number of nodules in soybean. It can be seen that in specific practical applications, the genes of leguminous plants can be GmSRO5 overexpressed to increase the number of nodules, enhance nitrogen fixation ability, and thereby improve the yield and quality of leguminous plants. Preferably, the leguminous plant is soybean.
[0009] As the second aspect of the present invention, there is provided a plant breeding method, which can promote the formation of root nodules in leguminous plants, and can be method (1) or method (2): Method (1) is to obtain plants with more root nodules than the target plant by increasing the activity of protein GmSRO5 in the target plant; generally speaking, an increase in gene expression will promote an increase in the corresponding protein content. Therefore, it is speculated that increasing the protein content of GmSRO5 can also promote an increase in the number of root nodules.
[0010] Method (2) is to obtain plants with more root nodules than the target plant by promoting the expression of the GmSRO5 gene in the target plant.
[0011] Preferably, the target plant is soybean.
[0012] Preferably, the implementation method of promoting the expression of the GmSRO5 gene in method (2) is selected from the following methods: Method (1) is to introduce the GmSRO5 gene into the target plant; Method (2) is to introduce a strong promoter and / or enhancer; Method (3) includes other common methods in the art such as small RNA regulation, methylation / demethylation, phosphorylation / dephosphorylation, promoter binding site regulation, etc.
[0013] Furthermore, the said method (1) includes the following steps: Step 1. Construction of an overexpression vector of soybean GmSRO5 gene; It includes the extraction and reverse transcription of soybean root RNA, and PCR amplification is carried out using the reverse transcribed cDNA as a template to obtain the GmSRO5 full-length cDNA sequence, and construct an overexpression vector of GmSRO5 gene; Step 2. Genetic transformation of soybean hairy roots.
[0014] Preferably, in step 1, the overexpression vector pZP211 is used to prepare the GmSRO5 overexpression vector pZP211-35S- GmSRO5 , and the plasmid pZP211-35S- GmSRO5 is transferred into Agrobacterium rhizogenes for genetic transformation of soybean hairy roots.
[0015] Preferably, in step 2, the Agrobacterium containing the GmSRO5 overexpression plasmid infects the cotyledon node of leguminous plants. After hairy roots grow, the cotyledon node infection site and the following part of the leguminous plants are buried with vermiculite, watered thoroughly, and after cultivation, GmSRO5 gene overexpression plants are obtained.
[0016] More specifically, the present invention also provides a method for enhancing soybean nodulation, the method comprising the following steps: (1) Soybean GmSRO5 Construction of gene overexpression vector: Amplify the full-length cDNA sequence of GmSRO5 from soybean cDNA, and ligate it into vector pZP211 to construct the overexpression vector pZP211-35S- GmSRO5 ; (2) Genetic transformation of soybean hairy roots: Transfer the plasmid of the overexpression vector pZP211-35S- GmSRO5 into Agrobacterium rhizogenes for genetic transformation of soybean hairy roots; (3) Screening of positive soybean plants: Through PCR amplification, screen positive plants to obtain soybean plants with increased nodule numbers.
[0017] In the present invention, there is no particular limitation on the plants applicable to the present invention or the target plants, as long as they are suitable for gene transformation operations, such as various crop plants, flower plants, or forestry plants, etc. The plants mentioned above can be (but not limited to): dicotyledonous plants, monocotyledonous plants, or gymnosperms.
[0018] As a preferred embodiment, the "plant" includes but is not limited to leguminous plants, especially soybeans, and any plant having this gene or a homologous gene thereto is applicable.
[0019] The "plant" mentioned in the present invention includes the whole plant, its parental and progeny plants, and different parts of the plant, including seeds, fruits, buds, stems, leaves, roots (including tubers), flowers, tissues, and organs, and the target gene or nucleic acid is present in these different parts. The "plant" mentioned here also includes plant cells, suspension cultures, callus, embryos, meristematic regions, gametophytes, sporophytes, pollen, and microspores. Similarly, each of the aforementioned objects contains the target gene / nucleic acid.
[0020] The present invention includes any plant cell, or any plant obtained or obtainable by the methods therein, and all plant parts and their propagules. The present invention also encompasses transfected cells, tissues, organs, or whole plants obtained by any of the aforementioned methods. The only requirement is that the progeny exhibit the same genotype or phenotypic characteristics, and the progeny characteristics obtained using the methods in the present invention are the same.
[0021] The present invention also extends to the harvestable parts of the plants as described above, but not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers, and bulbs. It further relates to other derivatives after plant harvesting, such as dry granules or powders, oils, fats, and fatty acids, starches, or proteins. The present invention also relates to foods or food additives obtained from the relevant plants.
[0022] The beneficial effects of the present invention are as follows: (1) The present invention first proposes SRO5 which can positively regulate the nodulation process of soybeans, and proves that GmSRO5 Overexpression of the gene can significantly increase the number of nodules in soybean roots. In the future, it may be applied to soybean production and molecular breeding through means such as transgenic technology and molecular markers, and has very important application value.
[0023] (2) By using the breeding method provided by the present invention, the number of nodules in soybeans is significantly increased, which has important theoretical value and practical significance for cultivating high-quality and high-yield soybean germplasms, and has broad application prospects in plant molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] The accompanying drawings forming a part of this specification are used to provide a further understanding of the present invention. The schematic embodiments and descriptions thereof of the present invention are used to explain the present invention and do not constitute an improper limitation to the present invention.
[0025] Figure 1 For GmSRO5 the expression pattern of the gene in overexpressed soybean hairy roots.
[0026] Figure 2 is a comparison of the number of nodules in soybean roots between the empty vector (Control) and the overexpressed GmSRO5 gene lines; wherein, a and b respectively represent the number of nodules in soybean roots of the empty vector and the overexpressed GmSRO5 plants ( GmSRO5 OE -9 ); c is the statistical data of the number of nodules in soybean roots of the empty vector line and the overexpressed GmSRO5 line ( GmSRO5 OE ), repeated three times in total. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0027] It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention belongs.
[0028] If not specifically specified, the technical means used in the examples are conventional means well-known to those skilled in the art. The test methods in the following examples are all conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can be obtained from the market.
[0029] Unless otherwise defined, all professional and scientific terms used herein have the same meaning as those familiar to persons skilled in the art. In addition, any methods and materials similar or equivalent to those described may be applied to the present invention. The preferred methods and materials described herein are for illustrative purposes only.
[0030] Unless otherwise specified, the implementation of the present invention will use conventional botanical techniques, microorganisms, tissue culture, molecular biology, chemistry, biochemistry, DNA recombination, and bioinformatics techniques that are obvious to those skilled in the art. These techniques have been fully explained in the published literature. In addition, for the methods such as DNA extraction, phylogenetic tree construction, gene editing methods, construction of gene editing vectors, and obtaining gene editing plants used in the present invention, except for the methods used in the following examples, the methods disclosed in the existing literature can be used to achieve them.
[0031] The genes referred to herein may include introns and exons in the genomic sequence, and / or may include coding sequences in cDNA, and / or may include cDNA and its regulatory sequences. In a particular embodiment, for example, regarding the isolated nucleic acid sequence, it is preferably defaulted to be cDNA.
[0032] An "expression vector" refers to a vector that can express a target gene by adding expression elements (such as promoters, RBS, terminators, etc.) on the basis of the basic skeleton of a cloning vector.
[0033] The "Agrobacterium-mediated transformation method" refers to a technique in which a target gene is inserted into a modified T-DNA region, and the transfer and integration of foreign genes into plant cells are achieved by means of the infection of Agrobacterium, and then transgenic plants are regenerated through cell and tissue culture techniques.
[0034] Example 1 Soybean GmSRO5 Prediction of gene fragments A soybean GmSRO5 gene fragment (Glyma.04G183100) was obtained by means of bioinformatics. Its CDS sequence is shown in SEQ ID NO.1. The full-length coding frame nucleotide sequence of this gene is 954 bp in length and consists of 317 amino acids. Its protein sequence is shown in SEQ ID NO.2.
[0035] Example 2 Overexpression GmSRO5 The number of root nodules in transgenic soybean plants with overexpression increased I. Soybean GmSRO5 Construction of an overexpression vector for the (I) Extraction and reverse transcription of RNA from soybean roots 1. Total RNA was extracted using the TRIzol method (1)Weigh approximately 0.1 g of soybean W82 roots, quickly freeze them in liquid nitrogen and grind them into fine powder. Add 1 mL of TRIzol extraction solution, vortex for 2 min, and let it stand at room temperature for 5 min; (2)Centrifuge at 4 °C and 12000 rpm for 10 min to remove the precipitate; (3)Transfer the supernatant to a new centrifuge tube, add 200 μL of chloroform, vortex, and let it stand at room temperature for 3 min; (4)Centrifuge at 4 °C and 11000 rpm for 10 min; (5)Transfer the supernatant to a new centrifuge tube, add 600 μL of isopropanol, and let it stand at room temperature for 10 min; (6)Discard the supernatant, add 1 mL of 75% ethanol, resuspend, centrifuge at 4 °C and 11000 rpm for 5 min; Repeat once.
[0036] (7)Open the lid and dry at room temperature for 5 - 7 min, add 20 μL of DEPC-H2O to dissolve the precipitate, and store at -80 °C.
[0037] 2. Reverse transcription of cDNA (1)Use the kit provided by Vazyme to perform reverse transcription according to the instructions. Take the RNA product from the previous step as the template and perform the reaction in a 0.2 ml centrifuge tube, with a total of two steps. The genomic gDNA removal mixture system is shown in Table 1. First, prepare the genomic gDNA removal mixture system (Table 1). In the centrifuge tube, add 4 μL of 4×gDNA wiper Mix, 1 pg - 1 μg of RNA template, and add RNase free ddH2O to make up to 16 μL. Gently mix with a pipette, centrifuge, and react at 42 °C for 2 min on a PCR instrument: Table 1 Genomic gDNA removal mixture system
[0038] (2)Take out the reaction product from the previous step, add 4 μL of 5×HiScript Ⅲ qRT SuperMix to make up to 20 μL, gently mix with a pipette tip, place the microcentrifuge tube on the PCR instrument at 37 °C for 15 min; 85 °C for 5 s; The product is cDNA. After the reaction, take it out for use or store at -20 °C.
[0039] (II)Obtaining the full-length cDNA sequence Design specific primers GmSRO5 OX -F, GmSRO5 OX -R, The F and R primers respectively carry Bam HⅠ, XbaⅠ Restriction enzyme site. PCR amplification was carried out using the cDNA synthesized by reverse transcription as a template.
[0040] GmSRO5 OX -F: 5'- GGTACCCGAGGATCCATGGAACTAACATTCCCTCATC -3'; GmSRO5 OX -R: 5'- GTAGTCCATTCTAGAAAAAGAGAATCGACGTACCTTG -3'; Among them, the PCR amplification system is shown in Table 2.
[0041] PCR reaction program: pre-denaturation at 95 °C for 7 min; denaturation at 95 °C for 30 s, annealing at 56 °C for 1 min, extension at 72 °C for 1 min, 35 cycles; extension at 72 °C for 5 min.
[0042] Table 2 PCR amplification system
[0043] The PCR product was electrophoresed on a 1.5% agarose gel to obtain the full-length cDNA sequence of GmSRO5 with a length of 954 bp.
[0044] (III) GmSRO5 Construction of gene overexpression vector The target band was recovered using the Kangwei DNA recovery and purification kit, and then the purified DNA fragment was ligated into the vector pGEM-T (Promega), transformed E.coli into DH5ɑ competent cells, positive clones were selected for plasmid extraction, sequencing was completed by BGI, and a fragment with a length of 954 bp GmSRO5 was obtained, with the DNA sequence of SEQ ID NO.1 in the sequence listing. The above-mentioned purified cDNA fragment was double-digested ( Bam HⅠ, Xba Ⅰ) and ligated into the overexpression vector pZP211, and then heat-shock transformed E. coli into DH5α competent cells. Colony PCR was performed on the recombinants, and agarose gel electrophoresis was used for detection. The recombinants contained bands of the same size as the target fragment. After the identified recombinants were expanded in culture, plasmids were extracted. After plasmid sequencing and comparison with the original sequence, the ligated fragment was the full-length cDNA and there were no base mutations and deletions, proving GmSRO5 that the overexpression vector pZP211-35S- GmSRO5 was successfully constructed. pZP211-35S-GmSRO5 The plasmid and the pZP211 empty vector plasmid were respectively transferred into Agrobacterium rhizogenes K599 for the genetic transformation of soybean hairy roots.
[0045] II. Genetic Transformation of Soybean Hairy Roots (1) Soybean Williams 82 was planted in the mixed soil and germinated in the greenhouse. When the cotyledons were 6 days old and not fully unfolded, the cotyledon nodes were respectively infected with Agrobacterium containing the GmSRO5 overexpression plasmid and Agrobacterium containing the pZP211 empty vector plasmid by using a syringe.
[0046] (2) After the injection was completed, it was covered with a transparent cover to keep the inside moist. After hairy roots grew, the infected sites of the soybean cotyledon nodes and the parts below were buried with vermiculite and watered thoroughly.
[0047] (3) After 6 days, the transparent cover was removed, and the infected parts and the parts below were completely covered with moist vermiculite to maintain a moist environment, and watered once every 2 days. Cultured at 28 °C with 14 h light / 10 h darkness for about 2 weeks for nodulation phenotype analysis.
[0048] III. Positive Identification of Overexpression Transgenic Materials Take GmSRO5 a single root of the gene overexpression plant, extract genomic DNA, amplify it using the specific primers of the gene used for constructing the expression vector, and identify the PCR product by agarose gel electrophoresis. If a clear target band can be obtained, it is GmSRO5 an overexpression transgenic positive seedling, which can be used for phenotype analysis. GmSRO5
[0049] IV. GmSRO5 Detection of the Expression Pattern of the Gene in Soybean Overexpressing Hairy Roots The expression pattern of the gene in soybean overexpressing hairy roots was detected by qRT-PCR method. The roots of transgenic positive seedlings overexpressing the GmSRO5 gene and the empty vector were respectively taken, quickly frozen in liquid nitrogen and stored in a -80 °C refrigerator. Total RNA was extracted using the TRIzol method and reverse transcribed to obtain cDNA, and a fluorescence quantitative kit from TAKARA company was used for the reaction. The reaction was carried out on a quantitative PCR instrument (Applied Biosystems Stepone Plus), and the expression level of the gene was detected according to the relative quantification method. The reaction procedure was carried out according to the operation manual provided by TAKARA. The GmSRO5 soybean Actin gene was used as the internal reference in the reaction, and the primer sequences were: GmActin -F: 5'- CGGTGGTTCTATCTTGGCATC -3' GmActin -R: 5'- GTCTTTCGCTTCAATAACCCTA -3' GmSRO5 -F: 5'- CGCTTTCCAAGGTTTTGCCT -3' GmSRO5 -R: 5'- GAATCGACGTACCTTGTTGTCT -3' The reaction procedure is as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 56°C for 40 s, extension at 72°C for 40 s, with 35 cycles. After completion, the 2 -ΔΔCt method was used for calculation GmSRO5 of the gene expression level. This experiment was repeated three times. The results are as Figure 1 shown. The analysis results indicate that in the hairy roots overexpressing the GmSRO5 gene, the GmSRO5 expression level was significantly increased.
[0050] IV. Analysis of nodulation phenotypes of soybean plants (1) When the plants grew for 25 - 30 days (hairy root length was 5 - 10 cm), the main roots were cut off, and the composite plants were transplanted into small holes with a nutrient soil: vermiculite ratio of 1:1 for continued cultivation; (2) Three days later, 50 mL of Bradyrhizobium japonicum USDA110 (OD 600 = 0.08) was poured into each small hole, evenly around the root system, and treated once every week for a total of 3 weeks of pouring the bacteria.
[0051] (3) After 1 week of recovery, the soil on the surface of the hairy roots was washed clean, the number of root nodules was counted and photographed. The above experiment was repeated three times. As can be seen from Figure 2 it, Figure 2 a in Figure 2 and b in GmSRO5 OE - 9 respectively show the root system phenotype diagrams of the transformed empty vector and an overexpressing plant ( Figure 2 ). It can be seen from the figure that the number of root nodules of the overexpressing plant is significantly more than that of the empty vector plant. In addition, as shown in c in GmSRO5 , for multiple empty vector lines and overexpressing lines, the average number of root nodules of the hairy roots transformed with the empty vector (Control) was 13.05, while the average number of root nodules of the soybean hairy roots of the overexpressing GmSRO5 OE line ( GmSRO5 ) was 20.02. Compared with the empty vector, the average number of root nodules increased by 53.41%, reaching a highly significant level. It shows that overexpressing the GmSRO5 gene can significantly increase the number of soybean root nodules.
[0052] The present invention first proposes that SRO5 can positively regulate the nodulation process of soybeans, which has important theoretical value and practical significance for cultivating high-quality and high-yielding soybean germplasms and has broad application prospects in plant molecular breeding.
[0053] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention can have various changes and modifications. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.
Claims
1. Soybean GmSRO5 Application of a gene in promoting nodulation of leguminous plants, characterized in that The said GmSRO5 The CDS sequence of the gene is shown as SEQ ID NO.1, and the leguminous plant is soybean.
2. Application of an overexpression vector containing GmSRO5 gene in promoting nodulation of leguminous plants, characterized in that The GmSRO5 CDS sequence of the gene is shown in SEQ ID NO.1, and the leguminous plant is soybean.
3. The application according to claim 1 or 2, characterized in that, Promoting nodule formation is manifested as an increase in the number of soybean nodules.
4. The application according to claim 1, characterized in that, The soybean GmSRO5 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.
2.
5. A plant breeding method, characterized in that, The method is selected from method (1) or method (2): Method (1) is to obtain plants with more nodules than the target plant by increasing the activity of GmSRO5 protein in the target plant; Method (2) is to obtain a plant with more root nodules than the target plant by promoting the expression of the GmSRO5 gene in the target plant; The soybean GmSRO5 The CDS sequence of the gene is shown in SEQ ID NO.1, and the GmSRO5 amino acid sequence of the protein is shown in SEQ ID NO.2; The target plant is soybean.
6. The method according to claim 5, characterized in that, Method (2) promotes the realization of the expression of the GmSRO5 gene in the target plant, and the implementation methods are selected from the following method (1) or method (2): Method (1) is to GmSRO5 introduce the gene into the target plant; Method (2) is to introduce a strong promoter and / or enhancer.
7. A method for increasing soybean nodulation, characterized in that, The method includes the following steps: (1)Soybean GmSRO5 Construction of gene overexpression vector: Amplify the full-length cDNA sequence of the gene described in Claim 1 from soybean cDNA, and ligate it into the vector pZP211 to construct the overexpression vector pZP211-35S- GmSRO5 ; GmSRO5 ; (2)Genetic transformation of soybean hairy roots: Transfer the plasmid of the overexpression vector pZP211-35S- GmSRO5 into Agrobacterium rhizogenes for genetic transformation of soybean hairy roots; (3) Screening of soybean positive plants: After PCR amplification, positive plants are screened to obtain soybean plants with an increased number of nodules.
Citation Information
Patent Citations
Application of OsSRO1c gene in controlling rice drought resistance
CN102732526A
Methods for producing proteins in plants
CN106520520A
Application of leguminous plant Han homologous genes in regulating number of leguminous plant root nodules
CN110819635A
Application of soybean gene GmNPR1 in promoting generation of leguminous plant root nodules
CN115960947A
Application of soybean GmNOD19 gene in promoting generation of leguminous plant root nodules
CN117004644A
Cited By
Application of soybean GmPLAT5 gene in promoting generation of leguminous plant root nodules
CN122326655A
Application of soybean GmPLAT5 gene in promoting nodule production of leguminous plants
CN122326655B