Application method of citrus CML1 in enhancing canker resistance of oranges from late brocade

Abstract

The invention discloses an application method of citrus CML1 in enhancing canker resistance of oranges from late brocade, and relates to the technical field of molecular biology, VIGS is adopted to silently reduce the transcriptional level of CML1 genes in oranges from late brocade, and the nucleotide sequence of the citrus CML1 genes is shown as SEQ ID NO: 1. The VIGS vector of the citrus CML1 gene is transferred into citrus, so that the transcriptional level of the citrus CML1 is reduced, the canker resistance of the citrus can be remarkably improved, the canker attack degree is reduced, and the phenotype of a transgenic plant is not influenced. By constructing the VIGS vector of the citrus CML1 gene and performing agrobacterium tumefaciens-mediated transformation on citrus, the obtained citrus plant can show obvious resistance to the canker, the scab area is reduced by 65.53%, the disease index is reduced by 59.7%, and the attack degree of the canker is remarkably reduced.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and particularly relates to an application method of citrus CML1 in enhancing the resistance of late Jincheng oranges to citrus canker disease. Background Art

[0002] Citrus bacterial canker (CBC) is a bacterial disease caused by Xanthomonas citri subsp. citri (Xcc), which harms most of the current major citrus cultivars. Therefore, strengthening the research on the prevention and control of citrus bacterial canker is an urgent need for the development of the citrus industry.

[0003] Traditional prevention and control measures for citrus bacterial canker, such as burning diseased trees and using pesticides, require a large amount of manpower, material resources and financial resources, and will cause great environmental harm. Therefore, the prevention and control of citrus bacterial canker more hopes to cultivate new disease-resistant germplasms. Molecular breeding can cultivate new disease-resistant germplasms directionally and efficiently, so it has been developed rapidly and widely used at present. In recent years, some citrus resources resistant to citrus canker have been obtained through biotechnology means, such as Jincheng oranges, Xinhui oranges, and navel orange lines transfected with the antibacterial peptide D gene of Antheraea pernyi; late Jincheng orange lines overexpressing CsBZIP40; plants with improved resistance to citrus canker obtained by gene site-directed editing of the promoter of the citrus canker-susceptible gene CsLOB1, etc. However, high-quality candidate genes are still scarce, and the research on their functions and action mechanisms is not deep. Therefore, it is urgent to specifically explore more genes closely related to citrus bacterial canker, and deeply analyze their functions and mechanisms for molecular breeding of citrus canker resistance.

[0004] Ca 2+ As one of the important messengers for intracellular signal transduction, it plays a very crucial role in regulating plant stress responses. Calcium ions participate in the metabolic regulation of plants. Under stress conditions, the calcium ions in the plant cytoplasm will change specifically in time, space and concentration to generate calcium signals, and then the calcium signals are sensed and transduced by downstream calcium-binding proteins, and then a series of biochemical reactions are generated to adapt to or resist stress. Among them, calcium-binding proteins containing EF-Hand domains play a major role in plant calcium signal transduction events, including calmodulins (CaM), calmodulin-like proteins (CML), calcineurin B-like proteins (CBL), and calcium-dependent protein kinases (CDPK / CPK). CML participates in a variety of cellular functions, has no introns, contains four EF-Hand domains that bind Ca 2+ of2+ In addition to having an EF-Hand domain, the sensor CML does not have any other functional domains and thus does not possess any biochemical functions or enzymatic activities. However, multiple research data have shown that the dysregulation of the expression of a single CaM / CML gene or the loss of CML function can affect the defense response of plants against various pathogens. Therefore, it is speculated that CML may play an important role in the plant immune response. Although CML regulation has been partially applied in plant disease resistance, there is no relevant research report in the field of citrus canker disease. Summary of the Invention

[0005] The technical problem to be solved by the present invention is the insufficient resistance to citrus canker disease at present. The purpose is to provide a method for applying citrus CML1 in enhancing the resistance of late Jincheng oranges to canker disease. By transferring the VIGS vector of the citrus CML1 gene into citrus, reducing the transcriptional level of citrus CML1 can significantly improve the resistance of citrus to canker disease, reduce the incidence of canker disease, and does not affect the phenotype of transgenic plants.

[0006] The present invention is achieved through the following technical solutions:

[0007] The present application provides a method for applying citrus CML1 in enhancing the resistance of late Jincheng oranges to canker disease, using VIGS silencing to reduce the transcriptional level of the CML1 gene in late Jincheng oranges. The nucleotide sequence of the citrus CML1 gene is shown as SEQ ID NO: 1.

[0008] Further, it specifically includes the following steps:

[0009] (1) Clone the VIGS fragment of the citrus CML1 gene;

[0010] (2) Construct the expression vector of VIGS;

[0011] (3) Transform citrus with the VIGS expression vector to obtain VIGS plants in which the citrus CML1 gene is silenced.

[0012] Further, in step (1), the cloning method for cloning the VIGS fragment of the citrus CML1 gene is as follows: Extract the total RNA of citrus, reverse transcribe it into cDNA, and use high-fidelity enzyme PCR amplification with cDNA as a template to obtain the VIGS fragment of the citrus CML1 gene.

[0013] Further, the nucleotide sequence of the VIGS fragment of the citrus CML1 gene is shown as SEQ ID NO: 2.

[0014] Further, in step (1), when cloning the VIGS fragment of the citrus CML1 gene, the primers used for PCR amplification are CML1-VIGS-F and CML1-VIGS-R; the nucleotide sequence of primer CML1-VIGS-F is as shown in SEQ ID NO: 3, and the nucleotide sequence of primer CML1-VIGS-R is as shown in SEQ ID NO: 4.

[0015] Further, in step (2), the method for constructing the VIGS expression vector is as follows: The VIGS fragment of the citrus CML1 gene obtained in step (1) is digested with enzymes, recovered, and then ligated to the TRV2 vector digested with the same enzyme, and then transformed into Escherichia coli competent cells. The plasmid is extracted to obtain the VIGS expression vector of the CML1 gene.

[0016] Further, SacI and BamHI enzymes are used for digestion.

[0017] Further, in step (3), the method for transforming the VIGS expression vector into citrus is as follows: The VIGS expression vector obtained in step (2) is transformed into Agrobacterium, and an Agrobacterium liquid containing the VIGS expression vector is prepared to infect citrus sterile seedlings, obtaining VIGS plants with the citrus CML1 gene silenced.

[0018] Further, fluorescence observation, PCR or qRT-PCR is used to verify the VIGS plants with the citrus CML1 gene silenced.

[0019] Further, after obtaining the VIGS plants in step (3), the VIGS plants are evaluated for resistance to citrus canker, and it is determined that silencing of the citrus CML1 gene can enhance the resistance to citrus canker.

[0020] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0021] (1) By transferring the VIGS vector of the citrus CML1 gene into citrus, the present invention reduces the transcriptional level of citrus CML1, can significantly improve the resistance of citrus to canker, reduce the incidence of canker, and does not affect the phenotype of transgenic plants.

[0022] (2) By constructing the VIGS vector of the citrus CML1 gene and transforming citrus mediated by Agrobacterium, the obtained citrus plants can show obvious resistance to canker. The lesion area is reduced by 65.53%, and the disease index is reduced by 59.7%, significantly reducing the incidence of canker.

[0023] (3) The citrus CML1 gene in the present invention can also be used as a candidate gene to cooperate with multiple citrus canker resistant and susceptible genes in citrus canker resistance breeding by using techniques such as VIGS silencing, RNA interference, and gene editing, and has great application value in citrus canker resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the drawings required for use in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention, and thus should not be regarded as limiting the scope. For those of ordinary skill in the art, other related drawings can be obtained based on these drawings without creative efforts. In the drawings:

[0025] Figure 1 It is the bioinformatics feature diagram of citrus CML1 in the embodiment of the present invention: A: Chromosome localization of the citrus CML1 gene; B: Gene structure of citrus CML1; C: Conserved domain of citrus CML1;

[0026] Figure 2 It is the PCR amplification electrophoresis diagram of the VIGS fragment of the CML1 coding gene of the present invention: VIGS represents the RNAi fragment of the CML1 coding gene; M represents the DNA molecular weight standard;

[0027] Figure 3 It is the VIGS vector structure diagram of CML1 of the present invention: GFP: Green fluorescent protein; RdRp: NA-dependent RNA polymerase; CP: Coat protein; 35S: Plant constitutive promoter derived from cauliflower mosaic virus; NOS: Nopaline synthase gene terminator; LB: Left homology arm; RB: Right homology arm;

[0028] Figure 4 It is the PCR identification diagram of the transgenic plants of the present invention; the PCR detection diagram of the VIGS plants; +: Positive control; -: Negative control; M: Molecular weight standard; 1: VIGS plants of CML1; TRV1, TRV2: Detection result diagrams of the two vectors.

[0029] Figure 5 It is the qRT-PCR detection diagram of the expression of CML1 in the VIGS plants of the present invention; *: Significantly different (P = 0.05); TRV2: Plants with empty vector; TRV2-GSTF1: Plants transfected with the VIGS vector of CML1;

[0030] Figure 6 It is the phenotype diagram of the VIGS plants of the present invention: WT: Non-transgenic plants;

[0031] Figure 7This shows the disease incidence of the VIGS plants of the present invention 10 days after inoculation with the canker pathogen on the leaves;

[0032] Figure 8 This is a statistical chart of the lesion size of the VIGS plants of the present invention 10 days after inoculation with the canker pathogen on the leaves;

[0033] Figure 9 This is a statistical chart of the disease index of the VIGS plants of the present invention 10 days after inoculation with the canker pathogen on the leaves. Detailed implementation manners

[0034] To make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below with reference to the embodiments and the accompanying drawings. The illustrative embodiments and descriptions of the present invention are only used to explain the present invention and are not intended to limit the present invention.

[0035] In the following description, a large number of specific details are set forth in order to provide a thorough understanding of the present invention. However, it is obvious to those of ordinary skill in the art that: these specific details do not have to be adopted to implement the present invention. In other embodiments, well-known materials or methods are not specifically described in order to avoid obscuring the present invention.

[0036] Throughout the specification, the reference to "an embodiment", "embodiment", "an example" or "example" means that the specific features, structures or characteristics described in connection with that embodiment or example are included in at least one embodiment of the present invention. Thus, the phrases "an embodiment", "embodiment", "an example" or "example" appearing throughout the specification do not necessarily all refer to the same embodiment or example. In addition, the specific features, structures or characteristics can be combined in any appropriate combination and / or sub-combination in one or more embodiments or examples. The term "and / or" used herein includes any and all combinations of one or more of the related listed items. In addition, without contradiction, those skilled in the art can combine and combine the different embodiments or examples described in this specification and the features of different embodiments or examples.

[0037] If there is no special instruction, all steps of this application can be carried out in sequence or randomly, and preferably in sequence. For example, the method includes steps (a) and (b), which means that the method can include steps (a) and (b) carried out in sequence, or can also include steps (b) and (a) carried out in sequence. For example, it is mentioned that the method may further include step (c), which means that step (c) can be added to the method in any order. For example, the method can include steps (a), (b) and (c), or can also include steps (a), (c) and (b), or can also include steps (c), (a) and (b), etc.

[0038] Example 1

[0039] Bioinformatics Analysis of Citrus CML1

[0040] The Citrus CML1 gene is located between 31,269,916 bp and 31,270,527 bp on the Un chromosome of citrus, has no introns, contains 1 exon, encodes 203 amino acids, and contains an EF-HAND calcium-binding domain ( Figure 1 ).

[0041] The nucleotide sequence of the Citrus CML1 gene SEQ ID NO: 1 is:

[0042] ATGAAGTCTGAGGCCGCTACGGCCCATAGCCATGGAGGTAGAGGACAATCTTCTTTTGAAAGATTACGTAGAAAATTGTCATTCTCCCCAAAGACAAAGAAGGCAGACAACAAGGAGGGCTCTCTTTCACTTTCACTTGTCTTAAAGGACGAAACTGAAAGCAGCAGCGGGAGCGACGAGGAGCTTCAGAAGAAGGTGTTCAACTTCTTTGACGAGAACGGAGATGGAAGGATAACCGCAGCAGAGTTACAGAGCTGTTTAATGACGGTTGGCGGAGGCGGGGAACTCTCCATCTCCGTGGCTGATGCCGAAGCTGCCATTCAATCATCCGATTTAAACGGAGATGGGGTATTGGACTTCGATGAGTTTCTGAAGCTGATGGAGGGTAATCAGGAGGAGGAGGAGAAGAACTGCGAGCTCAGGGATGCTTTTGCGCTCTACGTCATGGATGGTTCCAATAGCATCACCCCGGCTAGTCTCAAGAGGATGCTTACCCGTCTGGGTCTCGGTGAGTCCAAGTCCATTGATGACTGTAAAGCTATGATCAGACCCTTTGATATCAACGGTGATGGCGTCCTCAGCTTTGAAGAGTTCTCTTTAATGATGCACTAA。

[0043] Example 2

[0044] Cloning of the VIGS Fragment of the Citrus CML1 Gene

[0045] 1. RNA Extraction and cDNA Synthesis

[0046] Total RNA from citrus (Wanjincheng) leaves was extracted using a plant total RNA extraction kit (Adlai, CAT: RN09), the RNA quality was verified by agarose gel electrophoresis, and its concentration was measured by a concentration meter. cDNA was synthesized using a reverse transcription kit PrimeScript RTMaster Mix (TaKaRa, CAT: RR036A), and the cDNA was stored at -20°C for future use.

[0047] 2.VIGS fragment amplification

[0048] The VIGS fragment of the CML1 encoding gene was cloned from citrus cDNA using primers CML1-VIGS-F (SEQ ID NO: 3) and CML1-VIGS-R (SEQ ID NO: 4) and the high-fidelity enzyme PrimeSTARMaxDNA Polymerase (TaKaRa, CAT: R045Q). The length of the fragment was 374 bp (SEQ ID NO: 2) ( Figure 2 ). Under ultraviolet light, use a clean blade to cut out the agarose gel block containing the target fragment, and use a kit (BioFlux, CAT: BSC02M1) to recover the DNA fragment.

[0049] PCR amplification program: 98°C, 5 min; 98°C, 30 s, 56°C, 30 s, 72°C, 1.5 min, 35 cycles; extension at 72°C for 10 min.

[0050] Among them, the nucleotide sequence of the VIGS fragment of the citrus CML1 gene, SEQ ID NO: 2, is:

[0051] GACAATCTTCTTTTGAAAGATTACGTAGAAAATTGTCATTCTCCCCAAAGACAAAGAAGGCAGACAACAAGGAGGGCTCTCTTTCACTTTCACTTGTCTTAAAGGACGAAACTGAAAGCAGCAGCGGGAGCGACGAGGAGCTTCAGAAGAAGGTGTTCAACTTCTTTGACGAGAACGGAGATGGAAG GATAACCGCAGCAGAGTTACAGAGCTGTTTAATGACGGTTGGCGGAGGCGGGGAACTCTCCATCTCCGTGGCTGATGCCGAAGCTGCCATTCAATCATCCGATTTAAACGGAGATGGGGTATTGGACTTCGATGAGTTTCTGAAGCTGATGGAGGGTAATCAGGAGGAGGAGGAGAAGAACTGCGAG.

[0052] The nucleotide sequence of primer CML1-VIGS-F SEQ ID NO: 3 (including restriction sites) is as follows:

[0053] TTCTGTGAGTAAGGTTACCGAATTCGACAATCTTCTTTTGAAAGATTACGTAGAAAA TTG.

[0054] The nucleotide sequence of primer CML1-VIGS-R SEQ ID NO: 4 (including restriction sites) is as follows:

[0055] GACGCGTGAGCTCGGTACCGGATCC CTCGCAGTTCTTCTCCTCCTC.

[0056] Example 3

[0057] Construction of VIGS vector

[0058] The VIGS vector TRV2 and the VIGS fragment of the CML1 gene were digested with SacI and BamHI, recovered by gel electrophoresis, and then the two fragments were ligated and transformed into competent Escherichia coli cells. The plasmid was extracted to obtain the VIGS expression vector TRV2-CML1 ( Figure 3 ). Among them, GFP: green fluorescent protein; RdRp: NA-dependent RNA polymerase; CP: coat protein; 35S: plant constitutive promoter derived from cauliflower mosaic virus; NOS: terminator of nopaline synthase gene; LB: left homology arm; RB: right homology arm. The vector TRV2-CML1 was transformed into Agrobacterium tumefaciens by electroporation to prepare an Agrobacterium tumefaciens solution containing the VIGS expression vector of the CML1 gene.

[0059] Example 4

[0060] Transformation of citrus with VIGS vector

[0061] 1. Activation of Agrobacterium tumefaciens

[0062] 500 μL of the Agrobacterium tumefaciens solutions of TRV1 and TRV2, and TRV2-GSTF1 were respectively added to 50 mL of liquid LB medium (containing kanamycin: concentration 50 mg / L), and cultured at 28 °C and 200 r / min until OD 600 = 1; the cells were collected and resuspended with MMA (10 mM MgCl2, 10 nM MES, 100 μM acetosyringone) solution, and the OD 600 was adjusted to 1; TRV1 was mixed with TRV2 and TRV2-GSTF1 vectors at a volume ratio of 1:1 and incubated at room temperature for 3 h.

[0063] 2. Agrobacterium-mediated infection

[0064] Immerse the sterile seedlings with radicle length of 3 cm into the Agrobacterium suspension, and vacuumize for 1 min with a vacuum pump; rinse with sterile water for 3 - 5 times, insert into the seed medium, and culture in the dark at room temperature for 2 - 3 d. Observe that if green fluorescence appears, it is a positive seedling, then transfer it to the soil for culture, and culture it under 16 h light / 8 h dark at 25℃, and water regularly.

[0065] Example 5

[0066] Identification and phenotypic observation of VIGS plants

[0067] 1. PCR identification

[0068] Positive seedlings showing green fluorescence under ultraviolet light were then transferred to the nutrient soil medium. One month later, tissues were collected to extract DNA and total RNA, and PCR verification was carried out using two pairs of primers CML1-ID1-F (SEQ ID NO: 5) / CML1-ID1-R (SEQ ID NO: 6), CML1-ID2-F (SEQ ID NO: 7) / CML1-ID2-R (SEQ ID NO: 8), and CML1-ID2-F (SEQ ID NO: 7) / CML1-VIGS-R (SEQ ID NO: 4): Primer pairs CML1-ID1-F / R and CML1-ID2-F / R can respectively amplify a 150 bp band in TRV2 and TRV2-CML1 plants; primer pair CML1-ID2-F / CML1-VIGS-R has no amplified band in TRV2 plants, but can amplify a 300 bp band in TRV2-CML1 plants. ( Figure 4 )。

[0069] PCR reaction conditions: 94℃, 3 min; 94℃, 30 s; 58℃, 30 s; 72℃, 30 s, for 30 cycles; 72℃, 10 min.

[0070] Among them, the nucleotide sequence of primer CML1-ID1-F, SEQ ID NO: 5 is:

[0071] TCGTTGAAGATGCCTCTGCCGACAG.

[0072] The nucleotide sequence of primer CML1-ID1-R, SEQ ID NO: 6 is:

[0073] CTAATTGCGTCTGCTAGCTGGTGG.

[0074] The nucleotide sequence of primer CML1-ID2-F, SEQ ID NO: 7 is:

[0075] TCGTTGAAGATGCCTCTGCCGACAG。

[0076] The nucleotide sequence of primer CML1-ID2-R, SEQ ID NO: 8, is:

[0077] TCGTTGAAGATGCCTCTGCCGACAG。

[0078] 2. qRT-PCR analysis

[0079] qRT-PCR was performed using primers CML1-RT-F (SEQ ID NO: 9) and CML1-RT-R (SEQ ID NO: 10) to verify whether CML1 was successfully silenced. The gene expression level of plants transformed with the empty vectors of TRV1 and TRV2 was set to 1. If the CML1 gene expression level of the plants containing the target fragment vector was less than 1, gene silencing occurred. After identification, the CML1 transcription level decreased by 94% ( Figure 5 ).

[0080] qRT-PCR reaction conditions: 95°C, 3 min; 94°C, 10 s; 56°C, 10 s; 72°C, 10 s; 40 cycles; 72°C, 10 min.

[0081] Among them, the nucleotide sequence of primer CML1-RT-F, SEQ ID NO: 9, is:

[0082] TTTTGCGCTCTACGTCATGG。

[0083] The nucleotide sequence of primer CML1-RT-R, SEQ ID NO: 10, is:

[0084] ACGCCATCACCGTTGATATC。

[0085] 3. Phenotypic observation

[0086] The phenotypes of VIGS plants of the CML1 gene were observed, and no obvious abnormalities were found in appearance and growth ([[]] Figure 6 ). It shows that the silencing of CML1 did not have an obvious impact on the phenotypes and development of the plants.

[0087] Example 6

[0088] Resistance evaluation of VIGS plants

[0089] The mature leaves of transgenic plants were washed, disinfected with 75% alcohol, and rinsed with sterile water, and then placed in a laminar flow hood; needles were inserted around the leaf veins, and the bacterial suspension of canker was spotted with a pipette, 1 μL of the suspension was spotted at each puncture hole (1X 10 5(CFU / mL); Cultivate in a constant temperature light incubator at 28°C (16 h light / 8 h dark); Take pictures 10 days after inoculating the leaves with bacteria, and use Image J V1.47 software to count the lesion area.

[0090] Classify the disease severity into grades 0 - 7 according to the lesion area. Represent the lesion area with the letter R. Grade 0 (R ≤ 0.25 mm 2 ), Grade 1 (0.25 mm 2 <R ≤ 0.5 mm 2 ), Grade 2 (0.5 mm 2 <R ≤ 0.75 mm 2 ), Grade 3 (0.75 mm 2 <R ≤ 1 mm 2 ), Grade 4 (1.0 mm 2 <R ≤ 1.25 mm 2 ), Grade 5 (1.25 mm 2 <R ≤ 1.5 mm 2 ), Grade 6 (1.5 mm 2 <R ≤ 1.75 mm 2 ), Grade 7 (R > 1.75 mm 2 ); Calculate the disease index according to the formula: DI = 100XΣ

Number of lesions at each grade X corresponding grade value

[0091] The results showed that 10 days after inoculating with the citrus canker pathogen, the symptoms of the VIGS plants of CML1 were significantly alleviated ( Figure 7 ); The lesion area decreased by 65.53% ( Figure 8 ); The disease index decreased by 59.7% ( Figure 9 ). Therefore, silencing of the CML1 gene can enhance the resistance of citrus to citrus canker.

[0092] In summary, in the present invention, by transferring the VIGS vector of the citrus CML1 gene into citrus, reducing the transcriptional level of citrus CML1, it can significantly improve the resistance of citrus to citrus canker, reduce the incidence of citrus canker, and does not affect the phenotype of transgenic plants. By constructing the VIGS vector of the citrus CML1 gene and transforming citrus mediated by Agrobacterium, the obtained citrus plants can show obvious resistance to citrus canker, the lesion area decreased by 65.53%, and the disease index decreased by 59.7%, significantly alleviating the incidence of citrus canker. The CML1 gene provided by the present invention can be silenced by various techniques and used for molecular breeding against citrus canker. It can also be used together with other disease-resistant or disease-susceptible genes for collaborative molecular breeding of citrus against citrus canker, and has great application value in citrus breeding against citrus canker.

[0093] The specific embodiments described above further elaborate on the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above description is only the specific embodiments of the present invention and is not used to limit the protection scope of the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A method for applying citrus CML1 in enhancing the resistance of late Jincheng oranges to citrus canker, characterized in that, Using VIGS silencing to reduce the transcriptional level of the CML1 gene in late Jincheng oranges, and the nucleotide sequence of the citrus CML1 gene is shown as SEQ ID NO:

1.

2. The application method of a citrus CML1 in enhancing the resistance of late Jincheng oranges to citrus canker according to claim 1, characterized in that Specifically, it includes the following steps: (1) Clone the VIGS fragment of the citrus CML1 gene; (2) Construct an expression vector of VIGS; (3) Transform the citrus with the VIGS expression vector to obtain VIGS plants in which the citrus CML1 gene is silenced.

3. The application method of a citrus CML1 according to claim 2 in enhancing the resistance of late Jincheng oranges to canker disease, characterized in that, In step (1), the cloning method for cloning the VIGS fragment of the citrus CML1 gene is: extract the total RNA of citrus, reverse transcribe it into cDNA, use the cDNA as a template, and amplify the VIGS fragment of the citrus CML1 gene by PCR with a high-fidelity enzyme.

4. The application method of a citrus CML1 in enhancing the resistance of late Jincheng oranges to canker according to claim 3, characterized in that, The nucleotide sequence of the VIGS fragment of the citrus CML1 gene is shown as SEQ ID NO:

2.

5. The application method of a citrus CML1 in enhancing the resistance of late Jincheng oranges to citrus canker according to claim 2, characterized in that, In step (1), when cloning the VIGS fragment of the citrus CML1 gene, the primers used for PCR amplification are CML1-VIGS-F and CML1-VIGS-R; the nucleotide sequence of primer CML1-VIGS-F is shown as SEQ ID NO: 3, and the nucleotide sequence of primer CML1-VIGS-R is shown as SEQ ID NO:

4.

6. The application method of a citrus CML1 in enhancing the resistance of late Jincheng oranges to citrus canker according to claim 2, characterized in that, In step (2), the construction method for constructing the VIGS expression vector is: digest the VIGS fragment of the citrus CML1 gene, which is the PCR product obtained in step (1), recover it, and then ligate it with the digested TRV2 vector and transform the competent cells of Escherichia coli. Extract the plasmid to obtain the VIGS expression vector of the CML1 gene.

7. The application method of a citrus CML1 in enhancing the resistance of late Jincheng oranges to citrus canker according to claim 6, characterized in that, Use SacI and BamHI enzymes for digestion.

8. The application method of a citrus CML1 in enhancing the resistance of late Jincheng oranges to citrus canker according to claim 2, characterized in that In step (3), the method for transforming the citrus with the VIGS expression vector is: transform the VIGS expression vector obtained in step (2) into Agrobacterium, prepare an Agrobacterium suspension containing the VIGS expression vector, and infect the sterile seedlings of citrus to obtain VIGS plants in which the citrus CML1 gene is silenced.

9. The application method of a citrus CML1 in enhancing the resistance of late Jincheng oranges to citrus canker according to claim 2, characterized in that Verify the VIGS plants in which the citrus CML1 gene is silenced by fluorescence observation, PCR or qRT-PCR.

10. The application method of a citrus CML1 in enhancing the resistance of late Jincheng oranges to citrus canker according to claim 2, characterized in that, After obtaining the VIGS plants in step (3), evaluate the resistance of the VIGS plants to citrus canker, and determine that the silencing of the citrus CML1 gene can enhance the resistance of citrus to citrus canker.

Images