Application of CsSAUR61 gene in enhancing canker resistance of citrus

Abstract

The invention discloses application of a CsSAUR61 gene in enhancing canker resistance of citrus, and relates to the technical field of agricultural biological genes. According to the application method, VIGS is adopted to silently reduce the transcriptional level of the CsSAUR61 gene in the citrus, and the nucleotide sequence of the citrus CsSAUR61 gene is shown as SEQ ID NO.1. The application method specifically comprises the steps that a VIGS segment of the citrus CsSAUR61 gene is cloned, a VIGS expression vector is constructed, the citrus is transformed through the VIGS expression vector, and a VIGS plant with the citrus CsSAUR61 gene silenced is obtained; the VIGS expression vector of the citrus CsSAUR61 gene is transferred into citrus, the transcriptional level of citrus CsSAUR61 is reduced, the canker resistance of citrus can be remarkably improved, the canker attack degree is reduced, and the phenotype of a transgenic plant is not affected.

Description

Technical Field

[0001] The present invention relates to the field of agricultural biological gene technology, and specifically relates to the application of the CsSAUR61 gene in enhancing the resistance of citrus to citrus canker disease. Background Art

[0002] Citrus bacterial canker (CBC) is a bacterial disease caused by Xanthomonas citri subsp. Citri (Xcc), which harms most of the current major citrus cultivars. Therefore, strengthening the research on the prevention and control of citrus bacterial canker is an urgent need for the development of the citrus industry.

[0003] Traditional prevention and control measures for citrus bacterial canker, such as burning diseased trees and using pesticides, require a large amount of manpower and material resources and cause great environmental harm. Therefore, more hope is placed on cultivating new disease-resistant germplasms for citrus bacterial canker. Molecular breeding has been rapidly developed and widely applied because it can cultivate new disease-resistant germplasms directionally and efficiently. In recent years, some citrus resources resistant to citrus canker have been obtained through biotechnological means, such as Jincheng oranges, Xinhui oranges, and navel orange strains transformed with the antibacterial peptide D gene of Antheraea pernyi; late Jincheng orange strains overexpressing CsBZIP40; plants with improved resistance to citrus bacterial canker obtained by gene-editing the promoter of the citrus canker-susceptible gene CsLOB1. However, high-quality candidate genes are still scarce, and the research on their functions and action mechanisms is not deep. Therefore, it is urgent to specifically explore more genes closely related to citrus bacterial canker, deeply analyze their functions and mechanisms, and apply them to molecular breeding for citrus canker resistance.

[0004] Auxin is one of the earliest discovered plant hormones, and indole-3-acetic acid (IAA) is the most important active form. It plays a key role in many processes of plant growth and development, such as cell division, elongation and differentiation, vascular tissue formation, adventitious root formation, tropic responses, apical dominance, and the development of flowers and fruits (Cao et al., 2023; Wang et al., 2025). Auxin can induce the rapid and efficient expression of a class of genes, which are called auxin early response genes (AERGs), including the Auxin / indole-3-acetic acid (Aux / IAA) gene family, the Gretchen Hagen3 (GH3) gene family, and the Small auxin-up RNA (SAUR) gene family (Bao et al., 2024).

[0005] Among them, the SAUR gene family is a class of small molecular weight early auxin response genes, which usually lack introns or contain only one intron. This structural feature enables it to respond quickly to auxin signals and complete transcription, and also gives SAUR genes an evolutionary specific advantage (Chen et al., 2014). The proteins they encode are usually small, generally around 100 amino acids (Ren & Gray, 2015), and the half-life of both transcripts and proteins is very short, indicating that SAUR activity decreases rapidly after auxin removal (Hagen & Guilfoyle., 2002). SAUR genes act as output effectors, mediating auxin responses at the cellular level, such as cell expansion (Stortenbeker & Bemer, 2019). SAUR proteins contain two conserved leucine residues in most higher plants, indicating that these residues perform important functions. The sequence similarity between members of the SAUR gene family is low, but they all have some common structural features, such as the conserved region at the N-terminus and the variable region at the C-terminus. The conserved region at the N-terminus may be related to the function and localization of the protein, while the variable region at the C-terminus may determine the specific function of different SAUR proteins (Ma et al., 2023). The mechanism by which the SAUR gene family participates in plant disease resistance may be multifaceted. On the one hand, SAUR genes can affect plant stress resistance by regulating plant growth and development (Wen et al., 2020). On the other hand, SAUR genes may be directly involved in regulating plant defense responses. In addition, SAUR genes may also affect plant stress resistance by regulating hormone balance in plants, such as regulating the synthesis and signal transduction of hormones such as auxin, salicylic acid, and jasmonic acid (He et al., 2021). For example, in tomatoes, SlSAUR50 enhances the resistance of tomatoes to Botrytis cinerea, and also enhances the ability of tomatoes to clear ROS after infection with Botrytis cinerea (Mo et al., 2025).

[0006] Although SAUR genes have been partially applied in plant disease resistance, there have been no related research reports in the field of citrus canker. In view of this, this application is specially proposed. Summary of the invention

[0007] The present invention aims to expand the application of SAUR genes in plant disease resistance and fill the gap in the field of SAUR genes in citrus canker. The purpose is to provide an application of CsSAUR61 gene in enhancing the resistance of citrus to canker. By transferring the VIGS expression vector of the citrus CsSAUR61 gene into citrus and reducing the transcription level of citrus CsSAUR61, the resistance of citrus to canker can be significantly improved, the incidence of canker can be reduced, and the phenotype of transgenic plants will not be affected.

[0008] The present invention is achieved through the following technical solutions:

[0009] The present invention provides an application of the CsSAUR61 gene in enhancing the resistance of citrus to citrus canker. The application method is to use VIGS silencing to reduce the transcriptional level of the CsSAUR61 gene in citrus. The nucleotide sequence of the citrus CsSAUR61 gene is shown in SEQ ID NO.1.

[0010] Furthermore, the application method specifically includes the following steps:

[0011] (1) Clone the VIGS fragment of the citrus CsSAUR61 gene;

[0012] (2) Construct a VIGS expression vector;

[0013] (3) Transform the citrus with the VIGS expression vector to obtain VIGS plants in which the CsSAUR61 gene of citrus is silenced.

[0014] Furthermore, the nucleotide sequence of the VIGS fragment is shown in SEQ ID NO.2.

[0015] Furthermore, in step (1), the cloning method of the VIGS fragment of the citrus CsSAUR61 gene is:

[0016] Extract the total RNA of citrus, reverse transcribe it into cDNA, and use high-fidelity enzyme PCR amplification with the cDNA as a template to obtain the VIGS fragment of the citrus CsSAUR61 gene.

[0017] Furthermore, in step (1), the primers used for PCR amplification are CsSAUR61-VIGS-F and CsSAUR61-VIGS-R, and their nucleotide sequences are SEQ ID NO.3 and SEQ ID NO.4 respectively.

[0018] Furthermore, in step (2), the construction method of the VIGS gene fragment expression vector is:

[0019] Digest the VIGS fragment obtained in step (1) with BamH I and Sma I, recover it, connect it with the TRV2 vector digested with the same enzymes, and transform the competent cells of Escherichia coli. Extract the plasmid to obtain the VIGS expression vector of the CsSAUR61 gene.

[0020] Furthermore, in step (3), the method for transforming the citrus with the VIGS expression vector is:

[0021] The VIGS expression vector obtained in step (2) was transformed into Agrobacterium to prepare an Agrobacterium liquid containing the VIGS expression vector, which was used to infect citrus sterile seedlings. After verification by fluorescence observation, PCR, and qRT-PCR, VIGS plants with silenced citrus CsSAUR61 gene were obtained.

[0022] Further, three pairs of primers were used for PCR identification, namely TRV1-F / TRV1-R, TRV2-F / TRV2-R, and TRV2-F / CsSAUR61-VIGS-R. Among them, the nucleotide sequence of TRV1-F is SEQ ID NO.5, the nucleotide sequence of TRV1-R is SEQ ID NO.6, the nucleotide sequence of TRV2-F is SEQ ID NO.7, and the nucleotide sequence of TRV2-R is SEQ ID NO.8.

[0023] Further, the primers used for qRT-PCR analysis were CsSAUR61-RT-F and CsSAUR61-RT-R, and their nucleotide sequences are shown as SEQ ID NO.9 and SEQ ID NO.10 respectively.

[0024] Further, after obtaining the VIGS plants in step (3), the resistance of the VIGS plants to citrus canker was evaluated, and it was determined that silencing of the citrus CsSAUR61 gene could enhance the resistance to citrus canker.

[0025] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0026] 1. A citrus CsSAUR61 gene provided by the present invention and its application in enhancing the resistance of citrus to canker. By constructing a VIGS expression vector of the citrus CsSAUR61 gene and transforming it into citrus mediated by Agrobacterium, the obtained citrus plants can show obvious resistance to canker. The maximum area of the disease spots can be reduced to 68.7% of that of the control plants, and the disease index can be reduced to 79.8% of that of the control plants at most, significantly reducing the incidence degree of canker.

[0027] 2. By silencing the VIGS of the citrus CsSAUR61 gene in the present invention, VIGS plants with silenced citrus CsSAUR61 gene were obtained, which can be used for molecular breeding for canker resistance, or can be used together with other disease-resistant or disease-susceptible genes to synergistically carry out molecular breeding for citrus canker resistance, and has great application value in citrus canker resistance breeding. Moreover, silencing of the citrus CsSAUR61 gene by VIGS does not affect the phenotype of citrus plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] To more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the following will briefly introduce the drawings required for the embodiments. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as limiting the scope. For those of ordinary skill in the art, without creative efforts, other related drawings can also be obtained based on these drawings. In the drawings:

[0029] Figure 1 It is a bioinformatics feature diagram of citrus CsSAUR61 in the embodiments of the present invention; wherein, A represents the chromosomal localization of the citrus CsSAUR61 gene; B represents the gene structure of citrus CsSAUR61; C represents the conserved domain of citrus CsSAUR61; D represents the functional domain of CsSAUR61; E represents the secondary structure of CsSAUR61;

[0030] Figure 2 It is a PCR amplification electrophoresis diagram of the VIGS fragment of the CsSAUR61 coding gene of the present invention; wherein, VIGS represents the RNAi fragment of the CsSAUR61 coding gene; M represents the DNA molecular weight standard;

[0031] Figure 3 It is a VIGS vector structure diagram of the present invention; wherein, GFP represents green fluorescent protein; RdRp represents NA-dependent RNA polymerase; CP represents coat protein; 35S represents a plant constitutive promoter derived from cauliflower mosaic virus; NOS represents the terminator of the nopaline synthase gene; LB represents the left homologous arm; RB represents the right homologous arm;

[0032] Figure 4 It is a PCR detection diagram of the VIGS plants of the present invention; wherein, + represents the positive control; - represents the negative control; M represents the molecular weight standard; TRV2 represents the plants of the empty vector; TRV2-CsSAUR61-1 / 2 / 3 / 4 / 5 represents 5 VIGS plants;

[0033] Figure 5 It is a qRT-PCR detection diagram of the expression of CsSAUR61 in the VIGS plants of the present invention; wherein, "*" represents a significant difference, P<0.05; "**" represents a highly significant difference, P<0.01; "***" represents a highly significant difference, P<0.001; TRV2 represents the plants of the empty vector; TRV2-SAUR61-1 / 2 / 3 / 4 / 5 represents 5 VIGS plants;

[0034] Figure 6 It is a phenotypic diagram of the VIGS plants of the present invention; wherein, TRV2 represents the plants of the empty vector; TRV2-SAUR61-1 / 2 / 3 / 4 / 5 represents 5 VIGS plants;

[0035] Figure 7 This shows the disease incidence of the leaves of the VIGS plants of the present invention 10 days after inoculation with Xanthomonas citri subsp. citri. Among them, TRV2 represents the plants with the empty vector; TRV2-SAUR61-1 / 2 / 3 / 4 / 5 represents 5 VIGS plants.

[0036] Figure 8 This is a statistical chart of the lesion size of the leaves of the VIGS plants of the present invention 10 days after inoculation with Xanthomonas citri subsp. citri. Among them, TRV2 represents the plants with the empty vector; TRV2-SAUR61-1 / 2 / 3 / 4 / 5 represents 5 VIGS plants.

[0037] Figure 9 This is a statistical chart of the disease index of the leaves of the VIGS plants of the present invention 10 days after inoculation with Xanthomonas citri subsp. citri. Among them, TRV2 represents the plants with the empty vector; TRV2-SAUR61-1 / 2 / 3 / 4 / 5 represents 5 VIGS plants. Detailed implementation manners

[0038] To make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments and the accompanying drawings. Obviously, the illustrative embodiments and their descriptions of the present invention are only used to explain the present invention and do not serve as a limitation to the present invention.

[0039] The following will appropriately refer to the accompanying drawings to detail the implementation manners of the application of a CsSAUR61 gene in enhancing the resistance of citrus to citrus canker of the present invention. However, there will be cases where unnecessary detailed descriptions are omitted. For example, there are cases where the detailed descriptions of well-known matters and repeated descriptions are omitted. This is to avoid the following description from becoming unnecessarily lengthy and to facilitate the understanding of those skilled in the art.

[0040] The following further details the technical solutions of the present invention in conjunction with the embodiments.

[0041] It should be noted that the embodiments of the present invention use late Jincheng oranges as the test objects. In practical applications, this method can also be used to improve the resistance improvement of other citrus varieties to citrus canker. The experimental methods used in the embodiments are all conventional methods unless otherwise specified. The materials, reagents, methods and instruments used, unless otherwise specified, are all conventional materials, reagents, methods and instruments in this field, and those skilled in the art can obtain them through commercial channels.

[0042] Example 1

[0043] Bioinformatics analysis of citrus CsSAUR61

[0044] The citrus CsSAUR61 gene is located between 32150955bp and 32151565bp on chromosome 8 of citrus. It contains 1 exon, encodes 444 amino acids, and contains Auxin-inducible functional domains at the N-terminus and C-terminus respectively. The secondary structure prediction shows that the protein secondary structure is composed of α-helix (61 amino acids, accounting for 41.50%), extended chain (18 amino acids, accounting for 12.24%) and random coil (68 amino acids, accounting for 46.26%). Figure 1 ), the nucleotide sequence of the citrus CsSAUR61 gene is shown in SEQ ID NO.1.

[0045] Example 2

[0046] VIGS fragment cloning

[0047] 1. RNA Extraction and cDNA Synthesis

[0048] Total RNA from citrus (Wanjincheng) leaves was extracted using a plant total RNA extraction kit (Adlai, CAT: RN09), the RNA quality was verified by agarose gel electrophoresis, and its concentration was measured by a concentration meter. cDNA was synthesized using a reverse transcription kit PrimeScript RTMaster Mix (TaKaRa, CAT: RR036A), and the cDNA was stored at -20°C for future use.

[0049] 2.VIGS fragment amplification

[0050] The VIGS fragment of the CsSAUR61 encoding gene was cloned from citrus cDNA using primers CsSAUR61-VIGS-F (SEQ ID NO.3) and CsSAUR61-VIGS-R (SEQ ID NO.4) and high-fidelity enzyme PrimeSTARMaxDNAPolymerase (TaKaRa, CAT: R045Q). The length of the fragment was 304 bp (SEQ ID NO.2) ( Figure 2 ). Under ultraviolet light, use a clean blade to cut out the agarose gel block containing the target fragment, and use a kit (BioFlux, CAT: BSC02M1) to recover the DNA fragment.

[0051] The PCR amplification program was as follows: 98°C, 5 min; 98°C, 30 s, 56°C, 30 s, 72°C, 1.5 min, 35 cycles; and extension at 72°C for 10 min.

[0052] Example 3

[0053] VIGS expression vector construction

[0054] The VIGS vector TRV2 and the VIGS fragment of the CsSAUR61 gene were digested with BamH I and Sma I, recovered by gel electrophoresis, and then the two fragments were ligated and transformed into competent Escherichia coli cells. The plasmid was extracted to obtain the VIGS expression vector TRV2-CsSAUR61( Figure 3 ). Among them, GFP: green fluorescent protein; RdRp: NA-dependent RNA polymerase; CP: coat protein; 35S: plant constitutive promoter derived from cauliflower mosaic virus; NOS: terminator of the nopaline synthase gene; LB: left homologous arm; RB: right homologous arm. The vector TRV2-CsSAUR61 was transformed into Agrobacterium tumefaciens by electroporation to prepare an Agrobacterium tumefaciens solution containing the VIGS expression vector of the CsSAUR61 gene.

[0055] Example 4

[0056] Transformation of citrus with the VIGS expression vector

[0057] 1. Activation of Agrobacterium tumefaciens

[0058] 500 μL of the Agrobacterium tumefaciens solutions of TRV1 and TRV2, and TRV2-SAUR61 were respectively added to 50 mL of liquid LB medium (containing kanamycin) and cultured at 28 °C and 200 r / min until OD600 = 1; the cells were collected and resuspended with MMA (10 mM MgCl2, 10 nM MES, 100 μM acetosyringone) liquid to adjust OD600 = 1; TRV1 was mixed with TRV2 and TRV2-SAUR61 vectors at a volume ratio of 1:1 and incubated at room temperature for 3 h.

[0059] 2. Agrobacterium tumefaciens infection

[0060] Sterile seedlings with a radicle length of 3 cm were immersed in the Agrobacterium tumefaciens solution, and vacuum was pumped for 1 min with a vacuum pump; rinsed 3 - 5 times with sterile water, inserted into the seed medium and cultured at room temperature in the dark for 2 - 3 d. If green fluorescence was emitted, it was a positive seedling, which was transferred to the soil for cultivation and cultured at 25 °C with a light / dark cycle of 16 h / 8 h, and watered regularly.

[0061] Example 5

[0062] Identification and phenotypic observation of VIGS plants

[0063] 1. PCR identification

[0064] Positive seedlings showed green fluorescence under ultraviolet light and were then transferred to nutrient soil medium. One month later, tissues were collected to extract DNA and total RNA, and three pairs of primers, TRV1-F (SEQ ID NO.5) / TRV1-R (SEQ ID NO.6), TRV2-F (SEQ ID NO.7) / TRV2-R (SEQ ID NO.8), and TRV2-F (SEQ ID NO.7) / CsSAUR61-VIGS-R (SEQ ID NO.4), were used for PCR verification: The primer pair TRV1-F / R could amplify a 150-bp band in TRV2 and TRV2-CsSAUR61 plants; TRV2-F / R could amplify 255-bp and 559-bp bands in TRV2 and TRV2-CsSAUR61 plants, respectively; the primer pair TRV2-F / CsSAUR61-VIGS-R had no amplified band in TRV2 plants but amplified a 571-bp band in TRV2-CsSAUR61 plants( Figure 4 ). It indicated that VIGS-CsSAUR61 had been successfully integrated into the genome.

[0065] The PCR reaction conditions were: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, for 34 cycles; 72°C for 3 min.

[0066] 2. qRT-PCR analysis

[0067] qRT-PCR was performed using the primers CsSAUR61-RT-F (SEQ ID NO.9) and CsSAUR61-RT-R (SEQ ID NO.10) to verify whether CsSAUR61 was successfully silenced. The gene expression levels of plants transformed with TRV1 and TRV2 empty vectors were set to 1. If the CsSAUR61 gene expression level of plants containing the target fragment vector was less than 1, gene silencing occurred. After identification, the CsSAUR61 transcription level decreased by 38% - 64%( Figure 5 ).

[0068] The qRT-PCR reaction conditions were: 95°C for 3 min, 94°C for 10 s; 56°C for 10 s, 72°C for 10 s, for 40 cycles; 72°C for 10 min.

[0069] 3. Phenotype observation

[0070] The phenotypes of VIGS plants of the CsSAUR61 gene were observed, and no obvious abnormalities were found in appearance and growth( Figure 6 ). It indicated that the silencing of CsSAUR61 had no obvious effect on the phenotypes and development of plants.

[0071] Example 6

[0072] Resistance evaluation of VIGS plants

[0073] After washing the mature leaves of transgenic plants, disinfect them with 75% alcohol and rinse with sterile water, then place them in a laminar flow hood; prick the leaves with the veins as the center, and use a pipette to spot the bacterial suspension of citrus canker pathogen, with 1 μL (1×10 5 CFU / mL) spotted at each puncture hole; culture in a constant temperature light incubator at 28 °C (16 h light / 8 h dark); take pictures 10 days after inoculating the bacteria on the leaves, and use Image J V1.47 software to calculate the lesion area.

[0074] Classify the disease severity into levels 0 - 7 according to the lesion area. Let R represent the lesion area. Level 0 (R ≤ 0.25 mm 2 ), Level 1 (0.25 mm 2 <R ≤ 0.5 mm 2 ), Level 2 (0.5 mm 2 <R ≤ 0.75 mm 2 ), Level 3 (0.75 mm 2 <R ≤ 1 mm 2 ), Level 4 (1.0 mm 2 <R ≤ 1.25 mm 2 ), Level 5 (1.25 mm 2 <R ≤ 1.5 mm 2 ), Level 6 (1.5 mm 2 <R ≤ 1.75 mm 2 ), Level 7 (R > 1.75 mm 2 ); Calculate the disease index according to the formula: DI = 100 × Σ (number of lesions at each level × corresponding level value) / (total number of lesions × maximum level).

[0075] The results are as Figures 7 - 9 shown:

[0076] Figure 7 It shows that 10 days after inoculating with citrus canker pathogen, the symptoms of VIGS plants of CsSAUR61 were significantly alleviated;

[0077] Figure 8 It shows that 10 days after inoculating with citrus canker pathogen, the lesion area of VIGS plants of CsSAUR61 decreased by 19.9% - 31.3%;

[0078] Figure 9 It shows that 10 days after inoculating with citrus canker pathogen, the disease index of VIGS plants of CsSAUR61 decreased by 8.4% - 20.2%.

[0079] Therefore, silencing of the CsSAUR61 gene can enhance the resistance to citrus canker.

[0080] In summary, the silencing of CsSAUR61 in the present invention can greatly reduce the lesion area of citrus canker and alleviate the incidence of canker. The CsSAUR61 gene provided by the present invention can be silenced by various techniques and used for molecular breeding against canker. It can also be used in combination with other disease-resistant or disease-susceptible genes for collaborative molecular breeding of citrus against canker, and has great application value in citrus canker resistance breeding.

[0081] The nucleotide sequences involved in the present invention are as follows:

[0082] SEQ ID NO.1: (CDS sequence of CsSAUR61, from ATG to the stop codon)

[0083] ATGATTAGTCCAAAGAAGCTAATCAAAATGTCAAAGAAATGGCAGAAACTGGCCGC

[0084] TAGCAAGCAGAAAAGAATCTCATTCCCAACAACAGGGCCTGTCGATGCAGAGAGCTGC

[0085] CGCACATCATCTGTGTGTGAGAAGGGTCACTTTGTTGTGTACGCTACCGATGAGAAACG

[0086] CTTTGTTATTCCTTTGGCATATCTTAAAAACAATGTCATCAGAGAGCTCTTTAAAATGGCA

[0087] GAAGATGAATTTGGACTGCCAAGCTGTGGACCTATCACGTTGCCATGTGATGCAGTTTTC

[0088] ATGGAGTATGTAGTCTCTTTGATACAGAGAGGTGCAGCAAAAGATGTAGAGAAGGCATT

[0089] GCTAATGTCCTTAGCTACTACTCGCTGTTTACCATCTTCGTTCATCCATCAGGAGCATAGC

[0090] AACCAACATTCATTCATTTGCAGCTTTTAA

[0091] SEQ ID NO.2: (VIGS sequence of CsSAUR61)

[0092] TCACTTTGTTGTGTACGCTACCGATGAGAAACGCTTTGTTATTCCTTTGGCATATCTT

[0093] AAAAACAATGTCATCAGAGAGCTCTTTAAAATGGCAGAAGATGAATTTGGACTGCCAAG

[0094] CTGTGGACCTATCACGTTGCCATGTGATGCAGTTTTCATGGAGTATGTAGTCTCTTTGATA

[0095] CAGAGAGGTGCAGCAAAAGATGTAGAGAAGGCATTGCTAATGTCCTTAGCTACTACTCG

[0096] CTGTTTACCATCTTCGTTCATCCATCAGGAGCATAGCAACCAACATTCATTCATTTGCAGC

[0097] TTTTAA

[0098] SEQ ID NO.3: (Forward primer CsSAUR61-VIGS-F for cloning VIGS fragment, containing restriction enzyme sites)

[0099] GGTACCTCACTTTGTTGTGTACGCTACCG

[0100] SEQ ID NO.4: (Reverse primer CsSAUR61-VIGS-R for cloning VIGS fragment, containing restriction enzyme sites)

[0101] CCCGGGTTAAAAGCTGCAAATGAATGAATGTTGG

[0102] SEQ ID NO.5: (Forward primer TRV1-F for PCR identification of VIGS plants)

[0103] TTGGGTTGCTACTGATTCGACT

[0104] SEQ ID NO.6: (Reverse primer TRV1-R for PCR identification of VIGS plants)

[0105] CTGTAAGGACCATCATACTTCGC

[0106] SEQ ID NO.7: (Forward primer TRV2-F for PCR identification of VIGS plants)

[0107] CAAAGATGGACATTGTTACTCAAGGAAG

[0108] SEQ ID NO.8: (Forward primer TRV2 - R for PCR identification of VIGS plants)

[0109] CATTCTCGACTGATCTTGATTGATCG

[0110] SEQ ID NO.9: (Forward primer CsSAUR61 - RT - F for RT - PCR identification of VIGS plants, designed within the CDS)

[0111] GCCGCTAGCAAGCAGAAAAG

[0112] SEQ ID NO.10: (Reverse primer CsSAUR61 - RT - R for RT - PCR identification of VIGS plants, designed within the CDS)

[0113] TGGCAACGTGATAGGTCCAC

[0114] Finally, it should be noted that: The above specific embodiments are only used to illustrate the purpose, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above is only the specific implementation manners of the present invention, and is not used to limit the protection scope of the present invention; Although the present invention has been described in detail with reference to the above specific embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions recorded in the above embodiments, or perform equivalent replacements or improvements on some or all of the technical features; And these modifications, equivalent replacements and improvements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention, and they should all be covered by the scope of the claims and the description of the present invention.

Claims

1. Application of CsSAUR61 gene in enhancing resistance of citrus to citrus canker, characterized in that, The application method is to use VIGS silencing to reduce the transcriptional level of the CsSAUR61 gene in citrus, and the nucleotide sequence of the CsSAUR61 gene is shown in SEQ ID NO.

1.

2. Use of the CsSAUR61 gene according to claim 1 in enhancing the resistance of citrus to citrus canker, characterized in that, The specific application method includes the following steps: (1) Clone the VIGS fragment of the citrus CsSAUR61 gene; (2) Construct a VIGS expression vector; (3) Transform the citrus with the VIGS expression vector to obtain VIGS plants in which the CsSAUR61 gene of citrus is silenced.

3. Use of the CsSAUR61 gene according to claim 2 in enhancing the resistance of citrus to citrus canker, characterized in that, The nucleotide sequence of the VIGS fragment is shown in SEQ ID NO.

2.

4. Use of the CsSAUR61 gene according to claim 3 in enhancing the resistance of citrus to citrus canker, characterized in that, In step (1), the cloning method of the VIGS fragment of the citrus CsSAUR61 gene is: Extract the total RNA of citrus, reverse transcribe it into cDNA, and use high-fidelity enzyme PCR amplification with cDNA as the template to obtain the VIGS fragment of the citrus CsSAUR61 gene.

5. Use of the CsSAUR61 gene according to claim 4 in enhancing the resistance of citrus to citrus canker, characterized in that, In step (1), the primers used for PCR amplification are CsSAUR61-VIGS-F and CsSAUR61-VIGS-R, and their nucleotide sequences are SEQ ID NO.3 and SEQ ID NO.4 respectively.

6. Use of the CsSAUR61 gene according to claim 2 in enhancing the resistance of citrus to citrus canker, characterized in that, In step (2), the construction method of the VIGS gene fragment expression vector is: Digest the VIGS fragment obtained in step (1) with BamH I and Sma I, recover it, connect it with the TRV2 vector digested with the same enzymes, and transform the competent cells of Escherichia coli. Extract the plasmid to obtain the VIGS expression vector of the CsSAUR61 gene.

7. Use of the CsSAUR61 gene according to claim 2 in enhancing the resistance of citrus to citrus canker, characterized in that, In step (3), the method for transforming the citrus with the VIGS expression vector is: Transform the VIGS expression vector obtained in step (2) into Agrobacterium, prepare an Agrobacterium liquid containing the VIGS expression vector, infect the sterile seedlings of citrus, and obtain VIGS plants in which the CsSAUR61 gene of citrus is silenced after fluorescence observation, PCR and qRT-PCR verification.

8. Use of the CsSAUR61 gene according to claim 7 in enhancing the resistance of citrus to citrus canker, characterized in that, Three pairs of primers are used for PCR identification, TRV1-F / TRV1-R, TRV2-F / TRV2-R, and TRV2-F / CsSAUR61-VIGS-R. Among them, the nucleotide sequence of TRV1-F is SEQ ID NO.5, the nucleotide sequence of TRV1-R is SEQ ID NO.6, the nucleotide sequence of TRV2-F is SEQ ID NO.7, and the nucleotide sequence of TRV2-R is SEQ ID NO.

8.

9. Use of the CsSAUR61 gene according to claim 7 in enhancing the resistance of citrus to citrus canker, characterized in that, The primers used for qRT-PCR analysis are CsSAUR61-RT-F and CsSAUR61-RT-R, and the nucleotide sequences are SEQ ID NO.9 and SEQ ID NO.10 respectively.

10. Use of the CsSAUR61 gene according to claim 2 in enhancing the resistance of citrus to citrus canker, characterized in that, After obtaining the VIGS plants in step (3), evaluate the resistance of the VIGS plants to citrus canker, and determine that silencing of the CsSAUR61 gene in citrus can enhance the resistance to citrus canker.

Images