Application of CsIAA9 gene in enhancing canker resistance of citrus
By constructing the VIGS expression vector of the citrus CsIAA9 gene, the CsIAA9 gene was silenced to enhance the resistance of citrus to ulcer disease, solving the environmental hazards and gene scarcity of traditional prevention and control methods, and achieving significant disease resistance and molecular breeding potential.
Patent Information
- Application Number
- CN202510468545.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-15
- Publication Date
- 2025-07-04
AI Technical Summary
In the prior art, the prevention and control methods of citrus canker disease such as incineration of sick trees and the use of pesticides have environmental hazards, and the high-quality disease-resistant genes are scarce, and effective molecular breeding methods are lacking.
By constructing the VIGS expression vector of the citrus CsIAA9 gene, the transcription level of citrus CsIAA9 was reduced, and the transformation of citrus was mediated by Agrobacterium, and the CsIAA9 gene was silenced to enhance its resistance to ulcer disease.
Significantly improve the resistance of citrus to ulcer disease, reduce lesions area and condition index, and do not affect the plant phenotype, providing the potential for molecular breeding of ulcer disease.
Smart Images

Figure CN120249379A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of agricultural biological gene technology, and specifically relates to the application of the CsIAA9 gene in enhancing the resistance of citrus to canker disease. Background Art
[0002] Citrus bacterial canker (CBC) is a bacterial disease caused by Xanthomonas citri subsp. Citri (Xcc), which harms most of the current major citrus cultivars. Therefore, strengthening the research on the prevention and control of citrus canker disease is an urgent need for the development of the citrus industry.
[0003] Traditional prevention and control measures for citrus canker disease, such as burning diseased trees and using pesticides, require a large amount of manpower and material resources and will cause great environmental harm. Therefore, the prevention and control of citrus canker disease more hopes to cultivate new disease-resistant germplasms. Molecular breeding has been rapidly developed and widely applied at present because it can cultivate new disease-resistant germplasms directionally and efficiently. In recent years, some citrus resources resistant to canker disease have been obtained through biological technology means, such as Jincheng orange, Xinhui orange, and navel orange lines transformed with the antibacterial peptide D gene of Antheraea pernyi; late Jincheng orange lines overexpressing CsBZIP40; plants with improved resistance to citrus canker disease obtained by gene-editing the promoter of the citrus canker disease-susceptible gene CsLOB1. However, high-quality candidate genes are still scarce, and the research on their functions and action mechanisms is not deep. Therefore, it is urgent to specifically explore more genes closely related to citrus canker disease and deeply analyze their functions and mechanisms for molecular breeding of canker disease resistance.
[0004] Auxin is one of the earliest discovered plant hormones, and indole-3-acetic acid (IAA) is the most important active form among them. It plays a key role in many processes of plant growth and development, such as cell division, elongation and differentiation, vascular tissue formation, adventitious root formation, tropic responses, apical dominance, and the development of flowers and fruits (Cao et al., 2023; Wang et al., 2025).
[0005] Auxin can induce the rapid and efficient expression of a class of genes, which are called auxin early response genes (AERGs), including the Auxin / indole-3-acetic acid (Aux / IAA) gene family, the Gretchen Hagen3 (GH3) gene family, and the Small auxin-up RNA (SAUR) gene family (Bao et al., 2024).
[0006] The proteins encoded by the Aux / IAA gene family are a class of short-lived nuclear proteins that usually contain four conserved domains (Domain I-IV). Domain I has transcriptional repression activity and can interact with other transcription factors to inhibit gene expression; Domain II is rich in acidic amino acids and is the key region for Aux / IAA protein degradation. In the presence of auxin, this region can bind to the auxin receptor TIR1 / AFB, causing the Aux / IAA protein to be degraded by the 26S proteasome; Domains III and IV mediate the interactions between Aux / IAA proteins and between Aux / IAA proteins and auxin response factors (ARFs), forming protein complexes to regulate gene transcription (Shi et al., 2020; Luo et al., 2018). Many studies have shown that the Aux / IAA gene family often exhibits a negative regulatory role in the process of plant disease resistance. For example, a series of genes from the auxin signaling pathway auxin resistance 1 (AUX1), auxin resistance 2 (AXR2 / IAA7), AXR3 / IAA17, AXR4, AXR6, TIR1, PIN-FORMED (PIN2) are involved in the negative regulation of the resistance of plants to Fusarium oxysporum (Kidd et al., 2011). However, some studies have also found that the Aux / IAA gene family can also play a positive regulatory role in plant disease resistance in some cases. For example, overexpression of MdIAA24 in apples can regulate the interactions between IAA, JA, and SA, improve the reactive oxygen species (ROS) scavenging ability and the activities of defense-related enzymes, and increase the activities of chitinase and β-1,3-glucanase in leaves, jointly contributing to the resistance of apples to Glomerella leaf spot (GLS) caused by the pathogen Colletotrichum fructicola (Cf) (Wang et al., 2024).
[0007] Although the Aux / IAA gene has been partially applied in plant disease resistance, there is no relevant research report in the field of citrus canker. In view of this, the present invention is specifically proposed. Summary of the Invention
[0008] The present invention aims to expand the application of the Aux / IAA gene in plant disease resistance, make up for the blank of the Aux / IAA gene in the field of citrus canker, and provide an application of the CsIAA9 gene in enhancing the resistance of citrus to canker. By transforming the VIGS expression vector of the citrus CsIAA9 gene into citrus and reducing the transcriptional level of citrus CsIAA9, the resistance of citrus to canker can be significantly improved, the incidence of canker can be reduced, and the phenotype of the transgenic plants is not affected.
[0009] The present invention is achieved by the following technical solutions:
[0010] The present invention provides an application of the CsIAA9 gene in enhancing the resistance of citrus to citrus canker. The application method is to use VIGS silencing to reduce the transcriptional level of the CsIAA9 gene in citrus. The nucleotide sequence of the CsIAA9 gene is shown in SEQ ID NO.1.
[0011] Furthermore, the application method specifically includes the following steps:
[0012] (1) Clone the VIGS fragment of the citrus CsIAA9 gene;
[0013] (2) Construct a VIGS expression vector;
[0014] (3) Transform the citrus with the VIGS expression vector to obtain VIGS plants in which the CsIAA9 gene of citrus is silenced.
[0015] Furthermore, the nucleotide sequence of the VIGS fragment is shown in SEQ ID NO.2.
[0016] Furthermore, in step (1), the cloning method of the VIGS fragment of the citrus CsIAA9 gene is:
[0017] Extract the total RNA of citrus, reverse transcribe it into cDNA, and use high-fidelity enzyme PCR amplification with cDNA as a template to obtain the VIGS fragment of the citrus CsIAA9 gene.
[0018] Furthermore, in step (1), the primers used for PCR amplification are CsIAA9-VIGS-F and CsIAA9-VIGS-R, and their nucleotide sequences are SEQ ID NO.3 and SEQ ID NO.4 respectively.
[0019] Furthermore, in step (2), the construction method of the VIGS expression vector is:
[0020] Digest the VIGS fragment obtained in step (1) with BamH I and Sma I, recover it, connect it with the TRV2 vector digested with the same enzymes, and transform the competent cells of Escherichia coli. Extract the plasmid to obtain the VIGS expression vector of the CsIAA9 gene.
[0021] Furthermore, in step (3), the method for transforming the citrus with the VIGS expression vector is:
[0022] The VIGS expression vector obtained in step (2) was transformed into Agrobacterium to prepare an Agrobacterium liquid containing the VIGS expression vector, which was used to infect citrus sterile seedlings. After verification by fluorescence observation, PCR, and qRT-PCR, VIGS plants with silenced citrus CsIAA9 gene were obtained.
[0023] Further, three pairs of primers were used for PCR identification, namely TRV1-F / TRV1-R, TRV2-F / TRV2-R, and TRV2-F / CsIAA9-VIGS-R. Among them, the nucleotide sequence of TRV1-F is SEQ ID NO.5, the nucleotide sequence of TRV1-R is SEQ ID NO.6, the nucleotide sequence of TRV2-F is SEQ ID NO.7, and the nucleotide sequence of TRV2-R is SEQ ID NO.8.
[0024] Further, the primers used for qRT-PCR analysis were CsIAA9-RT-F and CsIAA9-RT-R, and their nucleotide sequences are shown as SEQ ID NO.9 and SEQ ID NO.10 respectively.
[0025] Further, after obtaining the VIGS plants in step (3), the VIGS plants were evaluated for resistance to citrus canker, and it was determined that silencing of the citrus CsIAA9 gene could enhance the resistance to citrus canker.
[0026] Compared with the prior art, the present invention has the following advantages and beneficial effects:
[0027] 1. By constructing a VIGS expression vector of the citrus CsIAA9 gene and transforming citrus through Agrobacterium-mediated transformation, the obtained citrus plants can show obvious resistance to canker. The lesion area can be reduced to 72.8% of that of the control plants at most, and the disease index can be reduced to 77.2% of that of the control plants at most, significantly reducing the incidence of canker.
[0028] 2. By silencing the VIGS of the citrus CsIAA9 gene, VIGS plants with silenced citrus CsIAA9 gene were obtained, which can be used for molecular breeding for canker resistance, or can be used together with other disease-resistant or disease-susceptible genes for collaborative molecular breeding of citrus canker resistance. It has great application value in citrus canker resistance breeding, and silencing of the citrus CsIAA9 gene by VIGS does not affect the phenotype of citrus plants. Brief Description of the Drawings
[0029] To more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the accompanying drawings required for the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as limiting the scope. For those of ordinary skill in the art, without creative efforts, other related drawings can also be obtained based on these drawings. In the drawings:
[0030] Figure 1 It is the bioinformatics feature map of the citrus CsIAA9 gene in Example 1 of the present invention; wherein, A represents the chromosomal localization of the citrus CsIAA9 gene, B represents the gene structure of citrus CsIAA9, C represents the conserved domain of citrus CsIAA9, D represents the functional domain of CsIAA9, and E represents the secondary structure of CsIAA9;
[0031] Figure 2 It is the PCR amplification electrophoresis map of the VIGS fragment of the CsIAA9 coding gene of the present invention, wherein, VIGS represents the RNAi fragment of the CsIAA9 coding gene; M represents the DNA molecular weight standard.
[0032] Figure 3 It is the structural diagram of the VIGS expression vector of CsIAA9 of the present invention, wherein, GFP represents green fluorescent protein, RdRp represents NA-dependent RNA polymerase, CP represents coat protein, 35S represents the plant constitutive promoter derived from cauliflower mosaic virus, NOS represents the terminator of the nopaline synthase gene, LB represents the left homology arm, and RB represents the right homology arm;
[0033] Figure 4 It is the PCR detection map of the VIGS plants of the present invention, wherein, + represents the positive control, - represents the negative control, M represents the molecular weight standard, TRV2 represents the plants with the empty vector, and TRV2-CsIAA9-1 / 2 / 3 / 4 / 5 represents 5 VIGS plants;
[0034] Figure 5 It is the qRT-PCR detection map of the expression of CsIAA9 in the VIGS plants of the present invention; wherein, "*": indicates significant difference, P < 0.05; "**": indicates extremely significant difference, P < 0.01; "***": indicates extremely significant difference, P < 0.001; TRV2 represents the plants with the empty vector; TRV2-CsIAA9-1 / 2 / 3 / 4 / 5 represents 5 VIGS plants;
[0035] Figure 6 It is the phenotype map of the VIGS plants of the present invention, wherein, TRV2 represents the plants with the empty vector, and TRV2-CsIAA9-1 / 2 / 3 / 4 / 5 represents 5 VIGS plants;
[0036] Figure 7 This shows the disease incidence of the leaves of VIGS plants of the present invention 10 days after inoculation with Xanthomonas citri subsp. citri. Among them, TRV2 represents the plants with the empty vector, and TRV2-CsIAA9-1 / 2 / 3 / 4 / 5 represent 5 VIGS plants;
[0037] Figure 8 This is a statistical chart of the lesion size of the leaves of VIGS plants of the present invention 10 days after inoculation with Xanthomonas citri subsp. citri. Among them, TRV2 represents the plants with the empty vector, and TRV2-CsIAA9-1 / 2 / 3 / 4 / 5 represent 5 VIGS plants;
[0038] Figure 9 This is a statistical chart of the disease index of the leaves of VIGS plants of the present invention 10 days after inoculation with Xanthomonas citri subsp. citri. Among them, TRV2 represents the plants with the empty vector, and TRV2-CsIAA9-1 / 2 / 3 / 4 / 5 represent 5 VIGS plants. Detailed implementation manners
[0039] To make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments and the drawings. Obviously, the illustrative embodiments and their descriptions of the present invention are only used to explain the present invention and do not serve as a limitation to the present invention.
[0040] The following will appropriately refer to the drawings to detail the implementation manners of the application of a CsIAA9 gene in enhancing the resistance of citrus to citrus canker of the present invention. However, there will be cases where unnecessary detailed descriptions are omitted. For example, there are cases where the detailed descriptions of well-known matters and repeated descriptions are omitted. This is to avoid the following descriptions from becoming unnecessarily lengthy and to facilitate the understanding of those skilled in the art.
[0041] It should be noted that the embodiments of the present invention use late Jincheng oranges as the test objects. In actual applications, this method can also be used to improve the resistance improvement of other citrus varieties to citrus canker; the experimental methods used in the embodiments are all conventional methods unless otherwise specified. The materials, reagents, methods and instruments used, unless otherwise specified, are all conventional materials, reagents, methods and instruments in the art, and those skilled in the art can obtain them through commercial channels.
[0042] Example 1
[0043] Bioinformatics analysis of citrus CsIAA9
[0044] The citrus CsIAA9 gene is located between 8221180bp and 8226084bp on chromosome 3 of citrus. It contains 4 introns and 5 exons, encoding 365 amino acids. The N-terminus and C-terminus contain Aux / IAA functional domains, respectively. The secondary structure prediction shows that the α-helix is composed of 49 amino acid residues (accounting for 13.42%), the extended chain contains 40 residues (10.96%), and the random coil region contains 276 residues (75.62%) (e.g. Figure 1 ), the CDS sequence of citrus CsIAA9 gene is shown in SEQ ID NO.1.
[0045] Example 2
[0046] VIGS fragment cloning
[0047] 1. RNA Extraction and cDNA Synthesis
[0048] Total RNA from citrus (Wanjincheng) leaves was extracted using a plant total RNA extraction kit (Adlai, CAT: RN09), the RNA quality was verified by agarose gel electrophoresis, and its concentration was measured by a concentration meter. cDNA was synthesized using a reverse transcription kit PrimeScript RTMaster Mix (TaKaRa, CAT: RR036A), and the cDNA was stored at -20°C for future use.
[0049] 2.VIGS fragment amplification
[0050] The VIGS fragment of the CsIAA9 encoding gene was cloned from citrus cDNA using primers CsIAA9-VIGS-F (SEQ ID NO.3) and CsIAA9-VIGS-R (SEQ ID NO.4) and high-fidelity enzyme PrimeSTARMaxDNA Polymerase (TaKaRa, CAT: R045Q). The length of the fragment was 312 bp (SEQ ID NO.2) ( Figure 2 ). Under ultraviolet light, use a clean blade to cut out the agarose gel block containing the target fragment, and use a kit (BioFlux, CAT: BSC02M1) to recover the DNA fragment.
[0051] The PCR amplification program was as follows: 98°C, 5 min; 98°C, 30 s, 56°C, 30 s, 72°C, 1.5 min, 35 cycles; and extension at 72°C for 10 min.
[0052] Example 3
[0053] VIGS expression vector construction
[0054] The VIGS vector TRV2 and the VIGS fragment of the CsIAA9 gene were digested with BamH I and Sma I, recovered by gel electrophoresis, and then the two fragments were ligated and transformed into competent Escherichia coli cells. The plasmid was extracted to obtain the VIGS expression vector TRV2-CsIAA9( Figure 3 ). Among them, GFP: green fluorescent protein; RdRp: NA-dependent RNA polymerase; CP: coat protein; 35S: plant constitutive promoter derived from cauliflower mosaic virus; NOS: terminator of nopaline synthase gene; LB: left homologous arm; RB: right homologous arm. The vector TRV2-CsIAA9 was transformed into Agrobacterium tumefaciens by electroporation to prepare an Agrobacterium tumefaciens solution containing the VIGS expression vector of the CsIAA9 gene.
[0055] Example 4
[0056] Transformation of citrus with VIGS expression vector
[0057] 1. Activation of Agrobacterium tumefaciens
[0058] 500 μL of the Agrobacterium tumefaciens solutions of TRV1 and TRV2, TRV2-IAA9 were added to 50 mL of liquid LB medium (containing kanamycin) respectively, and cultured at 28 °C and 200 r / min until OD600 = 1; the bacteria were collected and resuspended with MMA (10 mM MgCl2, 10 nM MES, 100 μM acetosyringone) solution to adjust OD600 = 1; TRV1 was mixed with TRV2 and TRV2-IAA9 vectors at a volume ratio of 1:1 respectively and incubated at room temperature for 3 h.
[0059] 2. Agrobacterium infection
[0060] Sterile seedlings with a radicle length of 3 cm were immersed in the Agrobacterium tumefaciens solution, and vacuum was applied for 1 min with a vacuum pump; rinsed 3 - 5 times with sterile water and inserted into the seed medium, cultured in the dark at room temperature for 2 - 3 d. If green fluorescence was observed, it was a positive seedling, which was transferred to the soil for cultivation, cultured at 25 °C with a light / dark cycle of 16 h / 8 h, and watered regularly.
[0061] Example 5
[0062] Identification and phenotypic observation of VIGS plants
[0063] 1. PCR identification
[0064] Positive seedlings showing green fluorescence under ultraviolet light were then transferred to nutrient soil medium. One month later, tissues were collected to extract DNA and total RNA, and PCR verification was performed using three pairs of primers: TRV1-F (SEQ ID NO.5) / TRV1-R (SEQ ID NO.6), TRV2-F (SEQ ID NO.7) / TRV2-R (SEQ ID NO.8), and TRV2-F (SEQ ID NO.7) / CsIAA9-VIGS-R (SEQ ID NO.4):
[0065] The primer pair TRV1-F / R can amplify a 150-bp band in TRV2 and TRV2-CsIAA9 plants; TRV2-F / R can amplify 255-bp and 567-bp bands in TRV2 and TRV2-CsIAA9 plants, respectively; the primer pair TRV2-F / CsIAA9-VIGS-R has no amplification band in TRV2 plants but can amplify a 458-bp band in TRV2-CsIAA9 plants( Figure 4 ). This indicates that VIGS-CsIAA9 has been successfully integrated into the genome.
[0066] PCR reaction conditions: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 34 cycles; 72°C for 3 min.
[0067] 2. qRT-PCR analysis
[0068] qRT-PCR was performed using the primers CsIAA9-RT-F (SEQ ID NO.9) and CsIAA9-RT-R (SEQ ID NO.10) to verify whether CsIAA9 was successfully silenced. The gene expression levels of plants transfected with the empty TRV1 and TRV2 vectors were set as 1. If the CsIAA9 gene expression level of the plants containing the target fragment vector was less than 1, gene silencing occurred. After identification, the CsIAA9 transcription level decreased by 25%-48%( Figure 5 ).
[0069] qRT-PCR reaction conditions: 95°C for 3 min, 94°C for 10 s; 56°C for 10 s, 72°C for 10 s, 40 cycles; 72°C for 10 min.
[0070] 3. Phenotype observation
[0071] Observing the phenotypes of VIGS plants of the CsIAA9 gene, no obvious abnormalities were found in appearance and growth( Figure 6 ). This indicates that the silencing of CsIAA9 has no obvious effect on the phenotype and development of plants.
[0072] Example 6
[0073] Resistance evaluation of VIGS plants
[0074] After washing the mature leaves of transgenic plants, they were disinfected with 75% alcohol and rinsed with sterile water, and then placed in a laminar flow hood. Needle pricks were made centered on the leaf veins, and the bacterial suspension of Xanthomonas citri subsp. citri was spotted with a pipette, 1 μL (1×10 5 CFU / mL) was spotted at each puncture hole; they were cultured in a constant temperature light incubator at 28 °C (16 h light / 8 h dark); photos were taken 10 days after inoculating the leaves with bacteria, and the lesion area was statistically analyzed using Image J V1.47 software.
[0075] The disease severity was divided into grades 0 - 7 according to the lesion area. Let R represent the lesion area. Grade 0 (R ≤ 0.25 mm 2 ), Grade 1 (0.25 mm 2 <R ≤ 0.5 mm 2 ), Grade 2 (0.5 mm 2 <R ≤ 0.75 mm 2 ), Grade 3 (0.75 mm 2 <R ≤ 1 mm 2 ), Grade 4 (1.0 mm 2 <R ≤ 1.25 mm 2 ), Grade 5 (1.25 mm 2 <R ≤ 1.5 mm 2 ), Grade 6 (1.5 mm 2 <R ≤ 1.75 mm 2 ), Grade 7 (R > 1.75 mm 2 ); The disease index was calculated according to the formula: DI = 100×Σ (number of lesions at each grade X corresponding grade value) / (total number of lesions × maximum grade).
[0076] The results were as Figures 7-9 shown:
[0077] Figure 7 showed that 10 days after inoculating with Xanthomonas citri subsp. citri, the symptoms of VIGS plants of CsIAA9 were significantly alleviated;
[0078] Figure 8 showed that 10 days after inoculating with Xanthomonas citri subsp. citri, the lesion area of VIGS plants of CsIAA9 decreased by 13.8% - 27.2%;
[0079] Figure 9 showed that 10 days after inoculating with Xanthomonas citri subsp. citri, the disease index of VIGS plants of CsIAA9 decreased by 9.5% - 22.8%.
[0080] Therefore, silencing of the CsIAA9 gene can enhance the resistance to citrus canker.
[0081] In summary, the silencing of CsIAA9 in the present invention can greatly reduce the lesion area of citrus canker and alleviate the incidence of canker. The CsIAA9 gene provided by the present invention can be silenced by various techniques and used for molecular breeding against canker. It can also be used in combination with other disease-resistant or disease-susceptible genes for collaborative molecular breeding of citrus against canker, having great application value in citrus canker resistance breeding.
[0082] The following are the nucleotide sequences involved in the present invention.
[0083] SEQ ID NO.1: (CDS sequence of CsIAA9, from ATG to the stop codon)
[0084]
[0085] SEQ ID NO.2: (VIGS sequence of CsIAA9)
[0086] ATCATTTAGGAAGAATTCATTGGCCACTTCGTCTAAGAATAATGACGAAGTAGATGGAAAAGCAGGTTCCAGTGCTCTGTTTGTCAAGGTCAGCATGGATGGTGCTCCTTATTTAAGAAAAGTGGACTTGAAAAATTACTCTAAATATCAGGAACTATCTTCTGCCCTTGAGAAGATGTTCAGCTGCTTTACAATTGGGCAATATGGATCTCATGGGGCTCTGGGCAGGGAGATGCTGAGTGAAAGCAAGTTGAAGGATCTGCTACATGGCTCAGAATTCGTTCTCACTTATGAAGACAAAGATGGGGATTG
[0087] SEQ ID NO.3: (Forward primer CsIAA9-VIGS-F for cloning VIGS fragment, containing restriction enzyme sites)
[0088] GGTACCATCATTTAGGAAGAATTCATTGGCCAC
[0089] SEQ ID NO.4: (Reverse primer CsIAA9-VIGS-R for cloning VIGS fragment, containing restriction enzyme sites)
[0090] CCCGGGCAATCCCCATCTTTGTCTTCATAAGTG
[0091] SEQ ID NO.5: (Forward primer TRV1-F for PCR identification of VIGS plants)
[0092] TTGGGTTGCTACTGATTCGACT
[0093] SEQ ID NO.6: (Reverse primer TRV1-R for PCR identification of VIGS plants)
[0094] CTGTAAGGACCATCATACTTCGC
[0095] SEQ ID NO.7: (Forward primer TRV2-F for PCR identification of VIGS plants)
[0096] CAAAGATGGACATTGTTACTCAAGGAAG
[0097] SEQ ID NO.8: (Primer TRV2-R before PCR identification of VIGS plants)
[0098] CATTCTCGACTGATCTTGATTGATCG
[0099] SEQ ID NO.9: (Primer CsIAA9-RT-F before RT-PCR identification of VIGS plants, designed within CDS)
[0100] GAGGTTCGGAACTCTGCCTC
[0101] SEQ ID NO.10: (Primer CsIAA9-RT-R before RT-PCR identification of VIGS plants, designed within CDS)
[0102] CCTGACTTCAGCCCCAAGTT
[0103] Finally, it should be noted that: The above specific embodiments are only used to illustrate the purpose, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above is only the specific implementation manners of the present invention and is not used to limit the protection scope of the present invention; Although the present invention has been described in detail with reference to the above specific embodiments, those of ordinary skill in the art should understand that: They can still modify the technical solutions recorded in the above embodiments, or perform equivalent replacements, improvements, etc. on some or all of the technical features; And these modifications, equivalent replacements, improvements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention, and they should all be covered by the scope of the claims and the description of the present invention.
Claims
1. Application of the CsIAA9 gene in enhancing the resistance of citrus to citrus canker, characterized in that, The application method is to use VIGS silencing to reduce the transcriptional level of the CsIAA9 gene in citrus, and the nucleotide sequence of the CsIAA9 gene is shown in SEQ ID NO.
1.
2. Use of the CsIAA9 gene according to claim 1 in enhancing the resistance of citrus to citrus canker, characterized in that, The specific application method includes the following steps: (1) Clone the VIGS fragment of the citrus CsIAA9 gene; (2) Construct a VIGS expression vector; (3) Transform the VIGS expression vector into citrus to obtain VIGS plants with the CsIAA9 gene of citrus silenced.
3. Use of the CsIAA9 gene according to claim 2 in enhancing the resistance of citrus to citrus canker, characterized in that, The nucleotide sequence of the VIGS fragment is shown in SEQ ID NO.
2.
4. Use of the CsIAA9 gene according to claim 2 in enhancing the resistance of citrus to citrus canker, characterized in that, In step (1), the cloning method of the VIGS fragment of the citrus CsIAA9 gene is as follows: Extract the total RNA of citrus, reverse transcribe it into cDNA, and use high-fidelity enzyme PCR amplification with the cDNA as a template to obtain the VIGS fragment of the citrus CsIAA9 gene.
5. Use of the CsIAA9 gene according to claim 4 in enhancing the resistance of citrus to citrus canker, characterized in that, In step (1), the primers used for PCR amplification are CsIAA9-VIGS-F and CsIAA9-VIGS-R, and their nucleotide sequences are SEQ ID NO.3 and SEQ ID NO.4 respectively.
6. Use of the CsIAA9 gene according to claim 2 in enhancing the resistance of citrus to citrus canker, characterized in that, In step (2), the construction method of the VIGS expression vector is as follows: Digest the VIGS fragment obtained in step (1) with BamH I and Sma I, recover it, connect it with the TRV2 vector digested with the same enzymes, and transform Escherichia coli competent cells. Extract the plasmid to obtain the VIGS expression vector of the CsIAA9 gene.
7. Use of the CsIAA9 gene according to claim 2 in enhancing the resistance of citrus to citrus canker, characterized in that, In step (3), the method for transforming the VIGS expression vector into citrus is as follows: Transform the VIGS expression vector obtained in step (2) into Agrobacterium, prepare an Agrobacterium liquid containing the VIGS expression vector, infect citrus sterile seedlings, and obtain VIGS plants with the CsIAA9 gene of citrus silenced after fluorescence observation, PCR, and qRT-PCR verification.
8. Use of the CsIAA9 gene according to claim 7 in enhancing the resistance of citrus to citrus canker, characterized in that, Three pairs of primers are used for PCR identification, namely TRV1-F / TRV1-R, TRV2-F / TRV2-R, and TRV2-F / CsIAA9-VIGS-R. Among them, the nucleotide sequence of TRV1-F is SEQ ID NO.5, the nucleotide sequence of TRV1-R is SEQ ID NO.6, the nucleotide sequence of TRV2-F is SEQ ID NO.7, and the nucleotide sequence of TRV2-R is SEQ ID NO.
8.
9. Use of the CsIAA9 gene according to claim 7 in enhancing the resistance of citrus to citrus canker, characterized in that, The primers used for qRT-PCR analysis are CsIAA9-RT-F and CsIAA9-RT-R, and the nucleotide sequences are shown in SEQ ID NO.9 and SEQ ID NO.10 respectively.
10. Use of the CsIAA9 gene according to claim 2 in enhancing the resistance of citrus to citrus canker, characterized in that, After obtaining the VIGS plants in step (3), evaluate the resistance of the VIGS plants to citrus canker, and determine that the silencing of the CsIAA9 gene in citrus can enhance the resistance to citrus canker.