Rapid detection method for succession law of saccharomyces cerevisiae in solid-state fermentation of white spirit and application of rapid detection method

Abstract

The invention discloses a rapid detection method for a succession rule of saccharomyces cerevisiae in solid-state fermentation of white spirit and application, and belongs to the technical field of wine making analysis. According to the method, the succession law of saccharomyces cerevisiae microbiota in the solid-state fermentation process is represented by adopting the quantity change of dominant yeast single plants, the dominant yeast single plants are subjected to fluorescence labeling to construct engineering bacteria FSC01, the engineering bacteria FSC01 are added into fermented grains along with yeast for making hard liquor, the engineering bacteria FSC01 and the fermented grains are put into a jar for fermentation together, flow cytometry is carried out through regular sampling, and the saccharomyces cerevisiae microbiota in the solid-state fermentation process are obtained. Background interference of complex samples is avoided, the detection result is accurate and quantifiable, and the defect that the detection result cannot accurately reflect the real activity of microorganisms in the fermentation process due to the fact that viable bacteria and dead bacteria cannot be distinguished in a traditional high-throughput sequencing technology is overcome; and compared with the traditional plate counting method, the method has the advantage of short detection period, can provide real-time data support for wine enterprises, and has important significance in optimizing the fermentation process and improving the wine quality and the wine yield.

Description

Technical Field

[0001] The present invention relates to the technical field of brewing analysis, and more specifically, to a rapid detection method for the succession law of Saccharomyces cerevisiae in the solid-state fermentation of Chinese liquor. Background Art

[0002] Chinese liquor is a well-known traditional fermented food, and its flavor and quality mainly depend on the fermentation process of microorganisms, especially the growth and metabolism status of key microorganisms. The brewing of Chinese liquor has the characteristics of open inoculation and multi-bacteria mixed fermentation. Taking Maotai-flavor Chinese liquor as an example, it adopts a solid-state fermentation process. During the whole fermentation process, more than 1,000 kinds of microorganisms are involved. The metabolic activities of microorganisms during the production process produce a large number of flavor substances, forming its unique liquor body style. However, at present, the effects of these microorganisms related to the formation of flavor compounds on the quality and liquor yield of liquor in fermented grains, as well as the growth law of key microorganisms during the fermentation process, are still unclear. The judgment criteria for the quality of fermented grains are also unclear.

[0003] Fermented grains refer to the materials prepared for distilling liquor after cooking and fermentation during the brewing process of Chinese liquor. The quality and state of fermented grains directly affect the liquor yield and the quality of liquor. Saccharomyces cerevisiae is one of the core microorganisms in the fermentation of fermented grains, mainly responsible for converting sugars into alcohol and carbon dioxide, and at the same time producing various flavor substances, such as esters, acids, and alcohols, etc. These substances endow Chinese liquor with unique aroma and taste. Factors such as temperature, humidity, and oxygen content in the fermentation environment have important effects on the activity and metabolism of yeast. Brewers optimize the metabolic pathway of yeast by carefully controlling these environmental factors, thereby improving the flavor of Chinese liquor.

[0004] At present, there are mainly three methods for detecting Saccharomyces cerevisiae microorganisms, namely the plate coating method, the high-throughput sequencing method, and the fluorescence quantitative PCR method. Among them, the plate coating method is time-consuming and laborious for analysis; due to the inaccurate sequencing results of universal primers, the high-throughput sequencing method can only detect at the genus level, and this method has a high cost and a long time-consuming. The detection object is all microbial populations, and dead cells cannot be removed, which has a great interference on the quantification of Saccharomyces cerevisiae that really plays a role; due to the inability to achieve absolute quantification after amplification by the PCR technique in the fluorescence quantitative PCR method, the error of the template will also lead to a large difference in results, and this method is complex to operate and difficult to quickly quantify.

[0005] Therefore, how to quickly, accurately, and quantitatively monitor the growth of yeast microorganisms during the brewing process and improve the liquor yield and the quality of liquor is an urgent problem to be solved by those skilled in the art. Summary of the Invention

[0006] In view of the above problems, the present invention provides a rapid detection method and application for the succession law of Saccharomyces cerevisiae in the solid-state fermentation of Chinese liquor.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] A rapid detection method for the succession law of Saccharomyces cerevisiae in the solid-state fermentation of Chinese liquor, comprising the following steps:

[0009] (1) Screening out the dominant single strain of Saccharomyces cerevisiae from the fermented grains used for fermentation;

[0010] (2) Introducing the integrated donor DNA fragment into the dominant single strain of Saccharomyces cerevisiae obtained in step (1) to construct an engineered strain FSC01 capable of expressing a fluorescent protein;

[0011] (3) In the koji mixing link of solid-state fermentation, adding the engineered strain FSC01 into the grain and koji along with the Daqu, and fermenting them in the vat together;

[0012] (4) Starting from putting into the vat, sampling regularly, performing flow cytometry detection, and recording the lg value of the cell concentration.

[0013] Preferably, the screening process of the dominant single strain of Saccharomyces cerevisiae described in step (1) is as follows:

[0014] S1. After gradient diluting the suspension of the fermented grains sample, coating it on the YPD agar medium plate for amplification culture, picking single colonies and performing streak plating on the WL differential medium, and observing the colony characteristics after culturing for a period of time;

[0015] S2. Screening out the colonies that are cream-colored with green, opaque, spherical, smooth, and protruding in shape from the colonies obtained in step S1, picking monoclonal colonies for shaking culture and then performing sequencing, and performing homology comparison with the Saccharomyces cerevisiae 26S rDNA sequence with the accession number HM191639.1 in the NCBI database;

[0016] S3. Selecting the colonies with 100% homology data in step S2, and screening out the strain with the largest percentage in the total number of isolated colonies as the dominant single strain of Saccharomyces cerevisiae.

[0017] Preferably, the nucleotide sequence of the integrated donor DNA fragment described in step (2) is as shown in SEQ ID NO.21.

[0018] Preferably, the integrated donor DNA fragment is obtained by the following steps:

[0019] a. Respectively performing PCR amplification on the DNA elements of plasmid pUC19, green fluorescent protein gene GFP, geneticin resistance gene G418, 1000bp sequences upstream and downstream of the stable site X3, P TDH3 、P TEF1 、T ADH1 and T CYC1 ;

[0020] b. After verifying that the PCR products obtained in step a are correct, respectively perform gel extraction and purification, mix them together for homologous recombination reaction, transform them into competent Escherichia coli cells, screen for positive clones, extract plasmids and perform PCR verification;

[0021] c. Use sma endonuclease to digest the plasmid verified to be correct in step b, perform gel extraction and sequencing verification, and the nucleotide sequence shown in SEQ ID NO.21 is the integrated donor DNA fragment.

[0022] Preferably, the size of the plasmid verified to be correct by PCR in step c is 1600 bp.

[0023] Preferably, the construction process of the engineered bacterium FSC01 in step (2) is as follows: Electrotransform the integrated donor DNA fragment into the competent cells of the dominant single strain of Saccharomyces cerevisiae, screen for positive clones, perform PCR verification, after expanding and culturing the successfully verified clones, perform fluorescence signal detection, and the clones that can normally express fluorescent proteins are the engineered bacterium FSC01.

[0024] Preferably, the size of the clones successfully verified by PCR is 2500 bp.

[0025] Preferably, the addition amount of the engineered bacterium FSC01 in step (3) to the grain mash is 10 5 / kg.

[0026] Preferably, the regular sampling in step (3) is to sample once every 2 days, and take samples from the surface layer and the inner layer each time, mix them evenly and use them as the test samples.

[0027] Another object of the present invention is to provide an application of a rapid detection method for the succession law of Saccharomyces cerevisiae in solid-state fermentation of Chinese liquor in the improvement of brewing technology.

[0028] Preferably, it includes the following improvements:

[0029] (1) Predict the liquor yield of the pit, and determine the priority order of liquor steaming; (2) Evaluate the fermentation situation in the pit and optimize the fermentation parameters; (3) Optimize the brewing process flow and improve the flavor of the liquor body.

[0030] As can be seen from the above technical solutions, compared with the prior art, a rapid detection method for the succession law of Saccharomyces cerevisiae in solid-state fermentation of Chinese liquor. The present invention uses the change in the number of dominant yeast single strains to characterize the succession law of the Saccharomyces cerevisiae microbiota in the solid-state fermentation process. By introducing an integrated DNA fragment with a specific nucleotide sequence into the dominant yeast single strain, an engineered bacterium FSC01 capable of expressing a fluorescent protein is constructed. And in the koji mixing step of solid-state fermentation, the engineered bacterium FSC01 is added to the grain mash together with the daqu, and then fermented in the vat. By regularly sampling for flow cytometry detection, the background interference of complex samples is avoided, and the detection results are accurate and quantifiable, overcoming the defect that the traditional high-throughput sequencing technology cannot distinguish between live bacteria and dead bacteria, resulting in the detection results being unable to accurately reflect the true activity of microorganisms during fermentation. And the detection method of the present invention has the advantage of a short detection period compared with the traditional plate counting method, can provide real-time data support for liquor enterprises, and is of great significance in optimizing the fermentation process, improving the quality of the liquor body and the liquor yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 : PCR electrophoresis diagram of the positive clone sample in Example 1, where M: Marker, 1, 3, 5: successfully constructed integrated recombinant plasmids, 2, 4: failed constructed integrated recombinant plasmids;

[0032] Figure 2 : Morphological diagram of Saccharomyces cerevisiae in the fermented grains sample in Example 2;

[0033] Figure 3 : PCR electrophoresis diagram of the positive clone sample in Example 3, where M: Marker, 3, 6, 8: successfully constructed integrated recombinant engineered bacteria, 1, 2, 4, 5, 7: failed constructed integrated recombinant engineered bacteria;

[0034] Figure 4 : Fluorescence intensity comparison diagram between the integrated recombinant engineered bacteria obtained in Example 3 and the dominant Saccharomyces cerevisiae obtained in Example 2, where the control group: dominant Saccharomyces cerevisiae, engineered bacteria: integrated recombinant engineered bacteria;

[0035] Figure 5 : Fluorescence-labeled flow cytometry detection results of different compoundings of the engineered bacterium FSC01 and the dominant yeast strain in Example 2, 10 7 represents the control group (engineered bacterium FSC01 with a concentration of 10 7 / m), 10 6 、10 5 、10 4 、10 3 、10 2 、10 1 、10 0 represent the addition amount ( / mL) of the engineered bacterium FSC01 in the compounded bacterial solutions of the experimental group;

[0036] Figure 6 : Relationship diagram between the addition amount of engineered bacterium FSC01 and the cell concentration in the compound bacterial liquid measured by flow cytometry;

[0037] Figure 7 : Fluorescence-labeled flow cytometry detection results of the compound of engineered bacterium FSC01 and different fermented grains samples. 10 7 represents the control group (engineered bacterium FSC01 with a concentration of 10 7 / m), 10 6 、10 5 、10 4 、10 3 、10 2 、10 1 represent the addition amount ( / mL) of engineered bacterium FSC01 in the compound fermented grains of the experimental group;

[0038] Figure 8 : Relationship diagram between the addition amount of engineered bacterium FSC01 and the cell concentration in the compound fermented grains measured by flow cytometry;

[0039] Figure 9 : Relationship diagram between the addition amount of engineered bacterium FSC01 and the cell concentration in the compound fermented grains measured by flow cytometry;

[0040] Figure 10 : Diagram of the plate counting of the Saccharomyces cerevisiae microbiota in the fermented grains with different addition ratios of engineered bacterium FSC01 during fermentation. Among them, 0: no addition of engineered bacterium FSC01, 10 3 : Addition ratio 10 3 / kg, 10 5 : Addition ratio 10 5 / kg;

[0041] Figure 11 : Schematic diagram of the application of engineered bacterium FSC01 in the solid-state fermentation process. Among them, fluorescence-enhanced microorganism: engineered bacterium FSC01;

[0042] Figure 12 : Relationship diagram of the change in the lg value of the cell concentration of engineered bacterium FSC01 with the number of days of solid-state fermentation;

[0043] Figure 13 : Diagram of the plate counting of the Saccharomyces cerevisiae microbiota during the fermentation in Example 7. Detailed implementation manners

[0044] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0045] All the reagents involved in the embodiments of the present invention are purchased through commercial channels, and the methods not mentioned are conventional experimental methods, which will not be elaborated here one by one.

[0046] The following reagents are for illustrative purposes:

[0047] 2×Phanta Flash MasterMix (Dye Plus), plasmid pUC19, Gel Extraction / DNA Purification Kit (FastPure Gel DNA Extraction Mini Kit), Exnase MultiS, and Plasmid Extraction Kit (FastPure Plasmid Mini Kit) are all purchased from Nanjing Novoprotein Scientific Inc.

[0048] Competent Escherichia coli DH5α are all purchased from Beijing Tsingke Biotechnology Co., Ltd.

[0049] The formula (w / v) of YPD medium is: 1% Yeast Extract, 2% Peptone, 2% Dextrose (glucose), and the rest is water.

[0050] YPD agar medium: Add 2% (w / v) agar powder to the YPD medium.

[0051] WL differential medium is purchased from Shanghai Haoran Biotechnology Co., Ltd.

[0052] Example 1 Obtaining of Integrated Expression Donor DNA

[0053] (1) Cloning of DNA elements

[0054] Using plasmid pUC19 as the backbone, with the green fluorescent protein gene GFP (Sequence ID: KY132015.1) and the geneticin resistance gene G418 (Sequence ID: KX431576.1) as expression elements, select 1000 bp upstream and downstream of the stable site X3 (Sequence ID: Z49380.1) as the upstream and downstream homologous arms for integration, and select P TDH3 (Sequence ID: Z72977.1) and P TEF1(Sequence ID: U51033.2) were used as the promoters of GFP and G418 respectively, and T ADH1 (Sequence ID: KR232318.1) and T CYC1 (Sequence ID: KJ502283.1) were used as the terminators of GFP and G418 respectively to construct the integrated recombinant plasmid.

[0055] Using the above DNA elements as templates, PCR amplification of the above DNA elements was carried out with the sequences shown in Table 1 as primers. The PCR amplification system was: 1 μL of DNA template, 1 μL each of the upstream and downstream primers with a concentration of 10 mM, 25 μL of 2×PhantaFlash MasterMix (Dye Plus), and 22 μL of sterilized ddH2O; the PCR amplification program was: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 55°C for 1 min, extension at 72°C for 60 s, for 30 cycles; extension at 72°C for 10 min to obtain the PCR amplification product. The PCR product was detected by agarose gel electrophoresis, and the PCR product with the size corresponding to the target fragment in Table 1 was the correct one.

[0056]

[0057]

[0058] (2) Construction of the recombinant plasmid

[0059] After recovering the 9 groups of PCR amplification products that were correctly detected in step (1) using a gel extraction / DNA purification kit, prepare the following homologous recombination system: Add the 9 groups of DNA fragments according to the amount of 20 ng / kb, 10 μL of Exnase MultiS enzyme, and supplement with sterile ddH2O to 20 μL. After incubating the prepared system at 50 °C for 30 min for the recombination reaction, then perform a protein denaturation reaction at 85 °C for 5 min; According to the product manual of competent Escherichia coli DH5α (Beijing Tsingke Biotechnology Co., Ltd.), chemically transform the above reaction-terminated system into competent Escherichia coli DH5α, spread it on an LB solid medium plate containing 100 mg / L ampicillin, culture overnight at 37 °C, pick 5 samples of positive clones, and use F1 (GGTGCATATATGGCATCGTTA, SEQ ID NO.19) and R1 (TTTGTACAATTCATCCATACCATGG, SEQ ID NO.20) as primers to perform PCR detection on the above samples respectively. The PCR amplification system is: 1 μL of bacterial solution, 0.4 μL of each of the forward and reverse primers with a concentration of 10 mM, 10 μL of 2×Phanta Flash MasterMix (Dye Plus), and 8.2 μL of sterile ddH2O; The PCR amplification program is the same as (1), and a target fragment with a size of 1600 bp is amplified (such as Figure 1 the 1st, 3rd, and 5th lanes in

[0060] (3) Obtaining of donor DNA

[0061] Select the above-mentioned clones with correct sequencing for scale-up culture, extract the plasmid using a plasmid extraction kit (FastPure Plasmid Mini Kit), and perform an enzymatic digestion reaction on the obtained plasmid with smaI. The reaction system is: 30 μL of plasmid DNA, 4 μL of reaction buffer, 2 μL of sma endonuclease, and 4 μL of sterile ddH2O. The reaction program is enzymatic digestion at 37 °C for 120 min; protein denaturation at 85 °C for 5 min; Perform agarose gel electrophoresis confirmation and recovery on the reaction-terminated system, sequence the recovered product, and obtain the nucleotide sequence fragment shown in SEQ ID NO.21, which is the integrated recombinant expression donor DNA.

[0062] Example 2 Obtaining of the dominant Saccharomyces cerevisiae single strain as the host bacterium

[0063] (1) Obtaining of fermented grains samples

[0064] Using Guizhou Hongyingzi sorghum as the raw material for solid-state fermentation, and medium-high temperature Daqu made from wheat:pea:barley with a mass ratio of 6:2:2, the fermented grains after 10 days of fermentation in a simulated solid-state fermentation system were obtained. The specific operation was as follows: Take 500 g of sorghum and crush it into 4 - 8 pieces per grain. Add 300 mL of hot water above 90 °C according to 60% of the raw material amount, stir evenly, cover with four layers of gauze and stack for 24 h, then transfer to the pot grate and steam for about 80 min. Take out the distiller's grains while it is hot and add 100 mL of cold water according to 20% of the raw material amount. Disperse the grains, stir, and cool the grains. When the grains are cooled to room temperature (<30 °C), add 100 g of the above-mentioned medium-high temperature Daqu flour (the Daqu is crushed into sesame seed size) according to 20% of the raw material amount, mix well, and then ferment in the vat at room temperature for 10 days.

[0065] (2) Screening and identification of superior Saccharomyces cerevisiae strains

[0066] Take 1 g of the fermented grains sample obtained above, add 10 mL of distilled water, shake and mix well. After standing for 1 min, take the suspension, and dilute it with distilled water in a 10-fold gradient. Take 0.1 mL of the diluted samples with different concentrations and spread them on the YPD agar medium plate. Incubate at 28 °C for 3 days. Pick single colonies and inoculate them into the WL differential medium by the method of streaking on the plate. Incubate at 28 °C for 5 - 7 days, observe the colony characteristics, and screen out the colonies that are cream-colored with green, opaque, spherical, smooth, and protruding in shape (see Figure 2 ). Pick monoclonal colonies and shake the bacteria, and send them to Beijing Tsingke Biotechnology Co., Ltd. for sequencing. The colonies with 100% homology between the measured 26S rDNA sequence and the 26S rDNA sequence (Sequence ID: HM191639.1) of Saccharomyces cerevisiae in the NCBI database were obtained, and the strain with the largest proportion among the isolated colonies was selected as the superior strain. In the present invention, the strain accounting for 87.5% of the total number of isolated colonies was selected as the superior strain. Different fermented grains samples have different percentages of superior Saccharomyces cerevisiae among the total number of isolated colonies, and the one with the largest value can be selected.

[0067] Example 3 Construction of integrated recombinant engineering bacteria

[0068] Based on the integrated expression donor DNA obtained in Example 1, using the superior Saccharomyces cerevisiae strain screened in Example 2 as the host bacterium, an integrated strain was constructed. The specific operation was as follows:

[0069] (1) Preparation of electrocompetent cells

[0070] The dominant yeast strains screened in Example 2 were inoculated into 20 mL of YPD medium and cultured at 250 rpm at 30 °C until OD600 = 1. The bacterial solution was collected by a centrifuge tube, and centrifuged at 3000 rpm for 3 min at 4 °C; the supernatant was discarded, 20 mL of pre-cooled ddH2O was added, and the cells were resuspended by pipetting, and centrifuged at 3000 rpm for 3 min at 4 °C; the supernatant was discarded, 20 mL of pre-cooled sorbitol (1 mol / L) was added, and the cells were resuspended by pipetting, and centrifuged at 3000 rpm for 3 min at 4 °C; the supernatant was discarded, 16 mL of pre-cooled sorbitol (1 mol / L), 2 mL of 10×TE buffer and 2 mL of 10×LiOAc solution were added, and the cells were resuspended by pipetting; the centrifuge tube was shaken at 250 rpm at 30 °C for 30 min; 200 μL of reagent DTT (1 mol / L) was added, and shaken for 15 min for recovery; centrifuged at 3000 rpm for 3 min at 4 °C; the supernatant was discarded, 20 mL of pre-cooled sorbitol (1 mol / L) was added, and the cells were resuspended by pipetting, centrifuged at 3000 rpm for 3 min at 4 °C, the supernatant was discarded, 20 mL of pre-cooled sorbitol (1 mol / L) was added again, and the cells were resuspended by pipetting, centrifuged at 3000 rpm for 3 min at 4 °C; the supernatant was discarded, and the cells were resuspended with 300 μL of sorbitol (1 mol / L) at 4 °C, aliquoted, and the electrotransformation-competent bacterial solution was obtained.

[0071] (2) Electrotransformation

[0072] Take 100 μL of the electrotransformation-competent bacterial solution obtained in (1), add 2000 ng of the integrated recombinant expression donor DNA, gently pipette and mix well, transfer it into a single transformation cup (pre-cooled), and transfer it to a gene introduction instrument for instantaneous electric shock to achieve electrotransformation. The specific conditions are: voltage 1.5 kV, capacitance 25 μF, resistance 200 Ω.

[0073] (3) Monoclonal screening

[0074] Add 0.5 mL of YPD medium + 0.5 mL of sorbitol (1 mol / L) mixed solution to the transformed bacterial solution, pipette and mix well, transfer it into a shaking tube (specification 15 mL), shake and recover at 250 rpm at 30 °C for 4 h, centrifuge at 3000 rpm for 3 min, discard part of the supernatant, leave 100 μL of the supernatant and mix it with the cells, spread it on a solid plate of YPD medium containing 100 ng / mL geneticin, and incubate at 30 °C for 48 - 72 h until colonies grow out.

[0075] Eight bacterial solutions with colonies grown were taken as PCR detection samples, and PCR detection was performed on the above samples using F2 (TGAACATGCAGATATTGATGAAGACA, SEQ ID NO.22) and R2 (TTTGTACAATTCATCCATACCATGG, SEQ ID NO.23) as primers. The PCR amplification system was as follows: 1 μL of bacterial solution, 0.4 μL each of forward and reverse primers with a concentration of 10 mM, 10 μL of 2×PhantaFlash MasterMix (Dye Plus), and 8.2 μL of sterilized ddH2O; the PCR amplification program was the same as in Example 1(1), and a target fragment of 2500 bp in size was amplified (such as Figure 3 in lanes 3, 6, and 8), which was the successfully constructed integrated recombinant engineering bacteria.

[0076] (4) Verification of fluorescent protein expression

[0077] The successfully constructed integrated recombinant engineering bacteria were picked and inoculated into YPD medium at an inoculation amount of 1% (v / v), and cultured at 30 °C and 250 rpm with constant shaking for 24 h. The bacterial solution was taken to detect the fluorescence signal in the FITC channel of the flow cytometer. The dominant Saccharomyces cerevisiae strain screened in Example 2 at the same concentration was used as a control, and it was confirmed that the integrated recombinant engineering bacteria constructed in the present invention could normally express fluorescent protein ( Figure 4 ), and this engineering bacteria was named FSC01.

[0078] Fluorescence specificity detection of engineering bacteria FSC01 in Example 4

[0079] To confirm that the fluorescence signal only comes from engineering bacteria FSC01, rather than other background interferences. Further verify the linear relationship between the fluorescence signal intensity and the number of target microorganisms (engineering bacteria FSC01), and evaluate the accuracy of the fluorescent protein labeling technology in quantitative detection. The specific experiment is as follows:

[0080] Control group: Engineering bacteria FSC01 with a concentration of 10 7 / mL, denoted as 10 7 ;

[0081] Blank group: Dominant yeast strain (screened in Example 2) with a concentration of 10 7 / mL;

[0082] Experimental group: Using the bacterial solution of the blank group as a diluent, the engineering bacteria FSC01 with a concentration of 10 7 / ml was diluted at a gradient of 10 1 -10 7 , and were respectively denoted as 10 6 , 10 5 , 10 4 , 103 , 10 2 , 10 1 , 10 0 ;

[0083] A flow cytometer was used to detect the fluorescence signals of the control group and the experimental group, and the flow cytometry plot shown as Figure 5 was obtained. Further analysis of the data showed the relationship between the added amount of the engineered bacterium FSC01 in the bacterial solution and the cell concentration measured by flow cytometry, as shown in Table 2.

[0084]

[0085]

[0086] Taking the lg value of the cell concentration in Table 2 as the ordinate and the added amount of the engineered bacterium FSC01 as the abscissa for linear regression, the linear relationship plot shown as Figure 6 was obtained. When the added amount of the engineered bacterium FSC01 was in the range of 10 2 / mL to 10 7 / mL, the linear equation was y = 0.9554x + 2.2753; the correlation coefficient R 2 = 0.998, indicating a significant linear relationship between the added amount of the engineered bacterium FSC01 and the lg value of the cell concentration. It can be seen that the fluorescence signal value of the green fluorescent protein of the engineered bacterium FSC01 is very strong and can be used for specific detection by flow cytometry.

[0087] Example 5 Fluorescence Detection of the Engineered Bacterium FSC01 after Being Mixed with Fermented Grains

[0088] To verify the stability, quantitative accuracy of the engineered bacterium FSC01 in a complex fermentation environment and its feasibility as a biological indicator. The specific experiment is as follows:

[0089] Control group: The engineered bacterium FSC01 with a concentration of 10 7 / mL, denoted as 10 7 ;

[0090] Blank group: The fermented grains suspension in Example 2 (i.e., the fermented grains sample in Example 2(1) was mixed with distilled water at a solid-liquid ratio of 1 g:10 mL, shaken well, and allowed to stand for 1 min to obtain).

[0091] Experimental group: Using the fermented grains suspension in the blank group as the diluent, the engineered bacterium FSC01 with a concentration of 10 7 / ml was serially diluted at 10 1 -10 6 gradients, and were respectively denoted as 10 6 , 10 5 , 10 4 , 10 3 , 102 and 10 1 ;

[0092] A flow cytometer was used to detect the fluorescence signals of the control group and the experimental group, and a flow cytometry plot as shown in Figure 7 was obtained. Among them, the P4 region is the region where the engineered bacterium FSC01 is located. According to the number of cells in this region and the measured volume, the cell concentration can be obtained. Further analysis of the above data shows the relationship between the addition amount of the engineered bacterium FSC01 in the fermented grains and the cell concentration measured by flow cytometry, as shown in Table 3.

[0093]

[0094] Taking the lg value of the cell concentration in Table 3 as the ordinate and the addition amount of the engineered bacterium FSC01 as the abscissa for linear regression, a linear relationship plot as shown in Figure 8 was obtained. When the addition amount of the engineered bacterium FSC01 is in the range of 10 2 / mL to 10 7 / mL, the linear equation is y = 0.842x + 2.5562; the correlation coefficient R 2 = 0.9811, indicating a significant linear relationship between the addition amount of the engineered bacterium FSC01 and the lg value of the cell concentration. It can be seen that the fluorescence signal value of the green fluorescent protein of the engineered bacterium FSC01 is very strong and can be used to characterize the succession law of the Saccharomyces cerevisiae microbiota in the fermented grains.

[0095] Example 6 Determination of the Optimal Initial Concentration of the Engineered Bacterium FSC01 in Fermented Grains

[0096] If the inoculation concentration of the engineered bacterium FSC01 in the fermented grains is too low, it is not conducive to the reproduction of the engineered bacterium FSC01. If the inoculation amount is too high, it may interfere with the growth of the original Saccharomyces cerevisiae flora in the fermented grains. Therefore, it is necessary to comprehensively consider the detectable fluorescence value and the normal growth of other Saccharomyces cerevisiae in the fermented grains during fermentation to obtain the optimal initial addition amount of the fluorescent bacterium. To ensure that the fluorescence signal can be effectively detected and avoid interfering with the growth of the original microbial flora in the fermented grains, it is necessary to determine the optimal initial inoculation concentration of the engineered bacterium FSC01 in the fermented grains. The specific experiment is as follows:

[0097] (1) In the experimental group, the engineered bacterium FSC01 was added to an equal amount of fermented grains (prepared in Example 2) at a ratio of 10 1 , 10 3 , 10 5 per kilogram of fermented grains, and were correspondingly denoted as 10 1 / kg, 10 3 / kg, 10 5 / kg; the control group was an equal amount of fermented grains (prepared in Example 2), denoted as 0 / kg. After fermenting in the vat at room temperature for 6 days, a flow cytometer was used to detect the fluorescence signals of the control group and the experimental group, and a plot as shown inFigure 9 From the shown flow chart, it can be seen that for the engineered bacterium FSC01 in fermented grains, the fluorescence intensity shown at an addition amount of 10 1 / kg has no significant difference from that of the control group (0 / kg), indicating that the addition ratio of 10 1 / kg is too low and is not conducive to the collection of fluorescence data by flow cytometry. For the engineered bacterium FSC01 in fermented grains, the fluorescence intensities shown at addition amounts of 10 3 / kg and 10 5 / kg are relatively high. Among them, the microbial populations with stronger green fluorescence signals (at the position of phylum P4) account for 0.26% and 2.52% respectively, and can be significantly distinguished from the non-fluorescent microbial populations;

[0098] (2) To further verify whether the engineered bacterium FSC01 added at the ratios of 10 3 / kg and 10 5 / kg affects the fermentation of the original fermented grains, experimental groups were set up by adding the engineered bacterium FSC01 at the ratios of 10 3 and 10 5 per kilogram of fermented grains to an equal amount of fermented grains (prepared in Example 2), and were correspondingly denoted as 10 3 and 10 5 ; the control group was an equal amount of fermented grains (prepared in Example 2), denoted as 0. They were fermented in the vat at room temperature for 28 days. Starting from the 2nd day of fermentation, every 2 days during this period, the plate counting method was used to monitor the change rule of the Saccharomyces cerevisiae microbiota during the fermentation process. The specific operation was as follows: Take 1 g of fermented grain sample, add distilled water and shake well according to the solid-liquid ratio of 1 g:10 mL, continue to dilute with distilled water by 1000 times, take 30 μL and coat it on the plate for counting. The results are shown in Figure 10 .

[0099] From Figure 10 it can be seen that the change trend of the number of Saccharomyces cerevisiae in the fermented grains with 10 3 , 10 5 engineered bacteria FSC01 added per kilogram is consistent with that in the fermented grains without the addition of the engineered bacterium FSC01. That is, as the fermentation time prolongs, the number of Saccharomyces cerevisiae decreases, indicating that the additional addition of 10 3 / kg and 10 5 / kg of the engineered bacterium FSC01 does not affect the growth of the Saccharomyces cerevisiae microbiota in the fermented grains itself. Therefore, in order to enhance the fluorescence intensity as much as possible, an addition amount of 10 5 / kg was used as the optimal initial concentration of the engineered bacterium FSC01 in the fermented grains for subsequent fermentation experiments.

[0100] Application of the engineered bacterium FSC01 in the monitoring of the solid-state fermentation process of Chinese liquor

[0101] With reference to the production process of Maotai-flavor liquor and based on the actual conditions of the laboratory, using Guizhou Hongyingzi sorghum as the raw material for solid-state fermentation and medium-high temperature Daqu made with wheat:pea:barley in a mass ratio of 6:2:2, a small-scale simulated solid-state fermentation process was designed. During the fermentation process, engineering bacteria FSC01 were used for monitoring. The operation process is as follows:

[0102] Crushing: Weigh 500 g of sorghum and crush it into 4 - 8 pieces per grain;

[0103] Moistening and piling up: Add 300 mL of hot water above 90 °C to the crushed sorghum at a ratio of 60% of the raw material amount, stir evenly, cover with four layers of gauze and pile up for 24 h; On the day of moistening the grains, activate and expand the culture of engineering bacteria FSC01 (pick engineering bacteria FSC01 and inoculate it into YPD medium, culture at 30 °C and 200 r / min for 24 h);

[0104] Steaming the grains: Adopt the method of steaming alone. Wrap the moistened grains with the gauze covering the moistening and steam them on the pot grate. After the steam comes up, steam for about 80 min; At the same time, verify the engineering bacteria FSC01 to be added with a flow cytometer to ensure its normal expression;

[0105] Cooling while spreading: After the steaming of the grains is completed, take them out of the steamer while they are hot, and add 100 mL of cold water at a ratio of 60% of the raw material amount to disperse the grain particles and further absorb water. Then stir and cool the grains; Before the cooling is completed, measure the OD600 value of engineering bacteria FSC01 with a spectrophotometer, and prepare a 10 7 proportion to make a 10 5 / mL solution of engineering bacteria FSC01;

[0106] Mixing with Daqu: Crush the Daqu into the size of sesame seeds, with the maximum not exceeding the size of mung beans. Wait until the grains cool down to room temperature (<30 °C), and add 100 g of the above-mentioned medium-high temperature Daqu flour (crushed Daqu into the size of sesame seeds) at a ratio of 20% of the raw material amount, and stir evenly; At the same time, add engineering bacteria FSC01 at an addition amount of 10 5 / kg. The specific operation is to dilute the original bacterial solution containing 10 5 engineering bacteria FSC01 to 100 mL of water, shake well and mix it into the above-mentioned grain mash;

[0107] Fermentation in the vat: Use a 5 L sealed tank as the fermentation container, load the grain mash and seal it, and ferment at room temperature.

[0108] Starting from the time of putting into the vat, take a detection sample every 2 days. Each time, take one sample from the surface layer and the inner layer, mix them evenly as the detection sample, and conduct flow cytometer detection. The specific operation is as follows: Add 5 g of the detection sample and 30 mL of sterilized PBS buffer solution to the centrifuge tube, vortex and shake for 1 min, let it stand for 5 min, and take the supernatant for flow cytometer detection. The results are as Figure 12 shown, byFigure 12 It can be seen that during the 28-day fermentation process, the succession law of the Saccharomyces cerevisiae microbiota shows a trend of increasing first and then decreasing, reaching the peak in the first week of fermentation, starting to decline in the third week of fermentation, and the Saccharomyces cerevisiae population also drops to a very low concentration at the end of the fermentation cycle. After 30 days of fermentation, the fermented grains in the fermentation tank are subjected to high-temperature distillation, and a total of 150 ml of base liquor is obtained. After testing with an alcohol meter, baijiu with an alcohol content of 60.47 degrees is obtained, and the actual liquor yield is 0.1335 kg. According to the formula raw material liquor yield = actual liquor production quality / total raw material quality × 100%, the liquor yield is calculated to be 26.7%. The normal liquor yield in the industry for the solid-state fermentation process of Maotai-flavor baijiu is 20% - 30%, indicating that the fermentation of the simulated solid-state fermentation process experiment of the present invention is normal.

[0109] Take 1 g of each of the above series of test samples, and shake and mix them with distilled water according to the solid-liquid ratio of 1 g:10 mL. Then continue to dilute them 1000 times with distilled water. Take 30 μL and coat it on the plate for counting to monitor the change law of the Saccharomyces cerevisiae microbiota during the fermentation process. The results are shown in Figure 13 . From Figure 13 It can be seen that during the 28-day fermentation process, the succession law of the Saccharomyces cerevisiae microbiota is consistent with the results measured by flow cytometry, and it also shows a trend of increasing first and then decreasing, reaching the peak in the first week of fermentation, starting to decline in the third week of fermentation, and the Saccharomyces cerevisiae population also drops to a very low concentration at the end of the fermentation cycle.

[0110] In this specification, each embodiment is described in a progressive manner. The key point of each embodiment is to illustrate the differences from other embodiments. For the same and similar parts among the embodiments, reference can be made to each other.

[0111] The above description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be obvious to those skilled in the art. The general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to these embodiments shown herein, but will conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A rapid detection method for the succession law of Saccharomyces cerevisiae in the solid-state fermentation of Chinese liquor, characterized in that, It includes the following steps: (1) Screen out the dominant single strain of Saccharomyces cerevisiae from the fermented grains used for fermentation; (2) Introduce the integrated donor DNA fragment into the dominant single strain of Saccharomyces cerevisiae obtained in step (1) to construct an engineered bacterium FSC01 capable of expressing fluorescent protein; (3) In the koji mixing stage of solid-state fermentation, add the engineered bacterium FSC01 into the grain mash together with the Daqu and ferment in the vat together; (4) Starting from putting into the vat, take samples regularly, conduct flow cytometry detection, and record the lg value of cell concentration.

2. The rapid detection method for the succession law of Saccharomyces cerevisiae in the solid-state fermentation of Chinese liquor according to claim 1, wherein, The screening process of the dominant single strain of Saccharomyces cerevisiae described in step (1) is as follows: S1. After gradient dilution of the suspension of the fermented grain mash sample, coat it on a YPD agar medium plate for enrichment culture, then pick single colonies and streak plate on a WL differential medium, and observe the colony characteristics after culturing for a period of time; S2. Screen out the colonies that are cream-colored with green, opaque, spherical, smooth, and protruding in shape from the colonies obtained in step S1, pick single clones for shaking culture and then sequence, and perform homology comparison with the Saccharomyces cerevisiae 26S rDNA sequence with Sequence ID HM191639.1 in the NCBI database; S3. Select the colonies with 100% homology data in step S2, and the strain with the largest percentage among the isolated colonies is the dominant single strain of Saccharomyces cerevisiae.

3. The rapid detection method for the succession law of Saccharomyces cerevisiae in the solid-state fermentation of Chinese liquor according to claim 1, wherein, The nucleotide sequence of the integrated donor DNA fragment described in step (2) is as shown in SEQ ID NO.

21.

4. The rapid detection method for the succession law of Saccharomyces cerevisiae in the solid-state fermentation of Chinese liquor according to claim 3, characterized in that The integrated donor DNA fragment is obtained by the following steps: a. PCR amplify the DNA elements of plasmid pUC19, green fluorescent protein gene GFP, geneticin resistance gene G418, 1000 bp sequences upstream and downstream of the stable site X3, P TDH3 , P TEF1 , T ADH1 and T CYC1 respectively. b. After verifying the correctness of the PCR product obtained in step a, respectively recover and purify it by gel electrophoresis, mix them together for homologous recombination reaction, transform into Escherichia coli competent cells, screen positive clones, and extract plasmids for PCR verification; c. Use sma endonuclease to perform enzymatic digestion on the plasmid verified correctly in step b, recover by gel electrophoresis and verify by sequencing, and the nucleotide sequence as shown in SEQ ID NO.21 is the integrated donor DNA fragment.

5. The rapid detection method for the succession law of Saccharomyces cerevisiae in the solid-state fermentation of Chinese liquor according to claim 1, characterized in that, The construction process of the engineered bacterium FSC01 described in step (2) is: electrotransform the integrated donor DNA fragment into the competent cells of the dominant single strain of Saccharomyces cerevisiae, screen positive clones, perform PCR verification, after expanding the culture of the successfully verified clones, perform fluorescence signal detection, and the clones capable of normally expressing fluorescent protein are the engineered bacterium FSC01.

6. The rapid detection method for the succession law of Saccharomyces cerevisiae in solid-state fermentation of Chinese liquor according to claim 1, characterized in that The addition amount of the engineered bacterium FSC01 described in step (3) in the grain mash is 10 5 / kg.

7. Application of a rapid detection method for the succession law of Saccharomyces cerevisiae in solid-state fermentation of Chinese liquor according to any one of claims 1-6 in the improvement of brewing technology.

8. The application according to claim 7, characterized in that, It includes the following improvements: (1) Predict the liquor yield of the pit and determine the priority order of liquor distillation; (2) Evaluate the fermentation situation in the pit and optimize the fermentation parameters; (3) Optimize the brewing process flow and improve the flavor of the liquor body.

Images