Kit for detecting optimal application time of near-infrared vibration orthodontic accelerator and application thereof

Abstract

The invention discloses a kit for detecting the optimal application time of a near-infrared vibration orthodontic accelerator and application of the kit, and belongs to the technical field of biology. Specifically, the invention relates to a primer group and a kit prepared by using the primer group and used for monitoring the optimal application time of the near-infrared vibration orthodontic accelerator, the kit comprises the primer group targeting six genes of SPON2, ABHD4, BMAL1, BCL3, ATP6V1B2 and GAPDH, and the optimal application time of the orthodontic accelerator is obtained by detecting the expression level of the genes and substituting the expression level into a formula. Compared with the prior art, the near-infrared orthodontic accelerator hour correction strategy provided by the invention has the advantages that the optimal application hour of the accelerator is detected by collecting the blood of an orthodontic patient twice, so that the accelerator can exert a better treatment effect, and a doctor can be helped to arrange an orthodontic plan of the patient more scientifically and reasonably according to the optimal application hour; therefore, personalized precise treatment is realized, and the orthodontic process of the patient is effectively shortened.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a kit for detecting the optimal application time of a near-infrared vibration orthodontic accelerator and its application. Background Art

[0002] Malocclusion is a disease of abnormal growth and development of the jaws. In recent years, the incidence rate has been increasing year by year, seriously affecting the oral and maxillofacial functions, physical and mental health of patients. With the development of medical technology and the improvement of patient needs, the scale of the orthodontic market has been growing continuously. However, there are still many deficiencies in the current orthodontic treatment plans, such as a relatively long treatment course, a slow rate of tooth movement, and being prone to complications such as root resorption, tooth loosening, and enamel demineralization, often causing discomfort and distress to patients.

[0003] Most of the existing orthodontic acceleration methods on the market adopt various orthodontic accelerator devices. Among them, the principle of the near-infrared oral orthodontic accelerator is to stimulate the metabolic activities of the jaws with low-intensity laser to accelerate the movement of teeth in the jaws. It has the advantages of few side effects, small invasiveness, simple operation, non-invasive and painless, and is more suitable for promotion among orthodontic patients. Summary of the Invention

[0004] Related research reports show that the metabolic activities of bone tissue have significant circadian rhythm characteristics. Therefore, we propose a concept of chronotherapy using a near-infrared oral orthodontic accelerator in accordance with the rhythm of jaw metabolic activities. Blood samples are taken from orthodontic patients for detection and the optimal time period for using the near-infrared oral orthodontic accelerator for the patient is calculated, so as to achieve personalized and precise application of the near-infrared oral orthodontic accelerator, shorten the orthodontic treatment course, reduce adverse complications, construct a healthy and efficient new treatment model, and lead the technological innovation of orthodontics. After preliminary retrieval, it is found that there are no related invention patents at present.

[0005] To achieve the above object, the present invention adopts the following technical solutions: In the first aspect, the present invention provides a primer set, which comprises 5 primer pairs targeting the following 5 genes: SPON2, ABHD4, BMAL1, BCL3, ATP6V1B2, and is composed of the nucleotide sequences shown in SEQ ID NO.1-10.

[0006] In the second aspect, the present invention also provides the application of the primer set in the preparation of a product for detecting the optimal application time of a near-infrared orthodontic accelerator.

[0007] Further, the product is a kit.

[0008] Further, the kit also includes a primer pair for an internal reference gene.

[0009] Further, the internal reference gene is GAPDH.

[0010] Furthermore, the kit further includes mRNA rapid extraction reagent, reverse transcription reagent, and PCR quantification reagent.

[0011] Furthermore, the reverse transcription reagent includes ABScript HII Reverse Transcriptase reagent.

[0012] Furthermore, the detection method is as follows: Collect blood samples once in the morning and once in the afternoon on the same day, pre-treat the blood samples, measure the CT values of SPON2, ABHD4, BMAL1, BCL3, and ATP6V1B2 genes in the samples through PCR reaction, and calculate the expression levels of SPON2, ABHD4, BMAL1, BCL3, and ATP6V1B2 twice after normalization with GAPDH; Convert the time points of the two blood sample collections into decimal numbers, take the average value and subtract 14 to get the value of X1; When the expression level of BMAL1 in the first sample is higher than that in the second sample, record X2 = -1, otherwise record X2 = 1; When the expression level of SPON2 in the first sample is higher than that in the second sample, record X3 = -1, otherwise record X3 = 1; When the expression level of ABHD4 in the first sample is higher than that in the second sample, record X4 = -1, otherwise record X4 = 1; When the expression level of BCL3 in the first sample is higher than that in the second sample, record X5 = -1, otherwise record X5 = 1; When the expression level of ATP6V1B2 in the first sample is higher than that in the second sample, record X6 = -1, otherwise record X6 = 1; Subsequently, a six-variable linear regression equation is derived for the gene to be tested, and the obtained formula is the peak time point of BMAL1 expression = 14.9496 + 0.2891*X1 + 3.6794*X2 + 0.5173*X3 - 0.6058*X4 - 0.4124*X5 + 0.4119*X6; Compare the obtained values of X1, X2, X3, X4, X5, and X6, substitute them into the formula to calculate the peak time point of BMAL1 expression, and the obtained time point is the optimal application time of the near-infrared orthodontic accelerator.

[0013] Furthermore, the PCR reaction system is as follows: Reagent Dosage Forward primer 0.4 μL Reverse primer 0.4 μL 2X MultiF Seamless Assembly Mix 10 μL cDNA sample 2 μL <![CDATA[RNase-Free H2O]]> 7.2 μL 。

[0014] Furthermore, the PCR reaction procedure is as follows: 。

[0015] Compared with the prior art, the present invention has the following beneficial effects: The concept of chronotherapy has been promoted clinically, but there is no clear application strategy for the current existing near-infrared orthodontic accelerators in this regard. The chronotherapy strategy of the near-infrared orthodontic accelerator proposed in the present invention enables the accelerator to exert a greater therapeutic effect by collecting the blood of orthodontic patients twice to detect the optimal application time, which can help doctors arrange the orthodontic plan for patients more scientifically and reasonably, thereby achieving personalized and precise treatment and more effectively shortening the orthodontic process of patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1A It is a heat map of the sequencing results of the periodontal tissue of orthodontic rats after stimulation in Example 1; Figure 1B It is a bubble chart of the enrichment analysis of differentially expressed genes in the sequencing results of the periodontal tissue of orthodontic rats in Example 1; Figure 2 After the rat model in Example 1 was given stimulation Bmall Gene expression; Figure 3A It is a CT scan result map of tooth movement after applying near-infrared stimulation in different modes to the orthodontic rat model in Example 1; Figure 3B It is a statistical analysis result map of tooth movement after applying near-infrared stimulation in different modes to the orthodontic rat model in Example 1; DETAILED DESCRIPTION OF THE EMBODIMENTS

[0017] For a better illustration of the present invention, the following examples are specifically listed. Obviously, the described examples are only a part of the present invention, rather than all the examples. Other examples obtained by those skilled in the art based on the examples in the present invention without making creative efforts all fall within the scope of protection of the present invention.

[0018] The technical solution of the present invention will be further described below with reference to the drawings and examples.

[0019] Example 1

[0020] An orthodontic rat model was constructed. After collecting the periodontal tissue of rats at time points, extracting RNA and performing transcriptome sequencing, the circadian rhythm characteristics of gene expression patterns were judged. 2988 genes with circadian rhythmic expression were detected, and these genes can be called clock-controlled genes. Enrichment analysis was performed on the related genes, and pathways such as biological clock, ATPase activity, tricarboxylic acid metabolic process, polysaccharide metabolic process, fatty acid metabolic process, cellular carbohydrate metabolic process, osteoblast differentiation, and bone mineralization could be enriched.

[0021] The chronotherapeutic concept has been widely applied clinically. By conforming to the rhythmicity of the metabolic activities of the remodeling jawbone and applying near-infrared stimulation during the stage of the most vigorous metabolism, the orthodontic jawbone remodeling effect can be achieved with twice the result with half the effort. Circadian clock genes control the circadian rhythm of the expression pattern of clock-controlled genes and also control the cycle phase of the expression rhythm of clock-controlled genes. Therefore, the optimal time period for applying the near-infrared oral orthodontic accelerator can be determined by detecting the expression rhythm phase of the Bmal1 unique and irreplaceable core gene of the circadian clock.

[0022] Collect rat blood samples at different time points (3 samples per group), and detect the Bmal1 expression level by qPCR to clarify the time points of the Bmal1 expression peak and trough, which are ZT0 and ZT12 respectively. Establish a rat orthodontic model: 6 rats per group, a total of 7 groups. Anesthetize Sprague-Dawley rats (SD rats) raised in the FPS environment (intraperitoneal injection of sodium pentobarbital at 40 mg / kg), pass a ligature wire between the first molar and the second molar in the maxilla, connect a nickel-titanium coil spring to the mesial side of the first molar, and connect the other end of the spring to the ligature wire as well; before starting orthodontic force application, use a dynamometer to determine the stretching length of the spring under a force of 50 g, and use a high-speed turbine handpiece to grind a undercut at the neck of the ipsilateral central incisor to fix the ligature wire and connect it to the other end of the nickel-titanium coil spring. Apply near-infrared stimulation on the basis of the rat orthodontic animal model, and apply near-infrared light stimulation for 15 minutes at the time points when the Bmal1 expression is higher (ZT0, ZT3, ZT21) and the time points when the expression is lower (ZT6, ZT12, ZT15). Another group is non-chronotherapeutic near-infrared stimulation for 15 minutes, with 6 rats in each group. The experimental results show that the near-infrared light stimulation has a better effect during the period when the Bmal1 expression is higher (ZT0, ZT3, ZT21), the mesial movement of the first maxillary molar of the rat is more significant, and the orthodontic tooth movement is the farthest. And the closer the stimulation time is to the Bmal1 expression peak time point, the better the tooth movement effect. Therefore, based on the relevant experimental results, for the clinical application of the near-infrared oral orthodontic accelerator, the optimal usage period is within 3 hours before and after the time point of the Bmal1 expression peak.

[0023] According to the literature reports, the peak time point of human BMAL1 expression often appears around 13:00, varying from person to person, and the peak point can move forward or backward. When the BMAL1 peak point moves, the peaks of the rhythmically stronger clock-controlled genes will also move accordingly. The published literature uses the cosine function to calculate the expression oscillation curve of the rhythm genes. Accordingly, it can be concluded that at two time points with the same phase difference from the peak point, the gene expression levels are close. To sum up, blood samples can be collected once in the morning and once in the afternoon on the same day for orthodontic patients, and the expression levels of the clock-controlled genes with stable rhythms in blood cells can be detected to infer the time point when the BMAL1 expression peak appears.

[0024] Analyze the chrono-transcriptome sequencing data of human samples (GSE220120, GSE108539, GSE56931, GSE48133), analyze the gene rhythm by the cosine method (https: / / mcarlucci.shinyapps.io / discorhy thm / ), screen out the genes with rhythm (P<0.05), and there is a stable phase difference with BMAL1 (respectively -2, -1, +1, +2). Finally, the genes to be detected are determined as SPON2, ABHD4, BMAL1, BCL3, and ATP6V1B2.

[0025] This kit includes reagents for detecting the expression levels of SPON2, ABHD4, BMAL1, BCL3, ATP6V1B2, and GAPDH, supplemented with reagents for rapid extraction of blood mRNA and reverse transcription reagents. When using, a DNA concentration detection instrument and a fluorescence quantitative PCR instrument are required.

[0026] Commercially available products such as the RNAeasy™ Blood RNA Extraction Kit (Beyotime, R0091S) can be used as the blood mRNA rapid extraction reagent; commercially available products such as ABScript HII Reverse Transcriptase (Abclonal, RK26507) can be used as the reverse transcription reagent; the reagents for detecting the expression levels of SPON2, ABHD4, BMAL1, BCL3, and ATP6V1B2 include 2X Universal SYBR Green Fast qPCR Mix (from Abclonal, product catalog number: RK2120), primers (provided by Tsingke Synthesis), and ddH2O (self-made). The primer sequences included are shown in Table 1 below: Table 1 Primer Sequence Table Gene name Forward primer sequence Reverse primer sequence GCAAGAAGGTGTAGCACGC (SEQ ID NO.1) ATGGACTCTCCCCCAAGAGG (SEQ ID NO.2) GATCTGGAGCAGCAGTGAGTTA (SEQ ID NO.3) AGCTACTCAGCCAGCCTTGA (SEQ ID NO.4) TGCGACATTTAGGGAAGGCA (SEQ ID NO.5) TTTCAGGCGGTCAGCTTCTT (SEQ ID NO.6) AGAGGAGTGAGGGTGTCTGT (SEQ ID NO.7) CCCATCCCTCCTAGCTCACT (SEQ ID NO.8) GACCTTACCGGATGGCACAA (SEQ ID NO.9) TTCGGCCAGTACAACAGGAC (SEQ ID NO.10) GGGAAGGAAATGAATGGGCA (SEQ ID NO.11) CGCCCAATACGACCAAATCAGA (SEQ ID NO.12) Blood samples were collected from orthodontic patients (regardless of gender and age, and required to have regular rest for 3 consecutive days before blood collection) once in the morning and once in the afternoon on the same day (the first blood collection was completed between 7:00 and 10:00, and the time interval between the two samplings was 8 - 12 hours). Blood samples could be collected continuously for 3 days to improve the accuracy. The mRNA of blood cells was extracted according to the instructions of the mRNA rapid extraction reagent of the commercial product, and then a reverse transcription experiment was carried out according to the instructions of the reverse transcription reagent of the commercial product to obtain cDNA. The concentration of the cDNA sample obtained by reverse transcription was measured by a DNA concentration detection instrument. The reagent was prepared according to the instructions of 2X Universal SYBR Green Fast qPCR Mix (Abclonal, RK2120), and the program of the real-time fluorescence quantitative PCR instrument was set. The reaction system and reaction program are shown in Table 2 and Table 3 respectively. The CT values of SPON2, ABHD4, BMAL1, BCL3, ATP6V1B2, and GAPDH in each sample were detected (each gene in each sample was technically replicated 3 times), and the expression means of SPON2, ABHD4, BMAL1, BCL3, and ATP6V1B2 in the two blood samples were calculated respectively after normalization with GAPDH.

[0027] Table 2 qRT-PCR reaction system Reagent Dosage Forward primer 0.4 μL Reverse primer 0.4 μL 2X MultiF Seamless Assembly Mix 10 μL cDNA sample 2 μL <![CDATA[RNase-Free H2O]]> 7.2 μL Table 3 qRT-PCR reaction program

[0028] Data processing is performed based on the above-mentioned transcriptome sequencing data at different times, that is, comparing the expression levels of the genes to be tested in two blood samples: convert the time points of the two blood sample collections into decimal numbers, take their average value, and subtract 14 to get the value of X1; when the expression level of BMAL1 in the first sample is higher than that in the second sample, record X2 = -1, otherwise record X2 = 1; when the expression level of SPON2 in the first sample is higher than that in the second sample, record X3 = -1, otherwise record X3 = 1; when the expression level of ABHD4 in the first sample is higher than that in the second sample, record X4 = -1, otherwise record X4 = 1; when the expression level of BCL3 in the first sample is higher than that in the second sample, record X5 = -1, otherwise record X5 = 1; when the expression level of ATP6V1B2 in the first sample is higher than that in the second sample, record X6 = -1, otherwise record X6 = 1; Subsequently, a six-variable linear regression equation will be derived for the gene to be tested, and the obtained formula is the peak time point of BMAL1 expression = 14.9496 + 0.2891*X1 + 3.6794*X2 + 0.5173*X3 - 0.6058*X4 - 0.4124*X5 + 0.4119*X6. Substitute the values of X1, X2, X3, X4, X5, and X6 into the formula to calculate the peak time point of BMAL1 expression. Use this formula to calculate the peak time point of BMAL1 expression as the optimal application time point of the orthodontic accelerator, and wear the orthodontic accelerator for 12 minutes.

[0029] Combined with the work and study arrangements of contemporary people, it is judged that the optimal time period for applying the orthodontic accelerator is in the morning (6 - 8 o'clock), during the lunch break (12 - 14 o'clock), or during the evening rest time (18 - 20 o'clock).

[0030] Example 2 Taking the transcriptome sequencing data GSE220120, GSE56931, GSE48133, and GSE108539 as samples, the peak time point of BAML1 expression is calculated by the cosine method (excluding samples with large deviation values, that is, the BMAL1 peak is from 0 o'clock to 6 o'clock), a total of 55 groups of data. Calculate the peak time point of BMAL1 by the cosine method, and summarize the most suitable time period for using the orthodontic accelerator (when the detected optimal application time point is from 0 to 9 o'clock: the best application is at 6 - 8 o'clock in the morning; when the detected optimal application time point is from 9 to 11 o'clock: the accelerator can be applied at 6 - 8 o'clock in the morning or during the lunch break from 12 to 14 o'clock; when the detected optimal application time point is from 11 to 15 o'clock: the best application is during the lunch break from 12 to 14 o'clock; when the detected optimal application time point is from 15 to 17 o'clock: the accelerator can be applied during the lunch break from 12 to 14 o'clock or in the evening from 18 to 20 o'clock; when the detected optimal application time point is from 17 to 24 o'clock: the best application is during the evening rest time from 18 to 20 o'clock).

[0031] Derive the formula for calculating the peak time of BMAL1 expression through a six - variable linear regression equation, substitute the sample data into the six - variable linear regression equation to calculate the peak time point of BAML1 expression, and divide the obtained peak time point of BAML1 expression into time periods according to the most suitable time to use the orthodontic accelerator (when the best detection application time point is 0 - 10.2: it is best to apply in the morning; when the best detection application time point is 10.2 - 17: it is best to apply during lunch break; when the best detection application time point is 17 - 24: it is best to apply during the evening rest time). The accuracy rate corresponding to the best application time period of the orthodontic accelerator calculated by the regression equation and the best application time period calculated by the cosine method is 49 / 55 (89.1%). See Table 4 below for details.

[0032] Table 4 Comparison of sample detection results Sample X1 X2 X3 X4 X5 X6 BMAL1 peak - cosine method Optimal usage time calculated by cosine method BMAL1 peak - six - element linear regression equation Time segments obtained from the regression equation GSE108539_1 0.0 1 1 -1 1 -1 20.7 Late 18.93 Late GSE108539_2 0.0 1 -1 -1 -1 -1 22.8 Late 19.75 Late GSE108539_3 0.0 1 -1 -1 -1 1 23.1 Late 19.54 Late GSE108539_4 0.0 1 -1 -1 -1 1 22.3 Late 19.54 Late GSE108539_5 0.0 1 1 -1 1 -1 21.7 Late 18.93 Late GSE108539_6 0.0 1 -1 -1 -1 1 21.6 Late 19.54 Late GSE108539_7 0.0 1 1 -1 -1 -1 22.8 Late 18.54 Late GSE108539_8 0.0 1 -1 -1 -1 -1 23.5 Late 18.72 Late GSE108539_9 0.0 1 1 1 -1 -1 22.0 Late 18.54 Late GSE220120_1 0.0 -1 -1 -1 -1 -1 11.0 Early or mid 10.36 Mid GSE220120_2 0.0 1 -1 1 -1 1 16.4 Mid or late 18.33 Late GSE220120_3 0.0 -1 -1 -1 -1 -1 10.6 Early or mid 11.36 Mid GSE220120_4 0.0 -1 1 1 1 -1 11.0 Early or mid 11.36 Mid GSE220120_5 0.0 1 1 1 1 1 16.4 Mid or late 18.54 Late GSE220120_6 0.0 -1 -1 -1 -1 -1 10.6 Early or mid 11.36 Mid GSE220120_7 0.0 -1 -1 1 -1 -1 8.9 Early 10.15 Early GSE48113_1 0.0 1 -1 -1 1 -1 13.8 Mid 17.89 Late GSE48113_10 -1.0 1 -1 -1 1 1 15.7 Mid or late 18.43 Late GSE48113_11 0.0 1 -1 1 1 1 20.8 Late 17.51 Late GSE48113_12 -1.0 1 1 -1 -1 -1 18.4 Late 19.46 Late GSE48113_2 -1.0 1 -1 -1 1 -1 16.1 Mid or late 17.6 Late GSE48113_3 -1.0 1 -1 1 1 1 20.6 Late 17.22 Late GSE48113_4 -1.0 -1 -1 -1 1 -1 13.4 Mid 10.25 Mid GSE48113_5 -1.0 1 1 -1 -1 1 16.1 Mid or late 20.29 Late GSE48113_6 -1.0 1 -1 -1 1 -1 20.0 Late 17.6 Late GSE48113_7 -1.0 1 1 1 1 1 18.8 Late 18.25 Late GSE48113_8 0.0 -1 -1 -1 -1 -1 11.7 Mid 11.36 Mid GSE48113_9 0.0 1 1 -1 -1 1 20.0 Late 20.58 Late GSE56931_1 0.0 1 -1 1 1 1 18.3 Late 17.51 Late GSE56931_10 0.0 1 -1 1 1 1 16.5 Mid or late 17.51 Late GSE56931_11 0.0 1 -1 -1 1 -1 15.8 Mid or late 18.72 Late GSE56931_12 0.0 -1 -1 -1 -1 -1 13.0 Mid 11.36 Mid GSE56931_13 0.0 1 -1 1 1 1 16.7 Mid or late 17.51 Late GSE56931_14 0.0 1 1 1 1 1 22.8 Late 18.72 Late GSE56931_15 0.0 1 -1 1 1 -1 13.7 Mid 16.68 Mid GSE56931_16 0.0 -1 -1 -1 -1 -1 13.3 Mid 11.36 Mid GSE56931_17 0.0 1 -1 -1 1 1 17.9 Late 18.72 Late GSE56931_18 0.0 1 -1 1 1 1 20.2 Late 17.51 Late GSE56931_19 0.0 -1 -1 -1 -1 -1 12.3 Mid 11.36 Mid GSE56931_2 0.0 1 -1 1 1 1 17.8 Late 17.51 Late GSE56931_20 0.0 1 -1 -1 -1 -1 15.8 Mid or late 17.89 Late GSE56931_21 0.0 1 -1 -1 -1 -1 16.2 Mid or late 18.72 Late GSE56931_22 0.0 -1 -1 -1 1 -1 11.2 Mid 10.53 Mid GSE56931_23 0.0 -1 -1 -1 1 1 6.7 Early 11.36 Mid GSE56931_24 0.0 -1 1 1 1 1 7.2 Early 11.18 Mid GSE56931_25 0.0 1 -1 -1 1 -1 19.9 Late 17.89 Late GSE56931_26 0.0 -1 -1 -1 1 1 13.1 Mid 11.36 Mid GSE56931_27 0.0 1 -1 1 1 1 16.0 Mid or late 17.51 Late GSE56931_3 0.0 -1 -1 1 1 -1 6.6 Early 9.32 Early GSE56931_4 0.0 1 -1 1 1 1 14.7 Mid 17.51 Late GSE56931_5 0.0 -1 -1 -1 1 -1 12.2 Mid 10.53 Mid GSE56931_6 0.0 1 -1 -1 -1 -1 15.4 Mid or late 18.72 Late GSE56931_7 0.0 -1 -1 1 1 1 11.9 Mid 10.15 Early GSE56931_8 0.0 1 1 -1 -1 -1 15.2 Mid or late 19.75 Late GSE56931_9 0.0 1 -1 -1 -1 -1 14.3 Mid 18.72 Late Example 3

[0033] Taking the transcriptome sequencing data GSE253864 as a sample, calculate the peak time point of BAML1 expression by the cosine method, and divide the time period for its best application of the orthodontic accelerator (0 - 9: it is best to apply in the morning; 9 - 11: it is okay to apply the accelerator in the morning or during lunch break; 11 - 15: it is best to apply during lunch break; 15 - 17: it is okay to apply during lunch break or in the evening; 17 - 24: it is best to apply during the evening rest time), with a total of 142 data.

[0034] Substitute the sample data into the formula for calculating the peak time of BMAL1 expression derived from the six - variable linear regression equation, and divide the most suitable time to use the orthodontic accelerator according to the time period determined in Example 2 (0 - 10.2: it is best to apply in the morning; 10.2 - 17: it is best to apply during lunch break; 17 - 24: it is best to apply during the evening rest time). The accuracy rate corresponding to the best application time period of the orthodontic accelerator calculated by the regression equation and the best application time period calculated by the cosine method is 121 / 142 (85.2%). See Table 5 below for details.

[0035] Taking the transcriptome sequencing data GSE253864 as a sample, calculate the peak time point of BAML1 expression by the cosine method, and divide the time period for its best application of the orthodontic accelerator (0 - 9: it is best to apply in the morning; 9 - 11: it is okay to apply the accelerator in the morning or during lunch break; 11 - 15: it is best to apply during lunch break; 15 - 17: it is okay to apply during lunch break or in the evening; 17 - 24: it is best to apply during the evening rest time), with a total of 142 data.

[0036] Substitute the sample data into the six - variable linear regression equation to derive the formula for calculating the peak time of BMAL1 expression, and determine the most suitable time to use the orthodontic accelerator according to the time period determined in Example 2 (0 - 10.2: best to apply in the morning; 10.2 - 17: best to apply during lunch break; 17 - 24: best to apply during evening rest time). The accuracy rate corresponding to the best time period for applying the orthodontic accelerator calculated by the regression equation and the best time period calculated by the cosine method is 121 / 142 (85.2%). See Table 5 below for details. Table 5 Comparison of sample test results Sample X1 X2 X3 X4 X5 X7 Cosine method BMAL1 peak point Appropriate usage time calculated by cosine method BMAL1 peak - six - element linear regression equation Time segments obtained from the regression equation GSE253864_1 1 -1 1 1 1 1 12.98231 Mid 11.4703 Mid GSE253864_2 1 1 -1 1 1 1 19.18893 Late 17.7945 Late GSE253864_3 -1 1 1 1 1 1 19.18893 Late 18.2509 Late GSE253864_5 -1 1 -1 1 1 1 17.32607 Late 17.2163 Late GSE253864_4 1 1 -1 -1 1 -1 17.32607 Late 18.1823 Late GSE253864_6 -1 -1 1 1 1 1 11.64061 Mid 10.8921 Mid GSE253864_8 -1 1 -1 1 1 1 14.8171 Mid 17.2163 Late GSE253864_7 1 1 -1 -1 -1 1 14.8171 Mid 19.8309 Late GSE253864_9 1 -1 -1 1 1 1 13.46204 Mid 10.4357 Mid GSE253864_10 -1 1 -1 1 1 1 13.46204 Mid 17.2163 Late GSE253864_11 1 -1 -1 -1 1 -1 14.33233 Mid 10.8235 Mid GSE253864_12 -1 1 -1 1 1 1 14.33233 Mid 17.2163 Late GSE253864_14 -1 1 -1 1 1 -1 20.53882 Late 16.3925 Mid GSE253864_13 1 1 -1 -1 1 1 20.53882 Late 19.0061 Late GSE253864_15 -1 1 -1 1 1 1 15.4989 Mid or late 17.2163 Late GSE253864_17 -1 1 -1 -1 1 1 18.001 Late 18.4279 Late GSE253864_16 1 1 -1 -1 -1 1 18.001 Late 19.8309 Late GSE253864_18 -1 -1 -1 1 1 1 12.48851 Mid 9.8575 Early GSE253864_20 -1 1 -1 -1 1 -1 17.08174 Late 17.6041 Late GSE253864_19 1 1 1 1 1 1 17.08174 Late 18.8291 Late GSE253864_21 1 -1 -1 1 1 1 12.07846 Mid 10.4357 Mid GSE253864_22 -1 1 -1 1 1 -1 12.07846 Mid 16.3925 Mid GSE253864_23 -1 -1 -1 1 -1 -1 15.42772 Mid or late 9.8585 Early GSE253864_24 1 -1 -1 -1 1 -1 15.42772 Mid or late 10.8235 Mid GSE253864_26 -1 1 -1 -1 -1 -1 15.09158 Mid or late 18.4289 Late GSE253864_25 1 1 -1 -1 -1 -1 15.09158 Mid or late 19.0071 Late GSE253864_28 -1 -1 1 1 1 1 9.010455 Early or mid 10.8921 Mid GSE253864_27 1 -1 1 1 1 1 9.010455 Early or mid 11.4703 Mid GSE253864_29 1 1 -1 -1 1 -1 16.69439 Mid or late 18.1823 Late GSE253864_30 -1 1 -1 -1 1 1 16.69439 Mid or late 18.4279 Late GSE253864_32 -1 1 -1 1 1 1 15.26994 Mid or late 17.2163 Late GSE253864_31 1 1 1 1 1 1 15.26994 Mid or late 18.8291 Late GSE253864_33 -1 1 -1 1 1 1 19.32732 Late 17.2163 Late GSE253864_34 -1 -1 -1 1 1 1 3.626398 Early 9.8575 Early GSE253864_36 -1 1 -1 -1 1 1 17.20069 Late 18.4279 Late GSE253864_35 1 1 1 1 1 1 17.20069 Late 18.8291 Late GSE253864_37 1 -1 1 1 -1 -1 12.79612 Mid 11.4713 Mid GSE253864_39 -1 1 -1 -1 1 -1 16.51876 medium or late 17.6041 late GSE253864_38 1 1 -1 -1 1 -1 16.51876 medium or late 18.1823 late GSE253864_40 -1 -1 -1 1 1 -1 5.319957 early 9.0337 early GSE253864_42 -1 1 -1 -1 -1 -1 16.34929 medium or late 18.4289 late GSE253864_41 1 1 1 -1 -1 -1 16.34929 medium or late 20.0417 late GSE253864_44 -1 1 -1 1 1 1 17.94411 late 17.2163 late GSE253864_43 1 1 -1 -1 -1 -1 17.94411 late 19.0071 late GSE253864_45 -1 1 -1 1 1 1 13.99067 medium 17.2163 late GSE253864_47 -1 1 1 1 1 1 15.88685 medium or late 18.2509 late GSE253864_46 1 1 1 -1 -1 1 15.88685 medium or late 20.8655 late GSE253864_48 -1 -1 -1 1 1 1 13.18824 medium 9.8575 early GSE253864_49 1 1 -1 -1 -1 -1 15.11351 medium or late 19.0071 late GSE253864_50 -1 -1 1 1 1 -1 6.232 early 10.0683 early GSE253864_51 -1 1 1 1 1 1 8.863658 early 18.2509 late GSE253864_52 1 -1 1 1 1 1 11.69315 medium 11.4703 medium GSE253864_54 -1 1 -1 1 1 1 19.23287 late 17.2163 late GSE253864_53 1 1 1 -1 -1 1 19.23287 late 20.8655 late GSE253864_56 -1 1 1 1 1 -1 17.36579 late 17.4271 late GSE253864_55 1 1 1 1 1 1 17.36579 late 18.8291 late GSE253864_57 -1 1 -1 1 1 1 12.14136 medium 17.2163 late GSE253864_58 -1 1 -1 -1 1 1 22.09544 late 18.4279 late GSE253864_60 -1 1 -1 -1 -1 -1 17.08901 late 18.4289 late GSE253864_59 1 1 -1 -1 1 1 17.08901 late 19.0061 late GSE253864_61 -1 1 -1 -1 -1 -1 15.38068 medium or late 18.4289 late GSE253864_63 -1 1 -1 1 1 1 21.85321 late 17.2163 late GSE253864_62 1 1 -1 -1 -1 -1 21.85321 late 19.0071 late GSE253864_65 -1 1 -1 1 1 -1 19.84654 late 16.3925 medium GSE253864_64 1 1 1 -1 1 1 19.84654 late 20.0407 late GSE253864_66 -1 -1 -1 1 -1 -1 4.207747 early 9.8585 early GSE253864_67 1 1 1 1 -1 -1 16.40152 medium or late 18.8301 late GSE253864_68 -1 1 1 -1 -1 -1 16.40152 medium or late 19.4635 late GSE253864_69 -1 -1 -1 1 1 1 0.706443 early 9.8575 early GSE253864_71 -1 1 -1 -1 1 -1 18.0805 late 17.6041 late GSE253864_70 1 1 -1 -1 -1 -1 18.0805 late 19.0071 late GSE253864_72 -1 1 -1 1 1 1 15.83365 medium or late 17.2163 late GSE253864_74 -1 1 1 1 1 1 19.72031 late 18.2509 late GSE253864_73 1 1 -1 -1 -1 -1 19.72031 late 19.0071 late GSE253864_75 -1 1 1 -1 1 -1 14.82183 medium 18.6387 late GSE253864_76 1 1 -1 1 1 1 15.15204 medium or late 17.7945 late GSE253864_78 -1 -1 1 1 1 1 11.77324 medium 10.8921 medium GSE253864_77 1 -1 1 1 1 1 11.77324 medium 11.4703 medium GSE253864_79 -1 -1 -1 1 1 1 6.008205 early 9.8575 early GSE253864_80 1 -1 -1 1 -1 -1 11.06504 medium 10.4367 medium GSE253864_81 -1 1 -1 -1 -1 -1 14.82546 medium 18.4289 late GSE253864_82 -1 -1 -1 -1 -1 -1 13.06931 medium 11.0701 medium GSE253864_84 -1 1 -1 -1 1 -1 23.13628 late 17.6041 late GSE253864_83 1 1 1 -1 -1 -1 23.13628 late 20.0417 late GSE253864_86 -1 1 1 -1 1 -1 16.14959 medium or late 18.6387 late GSE253864_85 1 1 1 -1 1 -1 16.14959 medium or late 19.2169 late GSE253864_88 -1 1 -1 -1 -1 -1 22.4672 late 18.4289 late GSE253864_87 1 1 -1 -1 -1 -1 22.4672 late 19.0071 late GSE253864_89 -1 -1 -1 1 1 -1 8.799798 early 9.0337 early GSE253864_91 -1 1 -1 -1 1 1 20.50346 late 18.4279 late GSE253864_90 1 1 -1 -1 -1 1 20.50346 late 19.8309 late GSE253864_92 1 1 1 1 1 1 19.35356 late 18.8291 late GSE253864_94 -1 1 -1 -1 1 -1 22.2987 late 17.6041 late GSE253864_93 1 1 -1 -1 -1 -1 22.2987 late 19.0071 late GSE253864_96 -1 1 -1 -1 -1 -1 18.03003 late 18.4289 late GSE253864_95 1 1 -1 -1 -1 1 18.03003 late 19.8309 late GSE253864_97 -1 1 1 -1 1 -1 2.63717 early 18.6387 late GSE253864_99 -1 1 -1 -1 1 -1 17.95546 late 17.6041 late GSE253864_98 1 1 1 -1 1 1 17.95546 late 20.0407 late GSE253864_101 -1 1 1 1 1 1 22.08616 late 18.2509 late GSE253864_100 1 1 1 1 1 1 22.08616 late 18.8291 late GSE253864_103 -1 1 -1 1 1 1 14.73483 medium 17.2163 late GSE253864_102 1 1 1 -1 1 1 14.73483 medium 20.0407 late GSE253864_104 1 1 -1 -1 1 -1 21.75526 late 18.1823 late GSE253864_106 -1 -1 -1 -1 -1 -1 12.2425 medium 11.0701 medium GSE253864_105 1 -1 -1 -1 -1 -1 12.2425 medium 11.6483 China GSE253864_107 1 -1 -1 -1 -1 -1 14.66686 China 11.6483 China GSE253864_108 -1 1 -1 1 -1 -1 14.66686 China 17.2173 Late GSE253864_109 -1 1 -1 1 1 -1 8.094862 Early 16.3925 China GSE253864_110 1 -1 -1 1 1 1 11.5031 China 10.4357 China GSE253864_111 -1 -1 1 1 1 1 11.5031 China 10.8921 China GSE253864_113 -1 1 -1 -1 1 -1 22.1574 Late 17.6041 Late GSE253864_112 1 1 -1 -1 1 -1 22.1574 Late 18.1823 Late GSE253864_115 -1 1 -1 -1 -1 -1 19.44179 Late 18.4289 Late GSE253864_114 1 1 -1 -1 -1 -1 19.44179 Late 19.0071 Late GSE253864_116 1 1 -1 -1 -1 -1 22.9316 Late 19.0071 Late GSE253864_117 1 -1 -1 1 1 1 11.48979 China 10.4357 China GSE253864_119 -1 1 1 -1 1 -1 21.09365 Late 18.6387 Late GSE253864_118 1 1 -1 -1 -1 -1 21.09365 Late 19.0071 Late GSE253864_120 -1 -1 1 1 1 -1 7.414849 Early 10.0683 Early GSE253864_122 -1 1 -1 1 1 1 19.23344 Late 17.2163 Late GSE253864_121 1 1 -1 -1 -1 -1 19.23344 Late 19.0071 Late GSE253864_123 -1 -1 -1 1 -1 -1 13.41205 China 9.8585 Early GSE253864_124 -1 1 1 1 1 -1 18.00239 Late 17.4271 Late GSE253864_125 -1 1 -1 -1 1 -1 13.73093 China 17.6041 Late GSE253864_127 -1 1 1 -1 1 1 18.00339 Late 19.4625 Late GSE253864_126 1 1 1 -1 1 1 18.00339 Late 20.0407 Late GSE253864_129 -1 1 -1 1 1 1 17.05369 Late 17.2163 Late GSE253864_128 1 1 -1 -1 1 1 17.05369 Late 19.0061 Late GSE253864_131 -1 1 -1 1 1 1 19.65914 Late 17.2163 Late GSE253864_130 1 1 -1 1 1 1 19.65914 Late 17.7945 Late GSE253864_132 -1 -1 -1 1 1 1 1.212483 Early 9.8575 Early GSE253864_134 -1 1 -1 -1 1 -1 15.41706 Middle or late 17.6041 Late GSE253864_133 1 1 -1 -1 1 -1 15.41706 Middle or late 18.1823 Late GSE253864_135 -1 1 -1 1 -1 -1 22.08587 Late 17.2173 Late GSE253864_137 -1 1 -1 -1 1 1 17.96525 Late 18.4279 Late GSE253864_136 1 1 -1 -1 -1 1 17.96525 Late 19.8309 Late GSE253864_138 1 1 -1 -1 1 1 18.9748 Late 19.0061 Late GSE253864_139 1 1 -1 -1 -1 -1 16.60379 Middle or late 19.0071 Late GSE253864_141 -1 1 -1 -1 1 -1 17.28612 Late 17.6041 Late GSE253864_140 1 1 -1 -1 1 -1 17.28612 Late 18.1823 Late GSE253864_142 -1 -1 -1 1 -1 -1 7.618441 Early 9.8585 Early The above - mentioned embodiments are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A primer set, characterized in that, The primer set contains 5 primer pairs, which respectively target the following 5 genes: SPON2, ABHD4, BMAL1, BCL3, ATP6V1B2, and are composed of the nucleotide sequences shown in SEQ ID NO.1-10.

2. Use of the primer set according to claim 1 in the preparation of a product for detecting the optimal application time of a near-infrared orthodontic accelerator.

3. The application according to claim 2, wherein The product is a kit.

4. The application according to claim 3, wherein The kit further includes a primer pair for an internal reference gene.

5. The application according to claim 4, characterized in that, The internal reference gene is GAPDH.

6. The application according to claim 2, wherein The kit further includes an mRNA rapid extraction reagent, a reverse transcription reagent, and a PCR quantification reagent.

7. The application according to claim 6, wherein The reverse transcription reagent includes ABMalScript HII Reverse Transcriptase reagent.

8. The application according to claim 2, wherein The detection method is as follows: Blood samples are collected once in the morning and once in the afternoon on the same day. The samples are pretreated, and the CT values of the SPON2, ABHD4, BMAL1, BCL3, and ATP6V1B2 genes in the samples are measured by PCR reaction. After normalization with GAPDH, the expression levels of SPON2, ABHD4, BMAL1, BCL3, and ATP6V1B2 in the two blood samples collected are calculated; the time points of the two blood samples collected are converted into decimals, and the mean value is taken and the value after subtracting 14 is X1; when the expression level of BMAL1 in the first sample is higher than that in the second sample, X2=-1 is recorded, otherwise X2=1 is recorded; when the expression level of SPON2 in the first sample is higher than that in the second sample, X3=-1 is recorded, otherwise X3=1 is recorded; when the expression level of ABHD4 in the first sample is higher than that in the second sample, X4=-1 is recorded, otherwise X4=1 is recorded; when the expression level of BCL3 in the first sample is higher than that in the second sample, X5=-1 is recorded, otherwise X5=1 is recorded; when the expression level of ATP6V1B2 in the first sample is higher than that in the second sample, X6=-1 is recorded, otherwise X6=1 is recorded; Subsequently, a six-variable linear regression equation is derived for the gene to be tested, and the obtained formula is the peak expression time point of BMAL1 = 14.9496 + 0.2891*X1 + 3.6794*X2 + 0.5173*X3 - 0.6058*X4 - 0.4124*X5 + 0.4119*X6; By comparing the values of X1, X2, X3, X4, X5, and X6 and substituting them into the formula to calculate the peak expression time point of BMAL1, the obtained time point is the optimal application time of the near-infrared orthodontic accelerator.

9. The application according to claim 8, wherein The PCR reaction procedure is as follows: 。

Images