A kit for detecting the optimal application time of a near-infrared vibration orthodontic accelerator and its application

Abstract

The present invention discloses a kit for detecting the optimal application time of a near-infrared vibration orthodontic accelerator and its application, and belongs to the field of biotechnology. Specifically, the present invention relates to a primer set and a kit for monitoring the optimal application time of a near-infrared vibration orthodontic accelerator prepared by using the primer set. The kit includes primer sets targeting six genes, namely SPON2, ABHD4, BMAL1, BCL3, ATP6V1B2, and GAPDH. By detecting the expression levels of the above genes, the optimal application time of the orthodontic accelerator is obtained by substituting them into a formula. Compared with the prior art, the near-infrared oral orthodontic accelerator timing correction strategy proposed in the present invention, by collecting blood samples of orthodontic patients twice to detect the optimal application time of the accelerator, enables the accelerator to exert a greater therapeutic effect, and can help doctors arrange the patient's orthodontic plan more scientifically and reasonably, thereby achieving personalized and precise treatment and more effectively shortening the patient's orthodontic process.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a kit for detecting the optimal application time of a near-infrared vibration orthodontic accelerator and application thereof. Background Art

[0002] Malocclusion, a disorder of abnormal jaw growth and development, has seen an increasing incidence in recent years, severely impacting patients' oral and maxillofacial function and physical and mental health. With the advancement of medical technology and increasing patient demand, the orthodontic market continues to grow. However, current orthodontic treatment options still have many shortcomings, such as long treatment durations, slow tooth movement, and the potential for root resorption, loose teeth, and enamel demineralization, which often cause discomfort and distress to patients.

[0003] The existing orthodontic acceleration methods on the market mostly use various types of orthodontic accelerator devices. Among them, the principle of near-infrared oral orthodontic accelerator is to use low-intensity laser to stimulate jaw metabolic activity to accelerate the movement of teeth in the jaw. It has the advantages of few side effects, low invasiveness, simple operation, non-invasiveness and painlessness, and is widely promoted among orthodontic patients. Summary of the Invention

[0004] Related studies have reported that bone tissue metabolic activity exhibits significant circadian rhythmic variations. Therefore, we propose a chronotherapy concept using a near-infrared orthodontic accelerator, tailored to the rhythm of jaw bone metabolic activity. Blood tests are performed on orthodontic patients to determine the optimal time period for their use. This allows for personalized and precise application of the near-infrared orthodontic accelerator, shortening orthodontic treatment duration, mitigating adverse complications, and establishing a healthy and efficient new treatment model, leading to technological innovation in orthodontics. A preliminary search revealed no relevant invention patents.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] In a first aspect, the present invention provides a primer set comprising five primer pairs, each targeting the following five genes: SPON2, ABHD4, BMAL1, BCL3, and ATP6V1B2, and consisting of the nucleotide sequences shown in SEQ ID NOs. 1-10.

[0007] In a second aspect, the present invention also provides the use of the primer set in preparing a product for detecting the optimal application time of a near-infrared orthodontic accelerator.

[0008] Furthermore, the product is a test kit.

[0009] Furthermore, the kit also includes a primer pair for an internal reference gene.

[0010] Furthermore, the internal reference gene is GAPDH.

[0011] Furthermore, the kit also includes an mRNA rapid extraction reagent, a reverse transcription reagent, and a PCR quantitative reagent.

[0012] Furthermore, the reverse transcription reagent includes ABScript HII Reverse Transcriptase reagent.

[0013] Furthermore, the detection method is as follows: blood samples are collected once in the morning and once in the afternoon of the same day, the blood samples are pretreated, the CT values of the SPON2, ABHD4, BMAL1, BCL3, and ATP6V1B2 genes in the samples are determined by PCR reaction, and the expression levels of SPON2, ABHD4, BMAL1, BCL3, and ATP6V1B2 are calculated twice after GAPDH standardization; the time points of the two blood sample collections are converted into decimal, and the average is taken and the value after subtracting 14 is X1; when the BMAL1 expression level of the first sample is higher than that of the second sample, X2 is recorded as -1, otherwise it is recorded as X2 =1; when the expression level of SPON2 in the first sample is higher than that in the second sample, X3=-1 is recorded, otherwise X3=1 is recorded; when the expression level of ABHD4 in the first sample is higher than that in the second sample, X4=-1 is recorded, otherwise X4=1 is recorded; when the expression level of BCL3 in the first sample is higher than that in the second sample, X5=-1 is recorded, otherwise X5=1 is recorded; when the expression level of ATP6V1B2 in the first sample is higher than that in the second sample, X6=-1 is recorded, otherwise X6=1 is recorded; then, the six-variable linear regression equation is derived for the genes to be tested, and the formula obtained is: BMAL1 expression peak time point = 14.9496 + 0.2891*X1 + 3.6794*X2 + 0.5173*X3 -0.6058*X4 -0.4124*X5 + 0.4119*X6; compare the values of X1, X2, X3, X4, X5, and X6, and substitute them into the formula to calculate the peak expression time of BMAL1. The obtained time point is the optimal application time of the near-infrared orthodontic accelerator.

[0014] Furthermore, the PCR reaction system is:

[0015] Reagents dose Upstream primer 0.4 μL Downstream primer 0.4 μL 2X MultiF Seamless Assembly Mix 10 μL cDNA samples 2 μL <![CDATA[RNase-Free H2O]]> 7.2 μL .

[0016] Furthermore, the PCR reaction procedure is:

[0017] .

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The concept of chronotherapy has been widely adopted in clinical practice, but currently available near-infrared orthodontic accelerators lack a clear application strategy for this purpose. The proposed chronotherapy strategy for a near-infrared orthodontic accelerator utilizes blood samples collected twice from orthodontic patients to determine the optimal time for accelerator application. This strategy maximizes the accelerator's therapeutic effect, helping doctors plan patients' orthodontic plans more scientifically and rationally, thereby achieving personalized, precise treatment and effectively shortening the patient's orthodontic progress. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1A This is a heat map of the sequencing results of periodontal tissues of orthodontic rats after stimulation of the rat model in Example 1;

[0021] Figure 1B This is a bubble chart of differential gene enrichment analysis in the sequencing results of periodontal tissues of orthodontic rats in Example 1;

[0022] Figure 2 After stimulation of the rat model in Example 1 Bmall Gene expression profile;

[0023] Figure 3A CT scan results of tooth movement after near-infrared stimulation in different modes was applied to the rat orthodontic model in Example 1;

[0024] Figure 3B Statistical analysis results of tooth movement after near-infrared stimulation in different modes was applied to the rat orthodontic model in Example 1; DETAILED DESCRIPTION

[0025] To better illustrate the present invention, the following embodiments are listed. Obviously, the embodiments described are only part of the present invention, not all of the embodiments. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without making any creative efforts are also within the scope of protection of the present invention.

[0026] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0027] Example 1

[0028] A rat orthodontic model was constructed, and periodontal tissues of rats were collected at different time points to extract RNA and perform transcriptome sequencing. The circadian rhythm characteristics of gene expression patterns were judged, and 2988 genes were detected to have circadian rhythmic expression. These genes can be called clock-controlled genes. Enrichment analysis of related genes showed that they were enriched in pathways such as biological clock, ATPase activity, tricarboxylic acid metabolism, polysaccharide metabolism, fatty acid metabolism, cellular carbohydrate metabolism, osteoblast differentiation, and bone mineralization.

[0029] The concept of chronotherapy has been widely used in clinical practice. By following the rhythmicity of the metabolic activity of the jaw during reconstruction and applying near-infrared stimulation at the most active metabolic stage, the orthodontic jaw reconstruction effect can be achieved with twice the result with half the effort. The biological clock gene controls the circadian rhythm of the expression pattern of clock-controlled genes and also controls the periodic phase of the expression rhythm of clock-controlled genes. Therefore, the detection of the only irreplaceable core gene of the biological clock can be used to Bmal1 The rhythm phase is expressed to determine the optimal time period for applying near-infrared orthodontic accelerator.

[0030] Blood samples were collected from rats at different time points (3 samples per group) and detected by qPCR. Bmal1 The expression level, clearly Bmal1 The time points of peak and trough expression were ZT0 and ZT12, respectively. A rat orthodontic model was constructed: 6 rats in each group, a total of 7 groups, anesthetized SD rats raised in an FPS environment (intraperitoneal injection of sodium pentobarbital 40 mg / kg), a ligature was passed between the first and second molars of the maxilla, a nickel-titanium coil spring was connected to the mesial side of the first molar, and the other end of the spring was also connected to the ligature; before the start of orthodontic force application, a dynamometer was used to determine the tensile length of the spring under a force of 50 g, and a high-speed turbine handpiece was used to grind an undercut on the neck of the central incisor on the same side to fix the ligature, which was connected to the other end of the nickel-titanium tension spring. Based on the orthodontic rat animal model, near-infrared stimulation was applied to the rats. Bmal1 Near-infrared light stimulation was applied for 15 minutes at the time points of the higher expression period (ZT0, ZT3, ZT21) and the lower expression period (ZT6, ZT12, ZT15). Another group was stimulated with near-infrared light for 15 minutes at non-time points. There were 6 rats in each group. Bmal1 The near-infrared light stimulation effect is better during the period of higher expression (ZT0, ZT3, ZT21), the mesial movement of the maxillary first molar of rats is more significant, and the orthodontic tooth moves the farthest. Bmal1 The closer the peak expression time is, the better the tooth movement effect is. Therefore, based on the relevant experimental results, the best use period for the clinical application of near-infrared orthodontic accelerator is Bmal1 Within 3 hours before and after the peak expression time.

[0031] According to literature reports, the peak time of human BMAL1 expression often occurs around 1:00 p.m., and the peak time can shift forward or backward depending on the individual. When the BMAL1 peak point shifts, the peak value of clock-controlled genes with strong rhythmicity will also shift accordingly. Published literature uses a cosine function to calculate the rhythmic gene expression oscillation curve, which shows that the gene expression levels are similar at two time points with the same phase difference from the peak point. In summary, blood samples can be collected from orthodontic patients once in the morning and afternoon on the same day to detect the expression levels of clock-controlled genes with stable rhythms in blood cells and infer the time point of BMAL1 expression peak.

[0032] Analyze chronological transcriptome sequencing data of human samples (GSE220120, GSE108539, GSE56931, GSE48133) and analyze gene rhythmicity using the cosine method (https: / / mcarlucci.shinyapps.io / discorhy

[0033] thm / ), and screened out rhythmic genes (P<0.05) with stable phase differences with BMAL1 (-2, -1, +1, +2, respectively). Finally, the genes to be tested were determined to be SPON2, ABHD4, BMAL1, BCL3, and ATP6V1B2.

[0034] This kit includes reagents for detecting the expression levels of SPON2, ABHD4, BMAL1, BCL3, ATP6V1B2, and GAPDH, supplemented by blood mRNA rapid extraction reagents and reverse transcription reagents. A DNA concentration detection instrument and a fluorescence quantitative PCR instrument are required for use.

[0035] For rapid blood mRNA extraction, commercial products such as the RNAeasy™ Blood RNA Extraction Kit (Biyuntian, R0091S) can be used. Reverse transcription reagents such as ABScript HII Reverse Transcriptase (Abclonal, RK26507) can be used. Reagents for detecting the expression of SPON2, ABHD4, BMAL1, BCL3, and ATP6V1B2 include 2X Universal SYBR Green Fast qPCR Mix (Abclonal, catalog number: RK2120), primers (provided by Qingke Synthesis), and ddH2O (self-made). The primer sequences are shown in Table 1 below:

[0036] Table 1 Primer sequence list

[0037] Gene name Upstream primer sequence Downstream primer sequence GCAAGAAGGTGTAGCACGC (SEQ ID NO.1) ATGGACTCTCCCCCAAGAGG (SEQ ID NO.2) GATCTGGAGCAGCAGTGAGTTA (SEQ ID NO.3) AGCTACTCAGCCAGCCTTGA (SEQ ID NO.4) TGCGACATTTAGGGAAGGCA (SEQ ID NO.5) TTTCAGGCGGTCAGCTTCTT (SEQ ID NO.6) AGAGGAGTGAGGGTGTCTGT (SEQ ID NO.7) CCCATCCCTCCTAGCTCACT (SEQ ID NO.8) GACCTTACCGGATGGCACAA (SEQ ID NO.9) TTCGGCCAGTACAACAGGAC (SEQ ID NO.10) GGGAAGGAAATGAATGGGCA (SEQ ID NO.11) CGCCCAATACGACCAAATCAGA (SEQ ID NO.12)

[0038] Blood samples were collected from orthodontic patients (with no gender or age restrictions, and patients were required to have a regular sleep and rest schedule for three consecutive days before blood collection) in the morning and afternoon of the same day (the first blood sample was collected between 7:00 and 10:00, and the interval between the two samples was 8-12 hours). Blood samples were collected for three consecutive days to improve accuracy. mRNA was extracted from blood cells according to the instructions of a commercial mRNA rapid extraction reagent. Subsequently, reverse transcription was performed according to the instructions of a commercial reverse transcription reagent to obtain cDNA. The concentration of the reverse-transcribed cDNA sample was measured using a DNA concentration detector. Reagents were prepared according to the instructions of 2X Universal SYBR Green Fast qPCR Mix (Abclonal, RK2120), and the program of the real-time fluorescence quantitative PCR instrument was set. The reaction system and reaction program are shown in Tables 2 and 3, respectively. The CT values of SPON2, ABHD4, BMAL1, BCL3, ATP6V1B2, and GAPDH in each sample were detected (each gene in each sample was technically tested three times), and the mean expression values of SPON2, ABHD4, BMAL1, BCL3, and ATP6V1B2 of the two blood samples were calculated after normalization with GAPDH.

[0039] Table 2 qRT-PCR reaction system

[0040] Reagents dose Upstream primer 0.4 μL Downstream primer 0.4 μL 2X MultiF Seamless Assembly Mix 10 μL cDNA samples 2 μL <![CDATA[RNase-Free H2O]]> 7.2 μL

[0041] Table 3 qRT-PCR reaction procedure

[0042]

[0043] According to the above-mentioned transcriptome sequencing data, data processing was performed to compare the expression levels of the two blood samples of the gene to be tested: the time points of the two blood sample collections were converted into decimal, and the value after taking the mean and subtracting 14 was recorded as X1; when the expression level of BMAL1 in the first sample was higher than that in the second sample, X2=-1 was recorded, otherwise X2=1 was recorded; when the expression level of SPON2 in the first sample was higher than that in the second sample, X3=-1 was recorded, otherwise X3=1 was recorded; when the expression level of ABHD4 in the first sample was higher than that in the second sample, X4=-1 was recorded, otherwise X4=1 was recorded; when the expression level of BCL3 in the first sample was higher than that in the second sample, X5=-1 was recorded, otherwise X5=1 was recorded; when the expression level of ATP6V1B2 in the first sample was higher than that in the second sample, X6=-1 was recorded, otherwise X6=1 was recorded; then, the six-variable linear regression equation for the gene to be tested was derived, and the formula obtained was: BMAL1 expression peak time point = 14.9496 + 0.2891*X1 + 3.6794*X2 + 0.5173*X3 -0.6058*X4 -0.4124*X5 + 0.4119*X6. Substitute the values of X1, X2, X3, X4, X5, and X6 into the formula to calculate the peak expression time of BMAL1. This formula was used to calculate the peak expression time of BMAL1 as the optimal time for orthodontic accelerator application. The orthodontic accelerator was worn for 12 minutes.

[0044] Combined with the work and study arrangements of modern people, the best time to use orthodontic accelerators is in the morning (6-8 o'clock), lunch break (12-14 o'clock) or evening rest time (18-20 o'clock).

[0045] Example 2

[0046] The transcriptome sequencing data of GSE220120, GSE56931, GSE48133, and GSE108539 were used as samples, and the peak expression time point of BAML1 was calculated by the cosine method (samples with large deviation values were excluded, that is, the BMAL1 peak was 0-6 o'clock). A total of 55 groups of data were used to calculate the peak time point of BMAL1 by the cosine method, and the most suitable time period for using the orthodontic accelerator was summarized (when the best application time point for detection is 0-9 o'clock: 6-8 o'clock in the morning is the best; when the best application time point for detection is 9-11 o'clock: 6-8 o'clock in the morning or 12-14 o'clock during lunch break can be used to use the accelerator; when the best application time point for detection is 11-15 o'clock: 12-14 o'clock during lunch break is the best; when the best application time point for detection is 15-17 o'clock: 12-14 o'clock during lunch break or 18-20 o'clock in the evening can be used to use the accelerator; when the best application time point for detection is 17-24 o'clock: 18-20 o'clock in the evening is the best time for rest).

[0047] A formula for calculating the peak expression time of BMAL1 was derived using a six-variable linear regression equation. Sample data were then substituted into the six-variable linear regression equation to calculate the peak expression time of BAML1. The obtained peak expression time points were divided into time periods based on the most suitable time for orthodontic accelerator use (optimal application time points: 0-10.2 hours: optimal for morning use; optimal application time points: 10.2-17 hours: optimal for lunch break; optimal application time points: 17-24 hours: optimal for evening rest). The accuracy of the optimal application time periods of orthodontic accelerators calculated by the regression equation and the optimal application time periods calculated by the cosine method was 49 / 55 (89.1%), as shown in Table 4 below.

[0048] Table 4 Comparison of sample test results

[0049] sample X1 X2 X3 X4 X5 X6 BMAL1 peak-cosine method When is the cosine method suitable for calculation? BMAL1 peak-six-variable linear regression equation Time segments obtained from the regression equation GSE108539_1 0.0 1 1 -1 1 -1 20.7 Night 18.93 Night GSE108539_2 0.0 1 -1 -1 -1 -1 22.8 Night 19.75 Night GSE108539_3 0.0 1 -1 -1 -1 1 23.1 Night 19.54 Night GSE108539_4 0.0 1 -1 -1 -1 1 22.3 Night 19.54 Night GSE108539_5 0.0 1 1 -1 1 -1 21.7 Night 18.93 Night GSE108539_6 0.0 1 -1 -1 -1 1 21.6 Night 19.54 Night GSE108539_7 0.0 1 1 -1 -1 -1 22.8 Night 18.54 Night GSE108539_8 0.0 1 -1 -1 -1 -1 23.5 Night 18.72 Night GSE108539_9 0.0 1 1 1 -1 -1 22.0 Night 18.54 Night GSE220120_1 0.0 -1 -1 -1 -1 -1 11.0 Early or mid-term 10.36 middle GSE220120_2 0.0 1 -1 1 -1 1 16.4 mid- or late-night 18.33 Night GSE220120_3 0.0 -1 -1 -1 -1 -1 10.6 Early or mid-term 11.36 middle GSE220120_4 0.0 -1 1 1 1 -1 11.0 Early or mid-term 11.36 middle GSE220120_5 0.0 1 1 1 1 1 16.4 mid- or late-night 18.54 Night GSE220120_6 0.0 -1 -1 -1 -1 -1 10.6 Early or mid-term 11.36 middle GSE220120_7 0.0 -1 -1 1 -1 -1 8.9 morning 10.15 morning GSE48113_1 0.0 1 -1 -1 1 -1 13.8 middle 17.89 Night GSE48113_10 -1.0 1 -1 -1 1 1 15.7 mid- or late 18.43 Night GSE48113_11 0.0 1 -1 1 1 1 20.8 Night 17.51 Night GSE48113_12 -1.0 1 1 -1 -1 -1 18.4 Night 19.46 Night GSE48113_2 -1.0 1 -1 -1 1 -1 16.1 mid- or late-night 17.6 Night GSE48113_3 -1.0 1 -1 1 1 1 20.6 Night 17.22 Night GSE48113_4 -1.0 -1 -1 -1 1 -1 13.4 middle 10.25 middle GSE48113_5 -1.0 1 1 -1 -1 1 16.1 mid- or late-night 20.29 Night GSE48113_6 -1.0 1 -1 -1 1 -1 20.0 Night 17.6 Night GSE48113_7 -1.0 1 1 1 1 1 18.8 Night 18.25 Night GSE48113_8 0.0 -1 -1 -1 -1 -1 11.7 middle 11.36 middle GSE48113_9 0.0 1 1 -1 -1 1 20.0 Night 20.58 Night GSE56931_1 0.0 1 -1 1 1 1 18.3 Night 17.51 Night GSE56931_10 0.0 1 -1 1 1 1 16.5 mid- or late-night 17.51 Night GSE56931_11 0.0 1 -1 -1 1 -1 15.8 mid- or late 18.72 Night GSE56931_12 0.0 -1 -1 -1 -1 -1 13.0 middle 11.36 middle GSE56931_13 0.0 1 -1 1 1 1 16.7 mid- or late-night 17.51 Night GSE56931_14 0.0 1 1 1 1 1 22.8 Night 18.72 Night GSE56931_15 0.0 1 -1 1 1 -1 13.7 middle 16.68 middle GSE56931_16 0.0 -1 -1 -1 -1 -1 13.3 middle 11.36 middle GSE56931_17 0.0 1 -1 -1 1 1 17.9 Night 18.72 Night GSE56931_18 0.0 1 -1 1 1 1 20.2 Night 17.51 Night GSE56931_19 0.0 -1 -1 -1 -1 -1 12.3 middle 11.36 middle GSE56931_2 0.0 1 -1 1 1 1 17.8 Night 17.51 Night GSE56931_20 0.0 1 -1 -1 -1 -1 15.8 mid- or late 17.89 Night GSE56931_21 0.0 1 -1 -1 -1 -1 16.2 mid- or late-night 18.72 Night GSE56931_22 0.0 -1 -1 -1 1 -1 11.2 middle 10.53 middle GSE56931_23 0.0 -1 -1 -1 1 1 6.7 morning 11.36 middle GSE56931_24 0.0 -1 1 1 1 1 7.2 morning 11.18 middle GSE56931_25 0.0 1 -1 -1 1 -1 19.9 Night 17.89 Night GSE56931_26 0.0 -1 -1 -1 1 1 13.1 middle 11.36 middle GSE56931_27 0.0 1 -1 1 1 1 16.0 mid- or late-night 17.51 Night GSE56931_3 0.0 -1 -1 1 1 -1 6.6 morning 9.32 morning GSE56931_4 0.0 1 -1 1 1 1 14.7 middle 17.51 Night GSE56931_5 0.0 -1 -1 -1 1 -1 12.2 middle 10.53 middle GSE56931_6 0.0 1 -1 -1 -1 -1 15.4 mid- or late-night 18.72 Night GSE56931_7 0.0 -1 -1 1 1 1 11.9 middle 10.15 morning GSE56931_8 0.0 1 1 -1 -1 -1 15.2 mid- or late-night 19.75 Night GSE56931_9 0.0 1 -1 -1 -1 -1 14.3 middle 18.72 Night

[0050] Example 3

[0051] Using transcriptome sequencing data GSE253864 as a sample, the peak expression time point of BAML1 was calculated by the cosine method, and the optimal time periods for applying orthodontic accelerators were divided (0-9 a.m.: best for application in the morning; 9-11 a.m.: best for application in the morning or during lunch break; 11-15 p.m.: best for application during lunch break; 15-17 p.m.: best for application during lunch break or evening; 17-24 p.m.: best for application during the night), totaling 142 data.

[0052] The sample data was substituted into a six-variable linear regression equation to derive a formula for calculating the peak time of BMAL1 expression. The optimal time for using the orthodontic accelerator was divided according to the time periods determined in Example 2 (0-10.2: optimal for morning use; 10.2-17: optimal for lunch break; 17-24: optimal for evening rest). The accuracy of the optimal time period for using the orthodontic accelerator calculated by the regression equation and the optimal time period calculated by the cosine method was 121 / 142 (85.2%), as shown in Table 5 below.

[0053] Using transcriptome sequencing data GSE253864 as a sample, the peak expression time point of BAML1 was calculated by the cosine method, and the optimal time periods for applying orthodontic accelerators were divided (0-9 a.m.: best for application in the morning; 9-11 a.m.: best for application in the morning or during lunch break; 11-15 p.m.: best for application during lunch break; 15-17 p.m.: best for application during lunch break or evening; 17-24 p.m.: best for application during the night), totaling 142 data.

[0054] The sample data was substituted into a six-variable linear regression equation to derive a formula for calculating the peak time of BMAL1 expression. The optimal time for using the orthodontic accelerator was divided according to the time periods determined in Example 2 (0-10.2: optimal for morning use; 10.2-17: optimal for lunch break; 17-24: optimal for evening rest). The accuracy of the optimal time period for using the orthodontic accelerator calculated by the regression equation and the optimal time period calculated by the cosine method was 121 / 142 (85.2%), as shown in Table 5 below.

[0055] Table 5 Comparison of sample test results

[0056] sample X1 X2 X3 X4 X5 X7 Cosine method BMAL1 peak point When is the cosine method suitable for calculation? BMAL1 peak-six-variable linear regression equation Time segments obtained from the regression equation GSE253864_1 1 -1 1 1 1 1 12.98231 middle 11.4703 middle GSE253864_2 1 1 -1 1 1 1 19.18893 Night 17.7945 Night GSE253864_3 -1 1 1 1 1 1 19.18893 Night 18.2509 Night GSE253864_5 -1 1 -1 1 1 1 17.32607 Night 17.2163 Night GSE253864_4 1 1 -1 -1 1 -1 17.32607 Night 18.1823 Night GSE253864_6 -1 -1 1 1 1 1 11.64061 middle 10.8921 middle GSE253864_8 -1 1 -1 1 1 1 14.8171 middle 17.2163 Night GSE253864_7 1 1 -1 -1 -1 1 14.8171 middle 19.8309 Night GSE253864_9 1 -1 -1 1 1 1 13.46204 middle 10.4357 middle GSE253864_10 -1 1 -1 1 1 1 13.46204 middle 17.2163 Night GSE253864_11 1 -1 -1 -1 1 -1 14.33233 middle 10.8235 middle GSE253864_12 -1 1 -1 1 1 1 14.33233 middle 17.2163 Night GSE253864_14 -1 1 -1 1 1 -1 20.53882 Night 16.3925 middle GSE253864_13 1 1 -1 -1 1 1 20.53882 Night 19.0061 Night GSE253864_15 -1 1 -1 1 1 1 15.4989 mid- or late-night 17.2163 Night GSE253864_17 -1 1 -1 -1 1 1 18.001 Night 18.4279 Night GSE253864_16 1 1 -1 -1 -1 1 18.001 Night 19.8309 Night GSE253864_18 -1 -1 -1 1 1 1 12.48851 middle 9.8575 morning GSE253864_20 -1 1 -1 -1 1 -1 17.08174 Night 17.6041 Night GSE253864_19 1 1 1 1 1 1 17.08174 Night 18.8291 Night GSE253864_21 1 -1 -1 1 1 1 12.07846 middle 10.4357 middle GSE253864_22 -1 1 -1 1 1 -1 12.07846 middle 16.3925 middle GSE253864_23 -1 -1 -1 1 -1 -1 15.42772 mid- or late-night 9.8585 morning GSE253864_24 1 -1 -1 -1 1 -1 15.42772 mid- or late-night 10.8235 middle GSE253864_26 -1 1 -1 -1 -1 -1 15.09158 mid- or late-night 18.4289 Night GSE253864_25 1 1 -1 -1 -1 -1 15.09158 mid- or late-night 19.0071 Night GSE253864_28 -1 -1 1 1 1 1 9.010455 Early or mid-term 10.8921 middle GSE253864_27 1 -1 1 1 1 1 9.010455 Early or mid-term 11.4703 middle GSE253864_29 1 1 -1 -1 1 -1 16.69439 mid- or late-night 18.1823 Night GSE253864_30 -1 1 -1 -1 1 1 16.69439 mid- or late-night 18.4279 Night GSE253864_32 -1 1 -1 1 1 1 15.26994 mid- or late-night 17.2163 Night GSE253864_31 1 1 1 1 1 1 15.26994 mid- or late-night 18.8291 Night GSE253864_33 -1 1 -1 1 1 1 19.32732 Night 17.2163 Night GSE253864_34 -1 -1 -1 1 1 1 3.626398 morning 9.8575 morning GSE253864_36 -1 1 -1 -1 1 1 17.20069 Night 18.4279 Night GSE253864_35 1 1 1 1 1 1 17.20069 Night 18.8291 Night GSE253864_37 1 -1 1 1 -1 -1 12.79612 middle 11.4713 middle GSE253864_39 -1 1 -1 -1 1 -1 16.51876 mid- or late-night 17.6041 Night GSE253864_38 1 1 -1 -1 1 -1 16.51876 mid- or late-night 18.1823 Night GSE253864_40 -1 -1 -1 1 1 -1 5.319957 morning 9.0337 morning GSE253864_42 -1 1 -1 -1 -1 -1 16.34929 mid- or late-night 18.4289 Night GSE253864_41 1 1 1 -1 -1 -1 16.34929 mid- or late-night 20.0417 Night GSE253864_44 -1 1 -1 1 1 1 17.94411 Night 17.2163 Night GSE253864_43 1 1 -1 -1 -1 -1 17.94411 Night 19.0071 Night GSE253864_45 -1 1 -1 1 1 1 13.99067 middle 17.2163 Night GSE253864_47 -1 1 1 1 1 1 15.88685 mid- or late-night 18.2509 Night GSE253864_46 1 1 1 -1 -1 1 15.88685 mid- or late-night 20.8655 Night GSE253864_48 -1 -1 -1 1 1 1 13.18824 middle 9.8575 morning GSE253864_49 1 1 -1 -1 -1 -1 15.11351 mid- or late-night 19.0071 Night GSE253864_50 -1 -1 1 1 1 -1 6.232 morning 10.0683 morning GSE253864_51 -1 1 1 1 1 1 8.863658 morning 18.2509 Night GSE253864_52 1 -1 1 1 1 1 11.69315 middle 11.4703 middle GSE253864_54 -1 1 -1 1 1 1 19.23287 Night 17.2163 Night GSE253864_53 1 1 1 -1 -1 1 19.23287 Night 20.8655 Night GSE253864_56 -1 1 1 1 1 -1 17.36579 Night 17.4271 Night GSE253864_55 1 1 1 1 1 1 17.36579 Night 18.8291 Night GSE253864_57 -1 1 -1 1 1 1 12.14136 middle 17.2163 Night GSE253864_58 -1 1 -1 -1 1 1 22.09544 Night 18.4279 Night GSE253864_60 -1 1 -1 -1 -1 -1 17.08901 Night 18.4289 Night GSE253864_59 1 1 -1 -1 1 1 17.08901 Night 19.0061 Night GSE253864_61 -1 1 -1 -1 -1 -1 15.38068 mid- or late-night 18.4289 Night GSE253864_63 -1 1 -1 1 1 1 21.85321 Night 17.2163 Night GSE253864_62 1 1 -1 -1 -1 -1 21.85321 Night 19.0071 Night GSE253864_65 -1 1 -1 1 1 -1 19.84654 Night 16.3925 middle GSE253864_64 1 1 1 -1 1 1 19.84654 Night 20.0407 Night GSE253864_66 -1 -1 -1 1 -1 -1 4.207747 morning 9.8585 morning GSE253864_67 1 1 1 1 -1 -1 16.40152 mid- or late-night 18.8301 Night GSE253864_68 -1 1 1 -1 -1 -1 16.40152 mid- or late-night 19.4635 Night GSE253864_69 -1 -1 -1 1 1 1 0.706443 morning 9.8575 morning GSE253864_71 -1 1 -1 -1 1 -1 18.0805 Night 17.6041 Night GSE253864_70 1 1 -1 -1 -1 -1 18.0805 Night 19.0071 Night GSE253864_72 -1 1 -1 1 1 1 15.83365 mid- or late-night 17.2163 Night GSE253864_74 -1 1 1 1 1 1 19.72031 Night 18.2509 Night GSE253864_73 1 1 -1 -1 -1 -1 19.72031 Night 19.0071 Night GSE253864_75 -1 1 1 -1 1 -1 14.82183 middle 18.6387 Night GSE253864_76 1 1 -1 1 1 1 15.15204 mid- or late-night 17.7945 Night GSE253864_78 -1 -1 1 1 1 1 11.77324 middle 10.8921 middle GSE253864_77 1 -1 1 1 1 1 11.77324 middle 11.4703 middle GSE253864_79 -1 -1 -1 1 1 1 6.008205 morning 9.8575 morning GSE253864_80 1 -1 -1 1 -1 -1 11.06504 middle 10.4367 middle GSE253864_81 -1 1 -1 -1 -1 -1 14.82546 middle 18.4289 Night GSE253864_82 -1 -1 -1 -1 -1 -1 13.06931 middle 11.0701 middle GSE253864_84 -1 1 -1 -1 1 -1 23.13628 Night 17.6041 Night GSE253864_83 1 1 1 -1 -1 -1 23.13628 Night 20.0417 Night GSE253864_86 -1 1 1 -1 1 -1 16.14959 mid- or late-night 18.6387 Night GSE253864_85 1 1 1 -1 1 -1 16.14959 mid- or late-night 19.2169 Night GSE253864_88 -1 1 -1 -1 -1 -1 22.4672 Night 18.4289 Night GSE253864_87 1 1 -1 -1 -1 -1 22.4672 Night 19.0071 Night GSE253864_89 -1 -1 -1 1 1 -1 8.799798 morning 9.0337 morning GSE253864_91 -1 1 -1 -1 1 1 20.50346 Night 18.4279 Night GSE253864_90 1 1 -1 -1 -1 1 20.50346 Night 19.8309 Night GSE253864_92 1 1 1 1 1 1 19.35356 Night 18.8291 Night GSE253864_94 -1 1 -1 -1 1 -1 22.2987 Night 17.6041 Night GSE253864_93 1 1 -1 -1 -1 -1 22.2987 Night 19.0071 Night GSE253864_96 -1 1 -1 -1 -1 -1 18.03003 Night 18.4289 Night GSE253864_95 1 1 -1 -1 -1 1 18.03003 Night 19.8309 Night GSE253864_97 -1 1 1 -1 1 -1 2.63717 morning 18.6387 Night GSE253864_99 -1 1 -1 -1 1 -1 17.95546 Night 17.6041 Night GSE253864_98 1 1 1 -1 1 1 17.95546 Night 20.0407 Night GSE253864_101 -1 1 1 1 1 1 22.08616 Night 18.2509 Night GSE253864_100 1 1 1 1 1 1 22.08616 Night 18.8291 Night GSE253864_103 -1 1 -1 1 1 1 14.73483 middle 17.2163 Night GSE253864_102 1 1 1 -1 1 1 14.73483 middle 20.0407 Night GSE253864_104 1 1 -1 -1 1 -1 21.75526 Night 18.1823 Night GSE253864_106 -1 -1 -1 -1 -1 -1 12.2425 middle 11.0701 middle GSE253864_105 1 -1 -1 -1 -1 -1 12.2425 middle 11.6483 middle GSE253864_107 1 -1 -1 -1 -1 -1 14.66686 middle 11.6483 middle GSE253864_108 -1 1 -1 1 -1 -1 14.66686 middle 17.2173 Night GSE253864_109 -1 1 -1 1 1 -1 8.094862 morning 16.3925 middle GSE253864_110 1 -1 -1 1 1 1 11.5031 middle 10.4357 middle GSE253864_111 -1 -1 1 1 1 1 11.5031 middle 10.8921 middle GSE253864_113 -1 1 -1 -1 1 -1 22.1574 Night 17.6041 Night GSE253864_112 1 1 -1 -1 1 -1 22.1574 Night 18.1823 Night GSE253864_115 -1 1 -1 -1 -1 -1 19.44179 Night 18.4289 Night GSE253864_114 1 1 -1 -1 -1 -1 19.44179 Night 19.0071 Night GSE253864_116 1 1 -1 -1 -1 -1 22.9316 Night 19.0071 Night GSE253864_117 1 -1 -1 1 1 1 11.48979 middle 10.4357 middle GSE253864_119 -1 1 1 -1 1 -1 21.09365 Night 18.6387 Night GSE253864_118 1 1 -1 -1 -1 -1 21.09365 Night 19.0071 Night GSE253864_120 -1 -1 1 1 1 -1 7.414849 morning 10.0683 morning GSE253864_122 -1 1 -1 1 1 1 19.23344 Night 17.2163 Night GSE253864_121 1 1 -1 -1 -1 -1 19.23344 Night 19.0071 Night GSE253864_123 -1 -1 -1 1 -1 -1 13.41205 middle 9.8585 morning GSE253864_124 -1 1 1 1 1 -1 18.00239 Night 17.4271 Night GSE253864_125 -1 1 -1 -1 1 -1 13.73093 middle 17.6041 Night GSE253864_127 -1 1 1 -1 1 1 18.00339 Night 19.4625 Night GSE253864_126 1 1 1 -1 1 1 18.00339 Night 20.0407 Night GSE253864_129 -1 1 -1 1 1 1 17.05369 Night 17.2163 Night GSE253864_128 1 1 -1 -1 1 1 17.05369 Night 19.0061 Night GSE253864_131 -1 1 -1 1 1 1 19.65914 Night 17.2163 Night GSE253864_130 1 1 -1 1 1 1 19.65914 Night 17.7945 Night GSE253864_132 -1 -1 -1 1 1 1 1.212483 morning 9.8575 morning GSE253864_134 -1 1 -1 -1 1 -1 15.41706 mid- or late-night 17.6041 Night GSE253864_133 1 1 -1 -1 1 -1 15.41706 mid- or late-night 18.1823 Night GSE253864_135 -1 1 -1 1 -1 -1 22.08587 Night 17.2173 Night GSE253864_137 -1 1 -1 -1 1 1 17.96525 Night 18.4279 Night GSE253864_136 1 1 -1 -1 -1 1 17.96525 Night 19.8309 Night GSE253864_138 1 1 -1 -1 1 1 18.9748 Night 19.0061 Night GSE253864_139 1 1 -1 -1 -1 -1 16.60379 mid- or late-night 19.0071 Night GSE253864_141 -1 1 -1 -1 1 -1 17.28612 Night 17.6041 Night GSE253864_140 1 1 -1 -1 1 -1 17.28612 Night 18.1823 Night GSE253864_142 -1 -1 -1 1 -1 -1 7.618441 morning 9.8585 morning

[0057] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A primer set, characterized in that: The primer set comprises five primer pairs, targeting the following five genes respectively: SPON2, ABHD4, BMAL1, BCL3, and ATP6V1B2, and is composed of the nucleotide sequences shown in SEQ ID NOs. 1-10.

2. Use of the primer set according to claim 1 in the preparation of a product for detecting the optimal application time of a near-infrared orthodontic accelerator.

3. The use according to claim 2, characterized in that The product is a test kit.

4. The use according to claim 3, characterized in that The kit also includes a primer pair for an internal reference gene.

5. The use according to claim 4, characterized in that The internal reference gene is GAPDH.

6. The use according to claim 2, characterized in that The kit also includes an mRNA rapid extraction reagent, a reverse transcription reagent, and a PCR quantitative reagent.

7. The use according to claim 6, characterized in that The reverse transcription reagent includes ABScript HIIReverse Transcriptase reagent.

8. The use according to claim 2, characterized in that The detection method comprises the following steps: collecting blood samples once in the morning and once in the afternoon on the same day, pre-treating the samples, determining the CT values of the SPON2, ABHD4, BMAL1, BCL3, and ATP6V1B2 genes in the samples by PCR reaction, and calculating the expression levels of SPON2, ABHD4, BMAL1, BCL3, and ATP6V1B2 of the two blood samples after normalization with GAPDH; converting the time points of the two blood sample collections into decimal, taking the average and subtracting 14 as X1; when the BMAL1 expression level of the first sample is higher than that of the second sample, X2 is recorded as -1, otherwise it is recorded as X2 =1; when the expression level of SPON2 in the first sample is higher than that in the second sample, X3=-1 is recorded, otherwise X3=1 is recorded; when the expression level of ABHD4 in the first sample is higher than that in the second sample, X4=-1 is recorded, otherwise X4=1 is recorded; when the expression level of BCL3 in the first sample is higher than that in the second sample, X5=-1 is recorded, otherwise X5=1 is recorded; when the expression level of ATP6V1B2 in the first sample is higher than that in the second sample, X6=-1 is recorded, otherwise X6=1 is recorded; then, the six-variable linear regression equation is derived for the genes to be tested, and the formula obtained is: BMAL1 expression peak time point = 14.9496 + 0.2891*X1 + 3.6794*X2 +0.5173*X3 -0.6058*X4 -0.4124*X5 + 0.4119*X6; compare the values of X1, X2, X3, X4, X5, and X6, and substitute them into the formula to calculate the peak expression time of BMAL1. The obtained time point is the optimal application time of the near-infrared orthodontic accelerator.

Images