SNP (Single Nucleotide Polymorphism) molecular marker related to sperm motility on pig chromosome 7, primer pair and application
By detecting the SNP molecular marker of A178-G178 mutation on pig chromosome 7, screening high-quality semen boars, solving the problem of genetic improvement of reproductive performance in pig breeding, and improving semen quality and increasing economic benefits were achieved.
Patent Information
- Application Number
- CN202510254960.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-05
- Publication Date
- 2025-07-04
AI Technical Summary
The prior art lacks effective means to improve the genetic improvement of boar reproductive performance in pig breeding, resulting in limited exploration of the genetic basis of semen quality, affecting breeding efficiency and economic benefits.
Provide a SNP molecular marker and its primer pair related to sperm viability on pig chromosome 7. By detecting mutations in specific nucleotide sites A178-G178, high-quality semen boars are screened, and the frequency of dominant alleles is increased generation by generation, and molecular marker assisted breeding technology is established.
It has improved the quality of pig semen, improved the breeding performance and growth performance of breeding pigs, enhanced the economic benefits and competitiveness of the enterprise, and promoted the progress of pig breeding.
Smart Images

Figure CN120249496A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to a SNP molecular marker related to sperm motility on pig chromosome 7, a primer pair and an application thereof. Background Art
[0002] In the modern pig production system, the genetic excellence of excellent boars can be quickly spread to different groups through artificial insemination (AI) technology, thereby effectively improving the production performance of commercial pig breeds. Duroc boars are widely used in crossbreeding programs due to their excellent lean meat rate and efficient feed conversion rate. Traditional breeding strategies mainly focus on the growth rate, backfat thickness and feed conversion efficiency of Duroc boars, while the breeding of reproductive performance is relatively neglected. Reproductive performance, as a core economic trait, plays a vital role in improving production efficiency and optimizing genetic improvement. Semen quality is a key indicator to measure the reproductive potential of boars. By identifying the key genes that affect semen quality and applying them to genetic improvement, the production efficiency and reproductive capacity of boars can be effectively improved. This will not only help promote the sustainable development of my country's pig farming industry, but also promote the self-sufficiency of the meat industry, enhance the competitiveness of the breeding industry, and thus improve the level of the national economy.
[0003] Genome-wide association studies (GWAS) have identified tens of thousands of genetic variants associated with semen quality traits in humans, cattle, poultry, and pigs. In addition, thousands of quantitative trait loci (QTLs) associated with semen quality traits are listed in the PigQTL database (https: / / www.animalgenome.org / cgi-bin / QTLdb / index). However, the exploration of the genetic basis of semen quality is limited by the fact that most of the variants identified by GWAS are located in non-coding regions, as well as genomic linkage disequilibrium (LD), limited sample size, and lack of functional genomic data. The complexity of these genetic structures often hinders the analysis of the regulatory mechanisms of complex traits. Summary of the invention
[0004] The purpose of the present invention is to provide a SNP molecular marker, primer pair and application related to sperm motility on chromosome 7 of pig, which can use regulatory annotation to explore the genetic mechanism of complex traits, enhance the probability of discovering reliable associations, increase the test efficiency, and improve the accuracy and reliability of the results.
[0005] The technical solution adopted by the present invention to solve its technical problem is:
[0006] A SNP molecular marker associated with sperm motility on chromosome 7 of pigs, wherein the SNP site corresponds to the A>G mutation at position 22,074,230 on chromosome 7 of the international pig genome version 11.1 reference sequence.
[0007] Preferably, its nucleotide sequence is as shown in SEQ ID NO: 1, where M in the sequence represents A or G, resulting in differences in porcine sperm motility.
[0008] Preferably, its SNP locus is a nucleotide mutation of A178 - G178 at the 178th position marked in the SEQ ID NO: 1 sequence.
[0009] Preferably, it has applications in identifying porcine sperm motility - related traits and porcine genetic breeding.
[0010] Another technical problem to be solved by the present invention is to provide a method for screening boars with high - quality semen using SNP molecular markers related to sperm motility on porcine chromosome 7, comprising the following steps:
[0011] Detect the SNP molecular markers related to sperm motility on porcine chromosome 7, where the 178th single nucleotide at the 5' end of the molecular marker is A or G, eliminate the A genotype and retain the G genotype.
[0012] Another technical problem to be solved by the present invention is to provide a primer pair for identifying SNP molecular markers related to sperm motility on porcine chromosome 7, and the primer pair comprises:
[0013] Primer P001 - F: 5'-GGAAGCACAAGCATCCACAG-3';
[0014] Primer P002 - R: 5'-CAGCATTCCCCGGTTACCTC-3'.
[0015] Preferably, its application in identifying porcine semen quality - related traits.
[0016] Preferably, its application in porcine molecular marker - assisted breeding.
[0017] Preferably, its application in improving porcine semen quality.
[0018] Another technical problem to be solved by the present invention is to provide a method for genetic improvement of pigs, comprising the following steps:
[0019] Determine the sites of SNP molecular markers related to sperm motility on porcine chromosome 7 of breeding pigs in the core breeding pig population, and make corresponding selections according to the molecular markers: select and retain breeding pig individuals with GG or AG genotypes at the 22,074,230th site on chromosome 7 of the international porcine reference genome version 11.1 in the core breeding pig population, and eliminate breeding pig individuals with AA genotypes at the 22,074,230th site;
[0020] Gradually increase the frequency of allele G at this locus, thereby improving the semen quality of offspring pigs.
[0021] The beneficial effects of the present invention are as follows:
[0022] The present invention studies and determines that the molecular marker related to pig sperm motility is located on the nucleotide sequence of chromosome 7 of pigs, verifies its effect on pig sperm motility traits, establishes an efficient and accurate molecular marker-assisted breeding technology, and applies it to the genetic improvement of breeding pigs to improve the semen quality, thereby improving the growth performance of offspring pigs, increasing the economic profit of enterprises, and enhancing the core competitiveness. By selecting the advantageous allele of this SNP, the frequency of the advantageous allele can be gradually increased from generation to generation, the semen quality of breeding pigs can be improved, excellent breeding pigs with the above two traits can be co-selected, and the progress of pig genetic improvement can be accelerated, thereby effectively improving the economic benefits of pig breeding.
[0023] The present invention provides a primer pair for identifying the SNP molecular marker related to sperm motility on chromosome 7 of pigs. Through this primer pair, an efficient and accurate molecular marker-assisted breeding technology can be established to quickly and accurately select and breed semen quality, and accelerate the breeding process. Brief Description of the Drawings
[0024] Figure 1 It is a Manhattan plot of genome-wide association analysis (GWAS) related to sperm motility on chromosome 7 of Duroc pigs. Specific Embodiment Methods
[0026] The principles and features of the present invention will be described below in conjunction with the accompanying drawings. The examples given are only for explaining the present invention and are not intended to limit the scope of the present invention. In the following paragraphs, the present invention will be described more specifically by way of example with reference to the accompanying drawings. The advantages and features of the present invention will be clearer according to the following description and the claims. It should be noted that the drawings are all in a very simplified form and use non-precise scales, only for the purpose of facilitating and clearly assisting in explaining the purpose of the embodiments of the present invention.
[0027] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the technical field to which the present invention belongs. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used herein includes any and all combinations of one or more of the related listed items.
[0028] Example 1
[0029] Experimental Animals
[0030] The experimental pig population used in this experiment was purebred Duroc pigs from the Breeding Pig Branch of Guangxi Yangxiang Group Co., Ltd. A total of 3,604 Duroc breeding pigs were selected from this resource population. All pigs had free access to food and water during the experiment, and the feeding methods, breeding conditions, etc. were kept consistent to ensure the unity of the experiment and the reliability of the data.
[0031] Sample collection
[0032] Pigs were randomly selected from the above-mentioned Duroc pig population, ear tissue samples were collected, and the samples were immersed in 75% ethanol solution by volume. Subsequently, the samples were stored in a -20°C refrigerator for further analysis.
[0033] Genotyping of 80K SNPs in the pig whole genome
[0034] Genomic DNA in the ear tissues of the collected Duroc pigs was extracted by the standard phenol-chloroform method, and the DNA concentration and OD ratios (OD260 / 280, OD260 / 230) of each sample were measured using a Nanodrop 2000 / 2000C nucleic acid and protein detector. Qualified DNA samples were diluted to 50 ng / μL according to the concentration requirements for further DNA quality inspection. 6 μL of the extracted DNA sample was mixed with 2 μL of loading buffer and loaded onto a 1% agarose gel for electrophoresis (150 V, 25 minutes). Observation and photography were carried out under an ultraviolet spectrophotometer and a gel imaging device to ensure the integrity of the DNA. Subsequently, the qualified DNA samples were sent to Wuhan Shadow Gene Technology Co., Ltd. for genotyping of 80K functional loci in the pig whole genome according to the standard procedure.
[0035] For all samples, the PLINK software was used to perform quality control on the 80K chip data, and SNPs with an individual rate lower than 90%, a pedigree Mendelian error rate higher than 0.1, a minor allele frequency less than 0.05, and a Hardy-Weinberg equilibrium significance level higher than 10^-6 were excluded.
[0036] Genotype imputation
[0037] For missing genotypes, the reference haplotype library of the reference population was used for imputation. The Beagle software was used to impute the 80K SNP chip data in combination with the PGRP reference panel to generate whole-genome sequencing data.
[0038] Genome-wide association study (GWAS)
[0039] Since the semen quality phenotype data included multiple ejaculation records collected at different time points, to handle this data structure, a repeatability model in the GMAT software was used for GWAS analysis. The significance threshold was set at a P value less than 5×10^-8. The GWAS analysis was carried out based on the following model:
[0040] Phenotypic vector: including observed values of traits such as semen quality.
[0041] Fixed effect vector: including the effects of population structure, sampling year, and sampling season.
[0042] Random regression polynomial coefficient vector: representing additive genetic effects, analyzed based on the marker-based relationship matrix.
[0043] Individual-specific permanent environmental effect: its variance-covariance matrix is modeled using the identity matrix.
[0044] Residual effect: using a diagonal matrix, considering measurement differences at different time points.
[0045] The results of GWAS analysis showed that there were loci on chromosome 7 of Duroc pigs that significantly affected sperm motility. The most strongly associated SNP was rs1112922792, with a P-value of 1.15×10^-8. The linkage disequilibrium between the g.178A>G locus and the most strongly associated locus was 0.82.
[0046] Transcriptome-wide association study (TWAS)
[0047] To further study the significant correlation between the genetically predicted gene expression levels and semen phenotypes, a single-tissue TWAS model provided by the PigGTEx resource was used. Combining the GWAS summary statistics of 11 semen traits, single-tissue TWAS analysis was performed using S-PrediXcan, and the significance threshold was corrected using Bonferroni multiple testing.
[0048] Colocalization analysis
[0049] To identify potential regulatory genes and the causal variants shared with phenotypes, Bayesian colocalization analysis was performed using the R package "coloc". First, summary statistics of expression quantitative trait loci (eQTL) were obtained from the PigGTEx database, and conditional analysis was performed based on SNPs within ±1Mb of independent variants. Bayesian colocalization analysis was carried out by integrating genetic information from GWAS and eQTL. The threshold for colocalization evidence was set with a posterior probability (PP4) greater than 0.8.
[0050] Analysis of the association between different genotypes and sperm motility phenotypes
[0051] According to the analysis results, there is a highly significant correlation (P<0.001) between the SNP locus g.178A>G of the molecular marker (the 178th nucleotide in SEQ ID NO.1, corresponding to the A>G mutation at position 22,074,230 on chromosome 7 of the reference sequence of the international pig genome version 11.1) and the sperm motility trait. This result indicates that this SNP molecular marker significantly affects the sperm motility trait of pigs, and auxiliary selection can be carried out on this SNP locus to improve the semen quality of the pig population, thereby accelerating the pig breeding process.
[0052] Table 1 Correlation analysis between the SNP locus g.178A>G of the molecular marker and sperm motility.
[0053]
[0054] Example 2
[0055] DNA sequence amplification and sequencing
[0056] Primer design
[0057] For DNA sequence amplification, in this experiment, the DNA sequence of SEQ ID NO:1 on chromosome 7 of pigs was downloaded from the Ensembl website (http: / / asia.ensembl.org / index.html). Using the primer design software Primer Premier 6.0, primers for PCR amplification were designed. The designed primer DNA sequences are as follows:
[0058] P001-F: 5’-GGAAGCACAAGCATCCACAG-3’
[0059] P002-R: 5’-CAGCATTCCCCGGTTACCTC-3’
[0060] PCR amplification
[0061] The total volume of the PCR amplification reaction system is 10 μL, and the specific composition is as follows:
[0062] DNA template: 1 μL
[0063] Double-distilled water: 3.4 μL
[0064] 2×Tag PCR StanMix with Loading Dye: 5 μL
[0065] Primer P001-F: 0.3 μL
[0066] Primer P002-R: 0.3 μL
[0067] The PCR reaction conditions are:
[0068] Pre-denaturation at 94°C for 5 minutes
[0069] Denaturation at 94°C for 30 seconds
[0070] Annealing at 55°C for 30 seconds
[0071] Extension at 72°C for 45 seconds
[0072] 35 cycles
[0073] Extension at 72°C for 5 minutes
[0074] The desired DNA fragment is amplified through this step.
[0075] DNA sequence determination
[0076] The amplified DNA fragment will be sent to BGI Tech Solutions (Shenzhen) Co., Ltd. for sequencing and identification. The gene fragment is sequenced through forward and reverse reactions, and the obtained DNA sequence will be compared with the NCBI genomic sequence to confirm the mutation of the corresponding SNP locus.
[0077] The sequencing results are as follows:
[0078] GGAAGCACAAGCATCCACAGTGAGAAAGAAGTCAGAATCCTGAGTTCTCATAAGCTTGGTGGCTCTCTCTCTCTATATATATATATATGTATATATATATATTACAGATTTGCTGGATAACTAGTAGCAGTTTTTAAACTGGGCTGATTAGAGATTTAGGATTTAGGAGTTCGTATCM(A>G)TGGCTTGGTGGTAAATGAATG TGACTACTATCCATGAGGATGAGGGTTCAGTCCCTGACCTTGCTCAGTGGATTAACTGATCAGTGATGTAGGTTGCAGATGCTGTTCCATTCGACTCCTGGCCCGTGAAATTCTGTATGTCTCAGCTGAGGCCCTAAAAAAGATGGGGAAAAAAAAAAAGATTTCATGTATTTTAGGGATTGGTGAAATTGAGTCTGTGTGGTTTTAAGGTAGAACTTTTTGTTCTATTTATTAGAATGAAAAAAATTTAATGTCTAAATCAGAGGTCTGAAATTGGATTGCTGGATTTGAAGCACTAGCTCTTATTCAACCAAAAAGGATTACTCTAGTTCATTAGTTCTCAAAAGTGTGGTTGTCTCAAGCAACAGCAGCAGCAGCATCTGGAAACTTGTGAGAAATACAAACTCCAGGGCTGGGGTCCAATAATTTGTGCTTGAACAAGCTCTCTGGGTGATTCTCATTATGCTAAAGTTTGAAACTCTAGGTGTGTTTTATTTTATTTTAAAACATGGTTAACCTAGTTTCTGTCCATCTTGATAACATCTTTTCTCCCCAGAACCCCCATTTTTCTCATCATTCCAACATCATCATGAGTGTCTATCCTGATCCTTCCCTACTCTGCCAGGATTAATGGTTCTAATCCCTACCCCACCCACAGTGCTAGGACTCACAGAGCAAGCTAATGTAGTGTTAAAAGACACTGGCCAAATATCCCCAGGAACAAACCTGACAAAATCCGTTTAATGAATTAACGGAGCGATAGGATACTTCGAGGTAACCGGGGAATGCTG
[0079] Annotation:
[0080] M is the mutation site, indicating that a base mutation has occurred at this position.
[0081] The underlined part in red is the mutated base, and the allele mutated to A>G is indicated in the parentheses.
[0082] The start and end positions of the designed primer sequences are marked with bold underlines for easy confirmation of the specific positions of the primers.
[0083] Based on the above sequence, the SNP site mutation (A>G) obtained from the experiment verified the gene variation on chromosome 7 of pigs, providing important genetic information for further research on the gene function and breeding strategies of pig breeds.
[0084] Example 3
[0085] Effect analysis of the SNP site g.178A>G of molecular markers
[0086] In this example, for the traits related to pig sperm motility, the effect of the SNP site g.178A>G was analyzed. According to the analysis results in Table 1, it was found that the average value of the sperm motility phenotype of the dominant allele genotype (GG) of this SNP site was significantly increased by 2.12 compared with the AA type. This finding provides a new basis for molecular marker-assisted selection of pig sperm motility traits.
[0087] By gradually eliminating pigs with the genotype AA within the population, the frequency of allele G can be effectively increased, thereby improving the sperm motility level of breeding pigs and the reproductive performance of boars. This genetic improvement can not only enhance the fertility of breeding pigs but also promote the yield and quality of pork products, thus directly promoting the growth of pork sales and bringing significant economic benefits to enterprises.
[0088] The present invention detected the 178th base mutation site in the SEQ ID NO:1 sequence, conducted an association analysis between the genotype and pig sperm motility traits, and preliminarily verified the potential of this SNP site as a molecular marker-assisted selection tool. This research provides a new molecular marker for pig genetic improvement, enabling a more accurate and efficient breeding strategy for the aquaculture industry, thereby achieving better economic benefits.
[0089] The above embodiments of the present invention do not limit the protection scope of the present invention. The implementation manners of the present invention are not limited thereto. All such modifications, substitutions or changes made to the above structure of the present invention according to the above content of the present invention, in accordance with the common general knowledge and customary means in the art, without departing from the above basic technical idea of the present invention, shall fall within the protection scope of the present invention.
Claims
1. A SNP molecular marker related to sperm motility on porcine chromosome 7, characterized in that, The SNP locus corresponds to an A>G mutation at position 22,074,230 on chromosome 7 of the International Pig Genome Version 11.1 reference sequence.
2. The SNP molecular marker according to claim 1, wherein Its nucleotide sequence is as shown in SEQ ID NO: 1, where M in the sequence represents A or G, resulting in differences in pig sperm motility.
3. The SNP molecular marker according to claim 1, wherein Its SNP locus is a nucleotide mutation of A178-G178 at position 178 annotated in the SEQ ID NO: 1 sequence.
4. The application of the SNP molecular marker according to claim 1, wherein It has applications in identifying pig sperm motility-related traits and pig genetic breeding.
5. A method for screening boars with high-quality semen using SNP molecular markers related to sperm motility on porcine chromosome 7, characterized in that, It includes the following steps: Detect the SNP molecular marker related to sperm motility on chromosome 7 of the pig, where the 178th single nucleotide at the 5' end of the molecular marker is A or G, eliminate the A genotype and retain the G genotype.
6. A primer pair for identifying SNP molecular markers related to sperm motility on porcine chromosome 7, characterized in that, The primer pair includes: Primer P001-F: 5'-GGAAGCACAAGCATCCACAG-3'; Primer P002-R: 5'-CAGCATTCCCCGGTTACCTC-3'.
7. The primer pair according to claim 6, wherein Its application in identifying pig semen quality-related traits.
8. The primer pair according to claim 6, wherein Its application in pig molecular marker-assisted breeding.
9. The primer pair according to claim 6, wherein Its application in improving pig semen quality.
10. A method for genetic improvement of pigs, characterized in that, It includes the following steps: Determine the locus of the SNP molecular marker related to sperm motility on chromosome 7 of the pigs in the core breeding pig population, and make corresponding selections according to the molecular marker: select and retain the pig individuals with the GG or AG genotype at position 22,074,230 on chromosome 7 of the International Pig Reference Genome Version 11.1 in the core breeding pig population, and eliminate the pig individuals with the AA genotype at position 22,074,230; Gradually increase the frequency of allele G at this locus, thereby improving the semen quality of the offspring pigs.