Mycoplasma detection method based on RPA-CRISPR / Cas12a and application thereof
By designing RPA universal primers and crRNA to optimize the RPA-CRISPR/Cas12a reaction system, the problems of long detection cycles and low sensitivity in the prior art are solved, and efficient and simple detection of various mycoplasmas in cell cultures are achieved, ensuring the quality and safety of biological products.
Patent Information
- Application Number
- CN202510280475.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-11
- Publication Date
- 2025-07-04
AI Technical Summary
The existing mycoplasma detection methods have problems such as long detection cycle, poor broad spectrum and low sensitivity in cell culture. It is difficult for traditional methods to detect multiple mycoplasma contamination at the same time. It is urgent to develop a real-time detection method with simple operation, accurate, strong specificity and high sensitivity.
RPA universal primers and crRNA targeting the highly conserved sequence of Mycoplasma 16S rRNA were designed to optimize the RPA-CRISPR/Cas12a reaction system, and high sensitivity real-time detection of nine common mycoplasmas in cell culture was achieved in CRISPR/Cas12a detection after RPA pre-amplification, and fluorescent signals and blue-violet light were used to observe the results.
It realizes simple and accurate detection of a variety of mycoplasmas in cell culture, has high sensitivity, and can observe the results with naked eyes within 40 minutes, with a detection limit of up to 10 copies/μL, ensuring early detection and providing reliable guarantees for the quality and safety of biological products.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology. More specifically, the present application relates to a Mycoplasma detection method based on RPA-CRISPR / Cas12a and its application. Background Art
[0002] Mycoplasma is a unique microorganism that lacks a cell wall and thus exhibits natural resistance to antibiotics commonly used in cell culture. These microorganisms are tiny in size and have variable shapes, can easily pass through a 0.22-micron (μm) filter, cannot be removed by filtration, and are difficult to detect by traditional microscopy. Mycoplasma can affect the performance of cell culture and the quality of products through multiple mechanisms, and can also alter the gene expression profile of host cells, thereby affecting the normal functions and production processes of cells. Therefore, it is regarded as a potential contaminant in the fields of cell culture and biopharmaceuticals, and precise detection and control measures are required for management.
[0003] Among the Mycoplasma detection methods specified in the pharmacopoeia, the culture method is regarded as the gold standard. This method detects the presence of Mycoplasma by inoculating cell culture samples into liquid and solid media for culture. This detection method has high sensitivity, but has problems such as a long detection cycle and poor broad-spectrum performance. In addition, the cell staining method adds a fluorescent DNA-binding dye after culturing cells and observes whether there is Mycoplasma contamination under a fluorescence microscope. Compared with the traditional culture method, this method has an advantage in detection speed, but has low sensitivity and requires professional knowledge to accurately judge the results. Therefore, there is an urgent need to develop a real-time detection method that is inexpensive, simple to operate, accurate, highly specific, and highly sensitive.
[0004] In recent years, pathogen detection systems based on nucleic acid amplification technologies, such as Recombinase Polymerase Amplification (RPA) and CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas12a (a CRISPR-associated endonuclease) system, have made remarkable progress. The RPA technology is a nucleic acid amplification method carried out at a constant temperature, which can achieve rapid amplification of nucleic acids without the need for complex instruments and equipment. CRISPR / Cas12a (also known as Cpf1) is a molecular tool that can recognize specific DNA sequences and activate its powerful ability to trans-cleave single-stranded DNA (ssDNA). After the target DNA fragment is amplified by RPA, Cas12a can specifically recognize these fragments and activate its ability to trans-cleave ssDNA, thereby cleaving the ssDNA fluorescent reporter probe in the system and generating a detectable fluorescent signal. By fluorescence reading or under illumination with light of a specific wavelength, it can be visually judged by the naked eye whether the sample is positively contaminated.
[0005] The RPA-CRISPR / Cas12a detection method can be divided into a one-step method and a two-step method. The one-step method completes RPA amplification and CRISPR / Cas12a detection in one step, with the advantages of simplicity, rapidity, and anti-contamination. The two-step method allows independent optimization of the RPA amplification and CRISPR / Cas12a detection steps to improve the specificity and sensitivity of detection, and is more suitable for application scenarios with high requirements for specificity and sensitivity.
[0006] Existing Mycoplasma detection methods based on the RPA-CRISPR / Cas12a technology are only designed for the detection of one type of Mycoplasma, while cell cultures may be contaminated by multiple types of Mycoplasma. Therefore, there is an urgent need to develop a highly versatile detection method that can detect multiple types of Mycoplasma contamination. Summary of the Invention
[0007] The purpose of the present invention is to provide a Mycoplasma detection method based on RPA-CRISPR / Cas12a and its application. By designing RPA universal primers and crRNAs targeting the highly conserved sequence of Mycoplasma 16S rRNA and optimizing the reaction system, high-sensitivity real-time detection of nine common Mycoplasmas in cell culture is achieved.
[0008] To achieve the above technical objectives, the technical solution adopted by the present invention is as follows: An RPA-CRISPR / Cas12a-based mycoplasma detection method, characterized in that the detection method uses an RPA primer pair, crRNA, and an ssDNA probe; The RPA primer pair is the sequence shown in SEQ ID NO:1 and SEQ ID NO:2; The crRNA is the sequence shown in SEQ ID NO:3; The sequence of the probe is the sequence shown in SEQ ID NO:4.
[0009] The detection method includes the following steps: Step 1: RPA pre-amplification: Using the sample to be tested as a template, perform RPA pre-amplification with the RPA primer pair at a certain temperature to obtain an RPA pre-amplified product.
[0010] Step 2: CRISPR / Cas12a detection: Quickly transfer the RPA pre-amplified product to a CRISPR / Cas12a reaction system containing Cas12a protein, crRNA, and ssDNA probe, place it in a qPCR instrument (fluorescent quantitative PCR instrument) at 37 °C and continue the reaction for 20 - 30 minutes, and monitor the fluorescence signal in real time. After incubation, the detection result can also be directly observed by the naked eye under blue-violet light irradiation.
[0011] Furthermore, the RPA pre-amplification reaction is carried out in the temperature range of 35 °C to 40 °C, preferably 37 °C.
[0012] Furthermore, the RPA pre-amplification time is 10 - 20 minutes, preferably 15 minutes.
[0013] Furthermore, the final concentration of Cas12a and crRNA in the reaction system is 25 - 250 nM, preferably 100 nM.
[0014] Furthermore, the final concentration of the ssDNA probe in the reaction system is 250 - 1000 nM, preferably 500 nM.
[0015] An application of RPA-CRISPR / Cas12a-based mycoplasma detection, characterized in that it is used to detect common mycoplasmas in cell cultures.
[0016] Further, the detection includes nine types of mycoplasmas, namely Mycoplasma pneumoniae, Mycoplasma orale, Mycoplasma fermentans, Spiroplasma Citri, Mycoplasma arginini, Acholeplasma laidlawii, Mycoplasma hominis, Mycoplasma salivarium, and Mycoplasma hyorhinis.
[0017] The advantages of adopting the technical solution of the present invention are as follows: The mycoplasma detection method based on RPA-CRISPR / Cas12a of the present invention can detect the contamination of multiple mycoplasmas in cell cultures, and is simple, accurate in operation. The whole detection process only takes 40 minutes, and the detection result can be directly observed by the naked eye under blue-violet light irradiation. This method has extremely high sensitivity and strong versatility, and can detect samples as low as 10 copies / μL, so as to ensure effective detection at the early stage of contamination, providing a more reliable guarantee for the quality and safety of biological products. Description of the Drawings
[0018] Figure 1 : Verification of RPA primers.
[0019] Figure 2 : Experiment on the absence of reaction components.
[0020] Figure 3 : Optimization of the RPA reaction temperature.
[0021] Figure 4 : Optimization of the RPA pre-amplification reaction time.
[0022] Figure 5 : Optimization of the Cas12a and crRNA concentrations.
[0023] Figure 6 : Optimization of the ssDNA fluorescent probe concentration.
[0024] Figure 7 : Detection of nine types of mycoplasmas using the RPA / CRISPR-Cas12a system.
[0025] Figure 8 : Specificity test of the RPA-CRISPR / Cas12 system.
[0026] Figure 9: Sensitivity test of the RPA-CRISPR / Cas12 system.
[0027] Figure 10 : Determination of mycoplasma concentration by semi-quantitative RPA analysis method.
[0028] Figure 11 : Durability and robustness test of the CRISPR system.
[0029] Figure 12 : Ease-of-use test of the RPA-CRISPR / Cas12 system. Specific implementation mode Experimental materials
[0030] Strains: Mycoplasma pneumoniae (ATCC15531) and Mycoplasma orale (ATCC23714) were purchased from the American Type Culture Collection (ATCC); plasmids of the 16S rRNA sequences of Mycoplasma fermentans (ATCC 19989), Spiroplasma citri (ATCC 27556), Mycoplasma arginini (ATCC 23838), Acholeplasma laidlawii (ATCC 23206), Mycoplasma hominis (ATCC 23114), Mycoplasma salivarium (ATCC 23064), and Mycoplasma acidophilum (ATCC 17981) were all synthesized by Beijing Tsingke Biotechnology.
[0031] Reagent materials: LbCas12a protein was purchased from New England Biolabs; TwistAmp basic nucleic acid amplification kit was purchased from TwistDX; Power SYBR® Green PCR Master Mix was purchased from Applied Biosystems™; Venor®GeM Sample Preparation Kit was purchased from Minerva-Biolabs; DNA primers, ssDNA probes, and crRNAs were all synthesized by Shanghai Sangon Biotech.
[0032] Instruments and equipment: Desktop high-speed centrifuge; ultra-micro spectrophotometer; PCR nucleic acid amplifier; agarose gel electrophoresis apparatus; gel imaging system; real-time fluorescence quantitative PCR instrument (qPCR instrument); vortex shaker; palm centrifuge; electrothermal constant temperature water bath; ultra-pure water machine; ice maker; refrigerator. Example 1 A method for detecting mycoplasma based on RPA-CRISPR / Cas12a
[0033] 1.1 Design and synthesis of RPA primers, crRNAs, ssDNA probes, and plasmids.
[0034] According to the gene conserved sequences of 16S rRNA of nine common mycoplasmas in cell culture, universal primers for RPA and crRNA of Cas12a were designed. First, the gene sequences of 16S rRNA of nine mycoplasmas were downloaded from https: / / www.atcc.org, and the nucleic acid sequences of the nine mycoplasmas were compared using MEGA11 to find the sequences with high homology and high conservation among the nine mycoplasmas and the PAM site (TTTN) of Cas12a to design crRNA. According to the position of crRNA, upstream and downstream primers for RPA (about 30 bp) were designed for the sequences with higher homology upstream and downstream of it respectively. The amplicon length was controlled within 500 bp as much as possible. After the design was completed, the primer specificity was analyzed using Blast, and the primer hairpin structure, self-dimer and heterodimer were analyzed and verified using the online software Oligo Analyzer. The plasmid pUC57 was selected as the vector for the design of the positive plasmid, and the 16S rRNA of nine mycoplasmas respectively was used as the target sequence.
[0035] Table 1 Primer sequences used in the experiment Name Sequence (5'-3') Number of bases Use RPA-F GACTACCAGGGTATCTAATCCTGTTTGCTC (SEQ ID NO:1) 30 RPA primer RPA-R AAACTCCTACGGGAGGCAGCAGTAGGGAAT (SEQ ID NO:2) 30 RPA primer crRNA UAAUUUCUACUAAGUGUAGAUCGCCCAAUAAUUCCGGAUAACGC (SEQ ID NO:3) 44 Cas12a crRNA ssDNA probe 5'6-FAM-CTCTCATTTTTTTTTTAGAGAG-3'-BHQ1 (SEQ ID NO:4) 22 F-Q fluorescence reporter probe Table 2 Mismatch sites between upstream and downstream primers of RPA and crRNA Strain code RPA F (5'-3')[[]]END]] RPA R (5'-3')[[]]END]] crRNA (5'-3')[[]]END]] ATCC 19989 GACTACCAGGGTATCTAATCCTGTTTGCTC <![CDATA[A G ACTCCTACGGGAGGCAGCAGTAGGGAAT]]> CGCCCAAUAAUUCCGGAUAACGC ATCC 15531 <![CDATA[GACTAC T AGGGTATCTAATCCT A TTTGCTC]]> <![CDATA[A T ACTCCTACGGGAGGCAGCAGTAGGGAAT]]> <![CDATA[CGCCCAAUAA A UCCGGAUAACGC <!-- 3 -->]]> ATCC 27556 <![CDATA[GACTAC T AGGGTATCTAATCCT A TTTGCTC]]> <![CDATA G AACTCCTACGGGAGGCAGCAGTAGGGAAT]]> <![CDATA[CGCCCAAUAA A UCCGGAUAACGC]]> ATCC 23838 GACTACCAGGGTATCTAATCCTGTTTGCTC AAACTCCTACGGGAGGCAGCAGTAGGGAAT CGCCCAAUAAUUCCGGAUAACGC ATCC 23714 GACTACCAGGGTATCTAATCCTGTTTGCTC AAACTCCTACGGGAGGCAGCAGTAGGGAAT CGCCCAAUAAUUCCGGAUAACGC ATCC 23206 GACTACCAGGGTATCTAATCCTGTTTGCTC AAACTCCTACGGGAGGCAGCAGTAGGGAAT <![CDATA[CGCCCA G UAA A UCCGGAUAACGC]]> ATCC 23114 GACTACCAGGGTATCTAATCCTGTTTGCTC AAACTCCTACGGGAGGCAGCAGTAGGGAAT CGCCCAAUAAUUCCGGAUAACGC ATCC 23064 GACTACCAGGGTATCTAATCCTGTTTGCTC AAACTCCTACGGGAGGCAGCAGTAGGGAAT CGCCCAAUAAUUCCGGAUAACGC ATCC 17981 GACTACCAGGGTATCTAATCCTGTTTGCTC <![CDATA[A G ACTCCTACGGGAGGCAGCAGTA A GGAAT]]> CGCCCAAUAAUUCCGGAUAACGC The mismatch sites are represented by bold underlined fonts 1.2 Preparation of positive template.
[0036] During the process of preparing the boiled template of the positive strain, first, 1 ml of the bacterial liquid in the logarithmic growth phase was taken out from the liquid medium and transferred to a centrifuge tube. Then, the centrifuge tube was placed in a water bath at 95 °C and heated for 5 minutes to destroy the cell wall and release the genetic material in the bacteria. Subsequently, it was centrifuged at a speed of 10000 g / min for 3 minutes to separate impurities such as cell debris and proteins. After centrifugation, the supernatant was carefully collected, and this supernatant was the crude bacterial liquid template.
[0037] For the extraction of mycoplasma positive template from the cell supernatant, nucleic acid extraction was carried out with reference to the operation instructions of the Venor®GeM Sample Preparation Kit column extraction kit. 2 μL of the mycoplasma positive plasmid solution was aspirated, and the nucleic acid concentration was accurately measured using a Nanodrop instrument. Based on the measured concentration data, the exact copy number of plasmids contained in each microliter of the solution was calculated. In order to construct a series of standard products with different concentrations, the plasmid solution was diluted at a 10-fold gradient to prepare a series of quantitative standard products of positive plasmids with decreasing concentrations.
[0038] 1.3 Construction of RPA-CRISPR detection system.
[0039] RPA system: Take out the RPA rehydration buffer, RPA freeze-dried reaction microspheres, and magnesium acetate (Mg(OAc)2) from the TwistAmp basic nucleic acid amplification kit. Put 30 μL of RPA rehydration buffer, 10 μL of ddH2O, 2.5 μL of RPA-F (10 μM), and 2.5 μL of RPA-R (10 μM) into the RPA freeze-dried reaction microspheres, vortex briefly to mix evenly, divide them into four portions, with 10 μL of each RPA premix.
[0040] CRISPR system: One 18-μL portion of CRISPR premix, including 13 μL of Cas12a Buffer (1×), 2 μL of Cas12a (1 μM), 2 μL of crRNA (1 μM), and 1 μL of ssDNA probe (10 μM).
[0041] RPA-CRISPR detection: Put 2 μL of the sample (or control) and 0.5 μL of Mg(OAc)2 (280 mM) on the tube cap, and one 10-μL portion of RPA premix at the bottom of the tube. After briefly centrifuging to mix evenly, incubate at 37°C for 20 minutes to obtain the RPA pre-amplified product.
[0042] Then transfer 2 μL of the RPA pre-amplified product into one 18-μL portion of the CRISPR premix, quickly oscillate to mix evenly, and then put it into a qPCR instrument. Incubate at 37°C for 20 min, and collect fluorescence signals every 30 seconds. Example 2 Verification of RPA primers
[0043] We precisely amplified the target gene sequences of nine common mycoplasmas according to the method described in Example 1 to verify the universality and practicability of the designed primers. After RPA amplification of the nucleic acids of these mycoplasmas, we purified the amplification products and then identified them by 1% agarose gel electrophoresis.
[0044] The results are as Figure 1 shown, Figure 1 In lanes 1-9 in [figure], they are Mycoplasma pneumoniae (ATCC15531), Spiroplasma citri (ATCC 27556), Mycoplasma fermentans (ATCC 19989), Acholeplasma laidlawii (ATCC 23206), Mycoplasma acidophilum (ATCC 17981), Mycoplasma orale (ATCC23714), Arginine (ATCC 23838), Mycoplasma hominis (ATCC 23114), Mycoplasma salivarium (ATCC 23064), respectively, and NTC is the negative control (nuclease-free water). Figure 1The results showed that specific amplification products of approximately 470 bp were generated from all samples, which was consistent with the expected gene sequence length. In addition, no non-specific bands were observed in the negative control group, further confirming the specificity and accuracy of the experimental method. Example 3 Optimization of the reaction system
[0045] 3.1 Experiment on the deletion of reaction components.
[0046] To explore the effect of the deletion of a certain component on the RPA / CRISPR-Cas12a reaction system, a series of control experiments were carried out based on the method described in Example 1. The samples were successively normal components (Normal), primer deletion (Primer - ), template deletion (Template - ), RPA deletion (RPA - ), Mg(OAc)2 deletion (Mg(OAc)2 - ), LbCas12a deletion (LbCas12a - ), crRNA deletion (crRNA - ), F-Q fluorescence reporter probe deletion (F-Q Report - ). The experimental results are shown in Figure 2 . Figure 2 (A) shows the real-time fluorescence curves of the reaction component deletion system; Figure 2 (B) shows the comparison of fluorescence intensities of the RPA-CRISPR / Cas12a system with different components deleted. Figure 2 The experimental results in show that the integrity of the RPA / CRISPR-Cas12a reaction system is crucial for the success of the experiment. The deletion of any component will cause the reaction system to fail to achieve the expected detection effect.
[0047] 3.2 Optimization of the RPA pre-amplification temperature.
[0048] To explore the most suitable temperature conditions for the RPA reaction and optimize the performance of the RPA / CRISPR-Cas12a fluorescence system, based on the method described in Example 1, screening was carried out at five different reaction temperatures (25°C, 30°C, 35°C, 40°C, 45°C). The experimental data are shown in Figure 3 . Figure 3 (A) shows the effect of different RPA pre-amplification temperatures on the RPA / CRISPR-Cas12a fluorescence system, with a template concentration of 10 7 copies / μL; Figure 3 (B) shows the comparison of fluorescence intensities at different RPA pre-amplification temperatures, with a template concentration of 10 7copies / μL; Figure 3 (C) shows the effect of different temperatures during RPA pre-amplification on the RPA / CRISPR-Cas12a fluorescence system, with a template concentration of 10 3 copies / μL; Figure 3 (D) shows a comparison of the fluorescence intensities at different RPA pre-amplification temperatures, with a template concentration of 10 3 copies / μL. Figure 3 The experimental results reveal that, under the condition of a relatively high template DNA concentration (10 7 copies / μL), five different reaction temperatures can all generate similar fluorescence curves, and the fluorescence intensities are not much different. However, when the template DNA concentration is reduced to 10 3 copies / μL, reaction temperatures of 35 °C and 40 °C significantly promote the amplification efficiency, and the fluorescence signal is significantly enhanced. This finding clearly indicates that the RPA pre-amplification reaction can achieve the best results within the temperature range of 35 °C to 40 °C.
[0049] 3.3 Optimization of RPA pre-amplification time.
[0050] On the basis of the method described in Example 1, the time of the RPA pre-amplification reaction (0 min, 5 min, 10 min, 15 min, 20 min, 25 min, 30 min, 35 min) was optimized, and the experimental results are shown in Figure 4 . Figure 4 (A) shows the effect of different RPA pre-amplification times on the RPA / CRISPR-Cas12a fluorescence system, with a template concentration of 10 7 copies / μL; Figure 4 (B) shows a comparison of the fluorescence intensities at different RPA pre-amplification times, with a template concentration of 10 7 copies / μL; Figure 4 (C) shows the effect of different RPA pre-amplification times on the RPA / CRISPR-Cas12a fluorescence system, with a template concentration of 10 3 copies / μL; Figure 4 (D) shows a comparison of the fluorescence intensities at different RPA pre-amplification times, with a template concentration of 10 3 copies / μL. Figure 4 The results in show that when the template DNA concentration reaches a relatively high level (10 7 copies / μL), after the RPA pre-amplification reaction proceeds for more than ten minutes, the fluorescence curves show a high degree of consistency, and the fluorescence intensities also tend to be stable. Further reducing the template DNA concentration to 10 3When the concentration is
[0051] 3.4 Optimization of Cas12a and crRNA concentrations.
[0052] In this study, to achieve rapid saturation of the reaction, based on the method described in Example 1, different concentrations of LbCas12a protein and crRNA (0 nM, 10 nM, 25 nM, 50 nM, 100 nM, 150 nM, 200 nM, 250 nM) were systematically screened to ensure that the concentration ratio of LbCas12a protein to crRNA remained 1:1. The experimental results are shown in Figure 5 . Figure 5 (A) shows the effect of different Cas12a and crRNA concentrations on the RPA / CRISPR-Cas12a system; Figure 5 (B) shows the comparison of fluorescence intensities generated by different Cas12a and crRNA concentrations through fluorescence detection; Figure 5 (C) shows the observation after 30 min of fluorescence detection of different Cas12a and crRNA concentrations under blue-violet light irradiation. Figure 5 The results in
[0053] reveal the significant effect of concentration on the reaction rate: at a concentration of 10 nM, the reaction progresses slowly, and the fluorescence curve shows a relatively gentle growth trend and does not reach complete reaction within a 20-minute observation period. In contrast, when the concentrations of LbCas12a and crRNA are increased to 100 nM, the fluorescence curve rises rapidly and is almost indistinguishable from the curves at higher concentrations, indicating that this concentration is sufficient to rapidly saturate the reaction and generate fluorescence intensity sufficient to be observed by the naked eye. Based on these findings, we determined 100 nM as the optimal concentration of LbCas12a and crRNA for the RPA / CRISPR-Cas12a fluorescence system, which can not only ensure rapid saturation of the reaction but also achieve high fluorescence intensity output in a short time.
[0053] 3.5 Optimization of ssDNA fluorescence probe concentration.
[0054] Based on the method described in Example 1, the ssDNA probe concentration of the RPA-CRISPR / Cas12a system was optimized by systematically evaluating different concentrations of F-Q fluorescence reporter probes (i.e., ssDNA probes). The experimental results are shown in Figure 6 . Figure 6(A) shows the effect of different ssDNA probe concentrations on the RPA / CRISPR-Cas12a system; (B) shows the comparison of fluorescence intensities generated by different ssDNA probe concentrations through fluorescence detection; (C) shows the observation after 30 min of fluorescence detection of different ssDNA probe concentrations under blue-violet light irradiation. The probe concentrations are 1000 nM, 500 nM, 250 nM, 125 nM, 50 nM, 10 nM, and 0 nM from left to right. Figure 6 The experimental results show that when the ssDNA probe concentration is adjusted to 500 nM, the reaction can quickly reach an equilibrium state and achieve saturation within just 10 minutes, compared with the high-concentration probe of 1000 nM. In contrast, for the low-concentration probes of 125 nM and 250 nM, especially those with a concentration below 250 nM, the fluorescence intensity is so weak that it cannot be recognized by the naked eye. Considering cost-effectiveness, it is advisable to select the probe concentration within the range of 500 nM. Example 4 General applicability verification
[0055] The method described in Example 1 was used to detect nine mycoplasmas, and the detection results are shown in Figure 7 . Figure 7 (A) is the real-time fluorescence curve of the RPA / CRISPR-Cas12a system for detecting different mycoplasmas; Figure 7 (B) is the comparison of fluorescence intensities of different mycoplasmas. As Figure 7 can be seen, this detection method successfully identified all target microorganisms. Notably, for Acholeplasma laidlawii (ATCC 23206), although there are two base mismatches between the amplified target sequence and the crRNA, when the Cas12a enzyme recognizes this mismatched target and triggers the trans-cleavage of the reporter probe, although the release rate of the fluorescence signal slows down, this delay does not affect the detection accuracy. In fact, after about 20 minutes, the intensity of the released fluorescence signal is high enough to be clearly recognized by the naked eye. By 30 minutes, the intensity of the fluorescence signal has stabilized, indicating that the reaction has entered the plateau phase. Therefore, the designed combination of RPA primers and crRNA is efficient and reliable in detecting nine common mycoplasmas including Acholeplasma laidlawii. Example 5 Specificity verification
[0056] The pharmacopoeia's definition of "specificity" emphasizes the importance of accurately identifying and evaluating target nucleic acids in potentially complex biological components. Figure 8Shows the results of specific detection of mycoplasma in cell lines such as Vero (African green monkey kidney cells), CHO (Chinese hamster ovary cells), HEK293 (human embryonic kidney cells), NK92 (natural killer cell line derived from non-Hodgkin lymphoma patients) using the method described in Example 1. Figure 8 (A) is the real-time fluorescence curve of the RPA / CRISPR-Cas12 system for detecting mycoplasma in different cell samples; Figure 8 (B) is the comparison of the fluorescence intensities generated by fluorescence detection of the RPA / CRISPR-Cas12 system for detecting mycoplasma in different cell samples. Figure 8 The results indicate that the detection system has high specificity for the detection efficiency of target nucleic acids in a diverse biological matrix environment. The anti-interference ability of the system against non-target genes ensures the accuracy and reliability of the detection results. Example 6 Sensitivity Verification
[0057] The definition of "detection limit" in the pharmacopoeia refers to the lowest concentration of target nucleic acid that can be accurately and reliably detected in a sample. In this study, a positively quantified plasmid standard containing the 16s rRNA sequence of Mycoplasma fermentans (ATCC 19989) was selected as the test sample to evaluate the sensitivity of the RPA-CRISPR detection method described in Example 1. The experimental results are shown by Figure 9 shown as Figure 9 (A) shows the effect of different concentrations of templates on the RPA / CRISPR-Cas12a system; Figure 9 (B) shows the comparison of the fluorescence intensities generated by fluorescence detection of different concentrations of Cas12a and crRNA; Figure 9 (C) shows the results observed after 30 min of fluorescence detection of different concentrations of Cas12a and crRNA and irradiation with blue-violet light. Figure 9 The experimental results show that the RPA-CRISPR detection system can sensitively detect a target nucleic acid concentration as low as 8.84×10 0 copies / μL. Example 7 Sample Quantitative Analysis
[0058] We detected the samples using a semi-quantitative analysis method and constructed a series of target concentration gradients based on a positively quantified plasmid standard containing the 16s rRNA sequence of Mycoplasma fermentans (ATCC 19989) to determine the target copy number in the samples. To ensure the reliability and repeatability of the experimental results, we conducted three parallel control experiments on the samples. The experimental results are as Figure 10 shown, and the target concentration ranges of the parallel samples correspond to 10 4 / μL to 10 5 / μL, it can be concluded that the target concentration range in the sample is between 10 4 / μL to 10 5 / μL copy numbers. Since the RPA reaction is amplified based on time under isothermal conditions and does not, like qPCR, precisely generate a specific quantity per cycle based on the number of cycles, we can use the semi-quantitative analysis of RPA to infer the concentration of mycoplasma in the sample. Through this method, we not only verified the sensitivity of the detection system but also achieved accurate quantitative analysis of the sample. Example 8 Durability and Robustness Tests
[0059] To improve the usability of the CRISPR system, this study conducted a premixing treatment on it and systematically evaluated its durability and robustness. Specifically, this study prepared a premixed CRISPR system daily and stored it in a 4°C refrigerator. After 7 days of storage, the performance of the premixed CRISPR system was tested using the same sample. The results are as Figure 11 shown. The detection performance of the premixed system from the 1st day to the 7th day of storage at 4°C was not significantly affected. This indicates that the premixed CRISPR system has good stability at 4°C and can maintain its detection efficacy for a long time, thus providing strong support for convenient operation and performance guarantee in practical applications. Example 9 Comparison with Other Mycoplasma Detection Methods
[0060] We collected 67 samples of CHO cell cultures and compared the detection results of three mycoplasma detection methods: the traditional culture method (the first culture method in the mycoplasma inspection method of the third part of the Chinese Pharmacopoeia 2020 edition, 3301), the qPCR method based on polymerase chain reaction (nucleic acid amplification technology NAT in Chapter 2.6.7 of the European Pharmacopoeia), and the latest DETECTR method (the method described in Example 1). The results are shown in Table 3 below. Through the analysis of 67 samples, we found that the coincidence rates of the three methods for detecting mycoplasma are very close, indicating their consistency and reliability in practical applications.
[0061] Table 3 Comparison of the RPA-CRISPR / Cas12 Detection Method with the Culture Method and the qPCR Method Example 10 Usability Test
[0062] To verify the operational convenience and user-friendliness of this mycoplasma detection system, this study selected 4 experimental personnel to conduct detection experiments using the same batch of samples. The experimental results are as Figure 12As shown, there is no significant difference (P > 0.05) between the detection results obtained by different experimenters during the operation process, which indicates that the detection system has good operation consistency and ease of use, and can achieve stable and reliable detection effects even among different operators, thus providing strong support for the wide promotion of the detection system in practical applications.
Claims
1. A mycoplasma detection method based on RPA-CRISPR / Cas12a, characterized in that, The described detection method uses an RPA primer pair, crRNA, and an ssDNA probe. The RPA primer pair is the sequences shown in SEQ ID NO:1 and SEQ ID NO:2; The crRNA is the sequence shown in SEQ ID NO:3; The sequence of the ssDNA probe is the sequence shown in SEQ ID NO:
4.
2. The mycoplasma detection method according to claim 1, characterized in that, It includes the following steps: Step 1: RPA pre-amplification: Using the sample to be tested as a template, perform RPA pre-amplification with the described RPA primer pair at a certain temperature to obtain an RPA pre-amplified product; Step 2: CRISPR / Cas12a detection: Transfer the pre-amplified product to a CRISPR / Cas12a reaction system containing Cas12a protein, crRNA, and ssDNA probe, continue the reaction, and then the detection result can be shown under blue-violet light irradiation.
3. The mycoplasma detection method according to claim 2, characterized in that, The RPA pre-amplification reaction is carried out in the temperature range of 35°C to 40°C, preferably 37°C.
4. The mycoplasma detection method according to claim 2, wherein The RPA pre-amplification reaction time is 10 - 20 minutes, preferably 15 minutes.
5. The mycoplasma detection method according to claim 2, wherein The final concentration of Cas12a protein and crRNA in the reaction system is 25 - 250 nM.
6. The mycoplasma detection method according to claim 2, wherein The final concentration of Cas12a protein and crRNA in the reaction system is 100 nM.
7. The mycoplasma detection method according to claim 2, characterized in that, The final concentration of the ssDNA probe in the reaction system is 250 - 1000 nM.
8. The mycoplasma detection method according to claim 2, wherein, The final concentration of the ssDNA probe in the reaction system is 500 nM.
9. Application of a mycoplasma detection method based on RPA-CRISPR / Cas12a, characterized in that, It is used to detect mycoplasma in cell cultures.
10. The application according to claim 9, characterized in that, The detection includes Mycoplasma pneumoniae, Mycoplasma orale, Mycoplasma fermentans, Spiroplasma citri, Mycoplasma arginini, Acholeplasma laidlawii, Mycoplasma hominis, Mycoplasma salivarium, Mycoplasma eosinophilum nasale.