ZmWOX9B gene mutation detection primer and application thereof in screening corn inbred line with strong somatic cell regeneration capacity

Abstract

The invention discloses a ZmWOX9B gene mutation detection primer and application thereof in screening a corn inbred line with strong somatic cell regeneration capacity, and belongs to the technical field of corn biological breeding. The ZmWOX9B gene mutation detection primer comprises a forward primer as shown in SEQ ID NO. 4 and a reverse primer as shown in SEQ ID NO. 5. The invention further discloses a kit for detecting the ZmWOX9B gene mutation. The ZmWOX9B gene mutation detection primer is a specific primer which is designed according to double target spots designed according to a nucleotide sequence of a ZmWOX9B gene; the sequences of the double target spots are as shown in SEQ ID NO. 2 and SEQ ID NO. 3. The method provided by the invention can be used for directly and quickly predicting the regeneration capacity of the somatic cells of the core inbred line from the gene level, and has important practical significance in accelerating the breeding of excellent inbred line receptors which are excellent in comprehensive characters and can be used for genetic transformation and promoting the research and development process of corn biological breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of maize biological breeding, and particularly relates to a primer for detecting ZmWOX9B gene mutation and its application in screening maize inbred lines with strong somatic cell regeneration ability. Background Art

[0002] The genotype dependence of somatic cell regeneration in maize inbred lines is essentially determined by the core genes that determine somatic cell regeneration endogenously. However, there are few reports on such genes at present, which has become a bottleneck factor restricting biotechnological improvements such as gene editing or transgenic technology in maize. Since Green and Philips first induced callus from maize immature embryos and obtained regenerated plants in 1975, a large number of practices have shown that it is difficult to induce embryogenic callus in the vast majority of maize materials, resulting in almost no somatic cell regeneration and making them unable to be used as direct receptors for foreign genes. Therefore, for many years, genetic transformation of maize in China has still been carried out only around a few inbred lines with unsatisfactory agronomic traits. If these materials are transformed and used for production, they must go through multiple generations of backcrossing and transformation, which not only prolongs the breeding cycle but also often introduces some redundant genes, greatly reducing their application value.

[0003] Therefore, it is urgent to explore the determinant genes and their molecular markers that control maize somatic cell regeneration, and to analyze the molecular network of maize cell fate determination, which is crucial for promoting molecular breeding of inbred lines with high-frequency somatic cell regeneration and ultimately breaking the genotype limitation of recalcitrant maize for transformation. Summary of the Invention

[0004] The purpose of the present invention is to provide a primer for detecting ZmWOX9B gene mutation and its application in screening maize inbred lines with strong somatic cell regeneration ability, so as to solve the problems existing in the above-mentioned prior art. The method provided by the present invention can directly and rapidly predict the somatic cell regeneration ability of core inbred lines at the gene level.

[0005] To achieve the above purpose, the present invention provides the following solutions:

[0006] Technical Solution 1: A primer for detecting ZmWOX9B gene mutation, wherein the primer for detecting ZmWOX9B gene mutation includes a forward primer shown in SEQ ID NO.4 and a reverse primer shown in SEQ ID NO.5.

[0007] Furthermore, the primer for detecting ZmWOX9B gene mutation is a specific primer designed based on two target sites of the nucleotide sequence of the ZmWOX9B gene; the sequences of the two target sites are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0008] Furthermore, the nucleotide sequence of the ZmWOX9B gene is shown as SEQ ID NO.1.

[0009] Technical solution two: Application of the primer for detecting ZmWOX9B gene mutation in screening maize inbred lines with strong somatic cell regeneration ability.

[0010] Technical solution three: A method for screening maize inbred lines with strong somatic cell regeneration ability, comprising the following steps:

[0011] Using the primer for detecting ZmWOX9B gene mutation to amplify the target region of the ZmWOX9B gene of the maize inbred line to be tested; comparing the amplification product with the wild-type ZmWOX9B gene sequence, if there is a frameshift mutation or large fragment base insertion or deletion in the target region, it is determined that the somatic cell regeneration ability of this inbred line is poor; the nucleotide sequence of the ZmWOX9B gene is shown as SEQ ID NO.1.

[0012] The three homozygous mutants exemplified in the embodiments of the present invention, that is, the deletion of 43 or 58 or the insertion of two bases TG only describe the fact that this frameshift mutation will lead to a decrease in somatic cell regeneration ability. Therefore, the implementation means protected by the present invention are not limited to the frameshift mutations caused by the deletion of 43 or 58 or the insertion of TG.

[0013] Furthermore, the frameshift mutation includes a deletion mutation or an insertion mutation between target 1 and target 2; the sequence of target 1 is shown as SEQ ID NO.2; the sequence of target 2 is shown as SEQ ID NO.3.

[0014] Furthermore, the somatic cell regeneration ability is identified by four somatic cell regeneration traits: embryogenic callus induction rate, green callus rate, green shoot regeneration rate, and the number of green shoots differentiated from each young embryo on average.

[0015] Technical solution four: A CRISPR / Cas9 gene editing vector, comprising an sgRNA sequence targeting the ZmWOX9B gene, and the sgRNA sequence includes SEQ ID NO.2 or SEQ ID NO.3.

[0016] Technical solution five: Application of the primer for detecting ZmWOX9B gene mutation or the CRISPR / Cas9 gene editing vector in maize transgenic breeding.

[0017] The present invention discloses the following technical effects:

[0018] Compared with the prior art, the present invention uses specific primers to amplify the target region of the maize ZmWOX9B gene. If the amplified nucleic acid sequence has corresponding frameshift mutations or large fragment base insertions and deletions compared with the wild-type control, it is speculated that the somatic cell regeneration ability of this inbred line is poor and it cannot be used as a direct receptor for maize genetic transformation. The method provided by the present invention can directly and rapidly predict the somatic cell regeneration ability of core inbred lines at the gene level. Compared with separately culturing each material to identify somatic cell regeneration traits through tissue culture, it not only avoids the heavy human and financial input in the experimental process, but also overcomes the technical bottleneck that maize embryo extraction is restricted by its growth cycle, significantly saving various resource costs.

[0019] The present invention uses gene editing technology to knockout the ZmWOX9B gene in the maize inbred line KN5585 with high-frequency somatic cell regeneration. By analyzing the somatic cell regeneration traits of the obtained mutants and their wild types, the aim is to ultimately clarify the function of the homeobox gene ZmWOX9B in the reacquisition of maize somatic cell totipotency and identify molecular markers that can be used to screen for high-frequency somatic cell regeneration. The practical application of the present invention has important practical significance for accelerating the breeding of excellent inbred line receptors with good comprehensive traits and suitable for genetic transformation, and promoting the R & D process of maize biological breeding. Brief Description of the Drawings

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0021] Figure 1 It is the nucleic acid sequence alignment result of the wild-type inbred line KN5585 and its mutants Zmwox9b-1, Zmwox9b-2, and Zmwox9b-3 at the gene editing target site of the ZmWOX9B gene;

[0022] Figure 2 It is the phenotypic comparison of the Zmwox9b homozygous mutant and its wild type during four weeks of callus induction culture: among them, a is the wild-type control; b is the Zmwox9b homozygous mutant;

[0023] Figure 3 It is the phenotypic comparison of the Zmwox9b homozygous mutant and its wild type during two weeks of embryogenic callus redifferentiation; among them, a is the wild-type control; b is the Zmwox9b homozygous mutant;

[0024] Figure 4 It is the dynamic development process of embryogenic callus redifferentiation of the Zmwox9b homozygous mutant and its wild type KN5585. Detailed implementation manners

[0025] The various exemplary implementation manners of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and implementation schemes of the present invention.

[0026] It should be understood that the terms used in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0027] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0028] Without departing from the scope or spirit of the present invention, various improvements and variations can be made to the specific implementation manners of the specification of the present invention, which are obvious to those skilled in the art. Other implementation manners obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are merely exemplary.

[0029] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.

[0030] The present invention uses the core inbred lines commonly used in northern maize breeding and the constructed segregating population as research materials. By using two methods, whole-genome resequencing and liquid-phase chip, and combining two means, GWAS and QTL mapping, a total of 14 consistent and stable major candidate genes are screened out. They are widely involved in pathways such as signal transduction, stress response, redox, and gluconeogenesis, and the phenotypic contribution rates they explain are between 5.7% and 24.39%. Among them, the homeobox gene ZmWOX9B is a new candidate gene, which encodes a WUSCHEL-related homeobox 9b transcription factor and has never been reported in previous related studies. This gene is mined in the somatic regeneration trait of the greening callus rate, and the phenotypic variation it explains is as high as 24.17%, indicating that ZmWOX9B may play a role in the initial stage of plant somatic cell differentiation. The present invention further uses qPCR technology to analyze the expression pattern of ZmWOX9B. The results show that the expression of this gene first shows a downward trend during the callus induction process of the inbred line with strong somatic regeneration ability, and then up-regulates to reach the highest level at 12 days of induction, and returns to the initial expression level at 16 days of induction; while its expression level in the inbred line with poor regeneration ability is lower than the former, and it hardly expresses in the culture at 16 days of induction, indicating that there are obvious differences in the response of the gene ZmWOX9B to callus induction culture. It is known from querying the MaizeGDB website that this gene is only highly expressed in the early stage of zygotic embryo development and does not express in other tissues and organs. Further indirectly indicates that the coding product of ZmWOX9B may play a function in determining the fate of maize somatic cells.

[0031] Example 1

[0032] Select the maize inbred line KN5585 with strong somatic regeneration ability and widely used in genetic transformation as the receptor. According to the nucleotide sequence (SEQ ID NO.1) of the ZmWOX9B gene in its genome, two target sites (single gene, two target sites) are designed, and the target site sequence information is as follows:

[0033] Target site 1: CGTCGTCTGACACGGCTCGGCGG (SEQ ID NO.2);

[0034] Target site 2: CCGTCCCTCCTCTCAGCTGGCGG (SEQ ID NO.3);

[0035] The full length of the nucleotide sequence of the ZmWOX9B gene is 5286bp, as shown below (the underlined parts in the sequence are target site 1 (front) and target site 2 (back) respectively):

[0036] Nucleotide sequence of the ZmWOX9B gene:

[0037] AAAAAAGAGACATCCTGTTCCTCGCAAGAAGCAGCTCACCCGACCATGCAATGCATGCACGGTCAAAATTGCCGCCCCATCGCCCTGTGACGCGGCTGCAGTTCTCATTCCTTCCGGCAAATGGGATCGGAAAGGCGAGGCGACGCCCGGAGGTCGCCATCACGCCCCGAAAGGCACCGTCAGAAATGGCAGGACACGGCATCGGGGACGCTTCGGTTTTTCGTGTCTACCTTGCTTGGCAGTGGCAGCAGCAGGCGTATATATGCTACTGCTACTGTAGCAGCCAGCTCGCCCGCCCGTACCTTCGCACGTTGCAGTACCCATCCGGCATGGTACAGCGAGTTCCCTCCCGATGCAACGCCACGCGACCGGGTCTCGCGAGCACGCATCTCCAAGCAGGGCGAGACTGGACTGGAGAGACTGGCCTCGCTCGGCCAGTAGTGTAGAACTGGGAGACCGACCATTCATTGCGTGGCAACGCTGCGCGAGCGCGAGACGACCGAGGGTAGGTGCTGCCATTATAAGAGGCAGCCAGCAGCAGTGTGCGAGCGTTCTCAGCCTAGCCGAGCCCCGTAGCGTGTAGCGAGAAGGTGCGACAGCAGGGTAGGGAGCTCACTGTTAGTCGTTCCTCCGATCCACAGATGAATCAGTGGTAGACTGCTGGTAGTAGTATATATACAATCTCTAGCTGTGCCGCTGTTTTAGAGTATCGTCGTGAGAGCTCACAAGGAGAAGATCTGGTGCTGCGAAAGGGAGAAGAAAAGAAGAAGAAGAAATCAGCTCAGCTCAGCATGGCTTCCTCGTCCTTCAACAACAGTCACTGGCCGAGCATGTTCAGGTCCAAGCACGCCGCCGAGCCGTGTCAGACGACGCAGCCTGACATCAGCAGCTCACCG CCGTCCCT CCTCTCAGCTGGCGG

[0038] Construct the CRISPR / Cas9 expression vector of the target gene according to the above double-target sequence information. The specific primers for amplifying the target region are designed as follows:

[0039] ZmWOX9B-F: AGCTGCCGCTGTTTTAGAGT (SEQ ID NO.4);

[0040] ZmWOX9B-R: GGAGTCAGCTTCACCTCTCG (SEQ ID NO.5).

[0041] Transfer the constructed editing vector into the recipient inbred line KN5585 by Agrobacterium-mediated method to obtain maize mutants with homozygous mutations in the ZmWOX9B gene, named Zmwox9b-1, Zmwox9b-2 and Zmwox9b-3 respectively; use specific primers to amplify and sequence the editing target segments of the three mutants and their wild types. It can be seen that: the mutant Zmwox9b-1 deleted 58 bases between target 1 and target 2 compared with the recipient control; the mutant Zmwox9b-2 deleted 43 bases between target 1 and target 2; the mutant Zmwox9b-3 inserted two bases TG at target 1. Specifically as Figure 1 shown.

[0042] Further plant the mutants Zmwox9b-1, Zmwox9b-2, Zmwox9b-3 and their wild types in the greenhouse respectively. When the maize reaches the flowering stage, perform self-pollination. About 12-13 days after pollination, randomly pick 20 ears from each material, and strip 50 young embryos from each ear on the sterile operating table for tissue culture to identify four somatic regeneration-related traits: embryogenic callus induction rate, greening callus rate, green shoot regeneration rate and average number of green shoots differentiated from each young embryo; the phenotypic data of each material are shown in Table 1.

[0043] Table 1

[0044]

[0045]

[0046] As can be seen from Table 1: the four traits of embryogenic callus induction rate, greening callus rate, green shoot regeneration rate and average number of green shoots differentiated from each young embryo of the mutants Zmwox9b-1, Zmwox9b-2 and Zmwox9b-3 are all significantly lower than those of the wild type control (P<0.01). Among them, the green shoot regeneration rate of the mutants is the lowest, only 5.88%, which is significantly lower than 73.02% of the recipient inbred line, indicating that the loss of function of the gene ZmWOX9B inhibits the somatic cell regeneration of maize.

[0047] Figure 2 Phenotypic comparison between the homozygous mutant Zmwox9b and its wild type at four weeks of callus induction culture. It can be seen that the callus volume of the mutant is significantly smaller than that of the wild type KN5585, and its morphological structure is denser, with significantly fewer surface granules. Further, the above-mentioned embryogenic calli were cultured under light for 2 weeks. It was found that although the cultures of each mutant grew to some extent, the ratio of green dots appearing on their surfaces decreased (53.86%-64.07%), and only a few calli differentiated into regenerated green seedlings; while the greening rate of the wild type reached 93.67%, and at the same time, the embryogenic calli grew vigorously and there were more regenerated green seedlings ( Figure 3 ). The dynamic development process of redifferentiation of embryogenic calli of mutant Zmwox9b and its wild type is shown in Figure 4 .

[0048] From Figure 2 and Figure 4 , it can be known that when maize immature embryos were induced for 4 weeks, the callus volume of mutant Zmwox9b was significantly smaller than that of the wild type KN5585, and its morphological structure was denser, with significantly fewer surface granules.

[0049] From Figure 3 and Figure 4 , it can be known that further differentiating the above-mentioned embryogenic calli for 2 weeks, although the cultures of the homozygous mutant Zmwox9b grew to some extent, the ratio of green dots appearing on their surfaces decreased, and only a few calli differentiated into regenerated green seedlings; while the greening rate of the wild type reached more than 90%, and at the same time, the embryogenic calli grew vigorously and there were more regenerated green seedlings. It shows that the loss of function of gene ZmWOX9B inhibits the somatic cell regeneration of maize inbred lines.

[0050] The above experiment confirmed that after the homeobox gene ZmWOX9B undergoes a frameshift mutation in the editing target region, the potential of maize somatic cells to regain totipotency is inhibited, resulting in a significant decline in its regeneration ability. Therefore, based on this discovery, in the future, the above-mentioned specific detection primers can be used to amplify and sequence the target segment of the ZmWOX9B gene in maize with unknown phenotypes. By comparing the sequences with the wild-type gene ZmWOX9B, maize inbred lines with high-frequency somatic cell regeneration can be screened batchwise and quickly, providing receptor materials for maize transgenic breeding.

[0051] The application of the present invention not only avoids the heavy manpower and financial investment in plant tissue culture, but also overcomes the technical bottleneck that maize embryo extraction is restricted by its growth cycle, significantly saving various resource costs.

[0052] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A primer for detecting ZmWOX9B gene mutation, characterized in that, The primer for detecting ZmWOX9B gene mutation includes the forward primer shown in SEQ ID NO.4 and the reverse primer shown in SEQ ID NO.

5.

2. The ZmWOX9B gene mutation detection primer according to claim 1, wherein The primer for detecting ZmWOX9B gene mutation is a specific primer designed based on two target sites of the nucleotide sequence of ZmWOX9B gene; the sequences of the two target sites are shown in SEQ ID NO.2 and SEQ ID NO.

3.

3. The ZmWOX9B gene mutation detection primer according to claim 1 or 2, characterized in that, The nucleotide sequence of the ZmWOX9B gene is shown in SEQ ID NO.

1.

4. Application of the primer for detecting ZmWOX9B gene mutation according to any one of claims 1-3 in screening maize inbred lines with strong somatic cell regeneration ability.

5. A method for screening maize inbred lines with strong somatic cell regeneration ability, characterized in that, It includes the following steps: Using the primer for detecting ZmWOX9B gene mutation according to any one of claims 1-3, amplify the target region of ZmWOX9B gene of the maize inbred line to be tested; compare the amplified product with the wild-type ZmWOX9B gene sequence. If there is a frameshift mutation or large fragment base insertion or deletion in the target region, it is determined that the somatic cell regeneration ability of this inbred line is poor; the nucleotide sequence of the ZmWOX9B gene is shown in SEQ ID NO.

1.

6. The method according to claim 5, characterized in that, The frameshift mutation includes deletion mutation or insertion mutation between target site 1 and target site 2; the sequence of target site 1 is shown in SEQ ID NO.2; the sequence of target site 2 is shown in SEQ ID NO.

3.

7. The method according to claim 5, characterized in that, The somatic cell regeneration ability is identified by four somatic cell regeneration traits: embryogenic callus induction rate, green callus rate, green seedling redifferentiation rate, and number of green seedlings differentiated from each immature embryo on average.

8. A CRISPR / Cas9 gene editing vector, characterized in that, It contains an sgRNA sequence targeting the ZmWOX9B gene, and the sgRNA sequence includes SEQ ID NO.2 or SEQ ID NO.

3.

9. Application of the primer for detecting ZmWOX9B gene mutation according to any one of claims 1-3 or the CRISPR / Cas9 gene editing vector according to claim 8 in maize transgenic breeding.

Images