SNP molecular markers associated with solitary and clustered fruiting branches in pepper and their application

Abstract

The present invention discloses a single-nucleotide polymorphism (SNP) molecular marker associated with the solitary or clustered development of pepper fruit branches and its application, belonging to the field of molecular marker-assisted breeding. The SNP molecular marker of the present invention is located at base 9558960 of chromosome Chr06 of the pepper genome, and has a polymorphism of either T or C. The present invention also provides primers for detecting the SNP molecular marker and a kit for detecting the solitary or clustered development of pepper fruit branches. These markers can be used to screen pepper varieties with clustered development of fruit branches, and can quickly and accurately identify the fruit branch type of pepper plants during the seedling stage, without having to wait until the plants enter the flowering stage for phenotypic observation. This marker has good application prospects in large-scale surveys of fruit branch types in pepper germplasm resources.

Description

Technical Field

[0001] The invention belongs to the field of molecular marker-assisted breeding, and particularly relates to a SNP molecular marker associated with solitary and clustered pepper fruit branches and an application thereof. Background Art

[0002] The branching pattern of pepper (Capsicum annuum L.) directly influences plant architecture, fruit yield, and mechanized harvesting efficiency. Shortened, clustered fruit branches have important applications in increasing pepper planting density, optimizing light utilization, and enabling mechanized harvesting. Currently, screening for branching traits in peppers relies primarily on phenotypic observations during mid- to late-stage plant growth, rather than during the seedling stage. This results in a long phenotypic identification cycle. Pepper branching is also susceptible to significant environmental interference, making accurate phenotyping difficult. The lack of efficient molecular markers for high-throughput detection of pepper branching makes it difficult for breeders to quickly and accurately identify pepper branching phenotypes by genotyping pepper plants during the seedling stage, thus hindering the efficiency of high-density planting cultivars. Therefore, there is an urgent need to develop a genetic molecular marker based on KASP technology to accurately identify pepper branching at an early stage, shorten the breeding cycle, improve selection efficiency, and reduce environmental interference with phenotyping. Summary of the Invention

[0003] The purpose of the present invention is to address the problems existing in traditional breeding and provide a SNP molecular marker related to the solitary and clustered development of pepper fruit branches and its application for quickly, accurately and reliably distinguishing the development types of pepper fruit branches.

[0004] To achieve the above-mentioned object, the technical solution of the present invention is as follows: providing a SNP molecular marker related to the solitary and clustered fruit branches of pepper, wherein the SNP molecular marker is located at base 9558960 of Chr06 chromosome in the pepper genome CNA0036143 (The 3D architecture of the pepper genome and its relationship to function and evolution. Nat Commun, 2022 / 06 / 16; 13(1): 3479.), and the polymorphism is T or C; the phenotype corresponding to the TT genotype is the solitary fruit branch type; the phenotype corresponding to the CC genotype is the clustered fruit branch type.

[0005] Furthermore, the sequence of the TT genotype is shown in SEQ ID NO.1, and the sequence of the CC genotype is shown in SEQ ID NO.2.

[0006] The present invention also provides the use of the SNP molecular marker in identifying whether pepper fruit branches grow solitary or clustered.

[0007] The present invention also provides a primer for detecting the SNP molecular marker, comprising two forward primers and one reverse primer, wherein the nucleotide sequences of the two forward primers are shown as SEQ ID NO.3 and SEQ ID NO.4 respectively, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.5.

[0008] The present invention also provides the use of a reagent for detecting the SNP molecular marker in identifying whether pepper fruit branches grow solitary or clustered.

[0009] Furthermore, the reagent includes two forward primers with nucleotide sequences as shown in SEQ ID NO.3 and SEQ ID NO.4 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.5; the application includes the following steps: using the reagent to perform PCR amplification on the genomic DNA of the pepper to be tested; if in the PCR amplification result, the color of the fluorescent signal is consistent with the color of the fluorescent linker of the forward primer with a sequence as shown in SEQ ID NO.3, the pepper to be tested is a homozygous genotype TT and the phenotype is a solitary fruit branch type; if the color of the fluorescent signal is consistent with the color of the fluorescent linker of the forward primer with a sequence as shown in SEQ ID NO.4, the pepper to be tested is a homozygous genotype CC and the phenotype is a clustered fruit branch type; if the color of the fluorescent signal is different from the color of the fluorescent linker of the forward primer with a sequence as shown in SEQ ID NO.3 or SEQ ID NO.4, the pepper to be tested is a heterozygous genotype TC.

[0010] The present invention also provides a kit for detecting solitary and clustered pepper fruit branches, which comprises the primers (SEQ ID NOs. 3-5) and a PCR amplification reagent.

[0011] The present invention also provides application of the kit in identifying whether pepper fruit branches grow solitary or in clusters.

[0012] The present invention has the following beneficial effects: The KASP marker provided by the present invention can be used to screen pepper varieties with clustered fruit branches. It allows for rapid and accurate identification of fruit branch types in pepper seedlings, eliminating the need to wait until the plants enter the flowering stage for phenotypic observation. This allows for large-scale surveys of fruit branch types in pepper germplasm resources, providing molecular tools for genetic diversity research and discovery of superior genes, improving breeding efficiency and shortening the breeding cycle. Based on the KASP marker, a commercial detection kit can be developed to meet the pepper fruit branch type identification needs of seed companies, breeding companies, and research institutions. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 The figure is a diagram of the fruit branch growth type of the parent materials D60 (single fruit branch) and CT4 (clustered fruit branch) in Example 1; wherein, Figure 1 (A) is the fruit branch growth type diagram of D60. Figure 1 (B) in the figure is the fruit branch growth type diagram of CT4;

[0014] Figure 2 The QTL location map based on the BSA mixed pool group analysis method according to Example 1;

[0015] Figure 3 This is a schematic diagram of the QTL mapping results of Example 1;

[0016] Figure 4 This is a fluorescence scatter plot obtained by KASP typing of multiple pepper materials based on the SNP marker at position 9558960 of chromosome Chr06 in Example 2. DETAILED DESCRIPTION

[0017] Unless otherwise specified, the methods used in the following examples are all conventional methods.

[0018] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0019] Example 1: Acquisition of SNP molecular marker sites highly associated with pepper fruit branch types.

[0020] (1) Construction of F2 segregating populations of solitary and clustered pepper fruit branches.

[0021] The male parent D60 with single fruit branches and the female parent CT4 with clustered fruit branches were used for hybridization to obtain F1, which was then self-pollinated to construct F2 populations with single and clustered pepper fruit branches. Figure 1 The statistical results of F1 and F2 phenotypes showed that fruit branch clustering was a recessive trait.

[0022] (2) QTL (Quantitative Trait Locus) positioning and molecular marker development.

[0023] The fruit branch types of the F2 population were identified, and 50 individual plants with extreme solitary and extreme clustered growth were selected. High-quality DNA was extracted, and two extreme pools were constructed and sequenced. BSA-Seq (Bulked Segregant Analysis - Sequencing) was used for QTL mapping. Specifically, the delta-SNPindex algorithm was used to locate QTL loci associated with the target trait. The mapping results obtained by analysis are shown in the figure below. Figure 2 Its physical location is located at 5.76Mb - 16.63Mb of chromosome Ca_59Chr06, as shown in Figure 3Furthermore, a linked molecular marker related to the QTL was developed, wherein when the pepper fruit branch type is solitary, the nucleotide at position 9558960 of chromosome Ca_59Chr06 is T; and when the pepper fruit branch type is clustered, the nucleotide at position 9558960 of chromosome Ca_59Chr06 is C.

[0024] Example 2: Validation of SNP molecular markers based on competitive allele-specific polymerase chain reaction (KASP) technology.

[0025] (1) Design of KASP detection primers.

[0026] The sequences of 200 bp upstream and 200 bp downstream of the 9558960th base position of chromosome Ca_59Chr06 were extracted and organized into the following format, where T / C represents the two haplotypes of solitary and clustered.

[0027] The TT genotype sequence is shown in SEQ ID NO.1:

[0028] TTTTTTTTTTGGGTGGGGGGTGGGGGGGGAACCAAATTAATTTCTTACTTTTTTTTTCCCCTAATGTTTGATAAGTAAACAACAGAAAATCTTATCTCAAACACATTTATGTGTAATCTAGCAAAACCTTTAGAAGTGGCGAGGGTGAGGTGTGGGACCTCAAGGTGGCGACAGACAAGAGGTAGGAATTGAGGGTGTTAT GTGGGTGAGAGGATACAATAAACATACGTGTCTCTTATAACACTTGTTTTCCCCACTTCTAATCAGGAATTTATTTTTCTGATTTTTAAGGAGCTTGTTTTTCTATAAAAAAAATATTAACATAAACCGCACTAATATGGACCGAATTACTTCCTATATCGTATCATTTCAATATTACATAAAATCTCGAAAAAACTGC.

[0029] The CC genotype sequence is shown in SEQ ID NO.2:

[0030] TTTTTTTTTTGGGTGGGGGGTGGGGGGGGAACCAAATTAATTTCTTACTTTTTTTTTCCCCTAATGTTTGATAAGTAAACAACAGAAAATCTTATCTCAAACACATTTATGTGTAATCTAGCAAAACCTTTAGAAGTGGCGAGGGTGAGGTGTGGGACCTCAAGGTGGCGACAGACAAGAGGTAGGAATTGAGGGTGTTAC GTGGGTGAGAGGATACAATAAACATACGTGTCTCTTATAACACTTGTTTTCCCCACTTCTAATCAGGAATTTATTTTTCTGATTTTTAAGGAGCTTGTTTTTCTATAAAAAAAATATTAACATAAACCGCACTAATATGGACCGAATTACTTCCTATATCGTATCATTTCAATATTACATAAAATCTCGAAAAAACTGC;

[0031] Two forward primers and one reverse universal primer were designed using the Primer3Plus (https: / / www.primer3plus.com / ) online website. The 3' end of the forward primer was the base T / C at position Ca_59Chr06:9558960. The nucleotide sequences of the two forward primers are shown in SEQ ID NO.3 (F1) and SEQ ID NO.4 (F2), respectively. The nucleotide sequence of the reverse primer is shown in SEQ ID NO.5 (R).

[0032] (2) Verify the SNP molecular marker at position Ca_59Chr06:9558960.

[0033] Using the KASP genotyping test kit (FLU-ARMS for KASP2× PCR Mix) from Guangzhou Good Biotechnology Co., Ltd., according to the instructions in the manual, competitive allele-specific polymerase chain reaction was performed on 10 D60 (single homozygous plants), 10 CT4 (cluster homozygous plants), 5 F1 (D60×CT4) plants, and 50 pepper plants in the recessive extreme cluster mixed pool, a total of 75 samples, for KASP typing to verify the SNP in Example 1. The reaction system is shown in Table 1, the reaction process is shown in Table 2, and the KASP typing results are shown in Table 2. Figure 4 shown.

[0034] Table 1: Reaction system components

[0035]

[0036] Table 2: Reaction process table

[0037]

[0038] The material with T base at chromosome Ca_59Chr06:9558960 can bind to the F1 primer and extend, and HEX fluorescence will be detected at a wavelength of 533-580nm ( Figure 4 The green dot in the middle) is the C base at chromosome Ca_59Chr06:9558960, which can bind to the F2 primer and extend. FAM fluorescence will be detected at a wavelength of 465-510 nm. Figure 4 If only HEX fluorescence is detected, it means that the genotype of the material at the Ca_59Chr06:9558960 position is TT. If only FAM fluorescence is detected, it means that the genotype of the material at the Ca_59Chr06:9558960 position is CC. If both HEX fluorescence and FAM fluorescence are detected, it means that the genotype of the material at the Ca_59Chr06:9558960 position is TC. Figure 4 In this example, the designed KASP primers were used to conduct competitive allele-specific polymerase chain reaction on 10 D60 (homozygous single plants), 10 CT4 (homozygous clustered plants), 5 F1 (D60×CT4) and 50 F2 (D60×CT4) plants with the recessive trait extreme clustered pepper. Figure 4 The typing results show that the molecular marker Ca_59Chr06:9558960 related to the fruit branch type proposed in the examples of this application has high stability and high credibility. This molecular marker can be used to quickly determine the type of pepper fruit branch, thereby accurately and efficiently screening the fruit branch type and discovering pepper varieties suitable for mechanized harvesting.

[0039] In summary, the present invention provides a SNP variant that can distinguish between solitary and clustered fruiting branches in peppers. This variant has been identified and is conserved in a variety of solitary and clustered peppers, and can be developed as a molecular marker for rapid, accurate, and reliable differentiation of pepper fruiting branch developmental types. The present invention also provides primers and a detection kit for detecting this variant, which has a positive impact on molecular-assisted breeding of peppers for different fruiting branch developmental types.

[0040] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.

Claims

1. A SNP molecular marker associated with solitary and clustered fruiting of pepper, characterized in that: The SNP molecular marker is located at base 9558960 of Chr06 chromosome of pepper genome CNA0036143, and the polymorphism is T or C; the sequence of TT genotype is shown in SEQ ID NO.1, and the corresponding phenotype is solitary fruit branch type; the sequence of CC genotype is shown in SEQ ID NO.2, and the corresponding phenotype is clustered fruit branch type.

2. A primer for detecting the SNP molecular marker according to claim 1, characterized in that: The primers include two forward primers and one reverse primer, wherein the nucleotide sequences of the two forward primers are shown as SEQ ID NO.3 and SEQ ID NO.4 respectively, and the nucleotide sequence of the one reverse primer is shown as SEQ ID NO.

5.

3. Use of a reagent for detecting the SNP molecular marker according to claim 1 in identifying solitary or clustered pepper fruit branches, characterized in that: The reagent is used to detect base 9558960 of Chr06 chromosome of pepper genome CNA0036143. If the base is T, the pepper fruit branch type is solitary; if the base is C, the pepper fruit branch type is clustered; the reagent includes two forward primers with nucleotide sequences as shown in SEQ ID NO.3 and SEQ ID NO.4 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.

5.

4. The use according to claim 3, characterized in that The application comprises the following steps: using the reagent to perform PCR amplification on the genomic DNA of the pepper to be tested; if in the PCR amplification result, the color of the fluorescent signal is consistent with the color of the fluorescent linker of the forward primer whose sequence is shown as SEQ ID NO.3, the pepper to be tested is a homozygous genotype TT, and the phenotype is a solitary fruit branch type; if the color of the fluorescent signal is consistent with the color of the fluorescent linker of the forward primer whose sequence is shown as SEQ ID NO.4, the pepper to be tested is a homozygous genotype CC, and the phenotype is a clustered fruit branch type; if the color of the fluorescent signal is different from the color of the fluorescent linker of the forward primer whose sequence is shown as SEQ ID NO.3 or SEQ ID NO.4, the pepper to be tested is a heterozygous genotype TC.

5. A kit for detecting solitary or clustered pepper fruit branches, characterized in that: The kit comprises the primers according to claim 2 and a PCR amplification reagent.

6. Use of the kit according to claim 5 in identifying solitary or clustered pepper fruit branches, characterized in that: The kit is used to detect the base 9558960 of Chr06 chromosome of pepper genome CNA0036143. If the base is T, the pepper fruit branch type is solitary; if the base is C, the pepper fruit branch type is clustered.

Images