Kit and method for detecting human papilloma virus

By combining LAMP and CRISPR/Cas technology, the color reaction of chromatographic test strips is used to achieve convenient, efficient and highly specific HPV detection, solving the problem of equipment dependence and false positives in the existing technology, and is suitable for home self-testing.

CN120249557APending Publication Date: 2025-07-04XIAMEN MEDICAL COLLEGE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510367490.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-26
Publication Date
2025-07-04

Smart Images

  • Figure CN120249557A_ABST
    Figure CN120249557A_ABST
Patent Text Reader

Abstract

The invention discloses a kit and a method for detecting human papilloma virus, and belongs to the technical field of biological detection.The detection method comprises the steps that a target sequence in a nucleic acid sample to be detected is amplified, then CRISPR reaction is conducted through a CRISPR / Cas reaction system, and finally result interpretation is conducted through chromogenic reaction of a chromatographic test strip. According to the invention, the LAMP amplification technology and the CRISPR detection technology are combined and have complementary advantages, and the CRISPR / Cas technology is utilized to make up the defect that the LAMP amplification is easy to generate false positive; the CRISPR / Cas technology after LAMP is combined, the detection result can be directly judged by naked eyes according to the color development condition of the chromatographic test strip, and efficient, sensitive and specific POCT detection without complex equipment is realized.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biological detection, and particularly relates to a kit and method for detecting human papillomavirus. Background Art

[0002] Cervical cancer is one of the common cancers in women, and its occurrence is related to the persistent infection of high-risk human papillomavirus (HPV). This persistent infection refers to the infection of the same type of HPV for more than 6 - 12 months.

[0003] HPV is an envelopeless, double-stranded deoxyribonucleic acid (DNA) virus. Therefore, the two main current methods for cervical cancer screening are cervical cytology examination and HPV DNA detection. Among them, cytology examination is more commonly used in China, but it has problems such as low sensitivity, subjective results, difficult quality assurance, and short screening interval. Compared with cytology examination, HPV DNA detection technology can screen high-risk populations to the greatest extent, detect precancerous lesions at an early stage, avoid the occurrence of cervical cancer, and at the same time can extend the screening interval.

[0004] Currently, the main method for detecting HPV DNA is real-time fluorescence PCR method, which combines PCR amplification and fluorescence probe detection technology. That is, a fluorescence reporting group capable of reflecting the reaction process is added to the PCR reaction system. As the PCR reaction proceeds, the fluorescence signal intensity also accumulates and increases continuously according to a specific law with the PCR product. At the same time, every time a thermal cycle passes, the quantitative PCR instrument collects a fluorescence signal, and the amplification process of PCR is monitored in real time by monitoring the change of the fluorescence intensity in the reaction system. The fluorescence quantity is proportional to the amount of amplification product, and the nucleic acid quantity of the sample is determined by detecting the fluorescence quantity. However, real-time fluorescence PCR requires thermal cycles at different temperatures, the process is relatively cumbersome, and it has a high dependence or requirement on instruments, laboratories, and professional experimental personnel. The results are also prone to false positives due to cross-contamination of samples.

[0005] Therefore, it is of positive significance to provide a method and detection product for detecting high-risk HPV that are sensitive, convenient for self-testing. Summary of the Invention

[0006] The object of the present invention is to provide a method and detection kit for detecting high-risk HPV virus with high sensitivity, high specificity, convenient and efficient detection, which can realize home self-testing of high-risk HPV.

[0007] To achieve one of the objects of the present invention, the present invention provides a method for detecting high-risk HPV virus, which is a non-disease diagnosis and treatment method, and includes the following steps:

[0008] S1. Amplify the target sequence in the nucleic acid sample to be tested using the loop-mediated isothermal amplification method to obtain a LAMP amplification product;

[0009] S2. Configure a reaction system for the CRISPR reaction to obtain a reaction product. The reaction system includes a Cas protein, an sgRNA, a reporter probe, and the LAMP amplification product obtained in step S1 and / or a transcription product obtained by in vitro transcription of the LAMP amplification product;

[0010] S3. Add the reaction product to the sample pad of the chromatographic test strip for detection, and read the color development result.

[0011] Further, the Cas protein is Cas13 protein and / or Cas14 protein.

[0012] Further, in step S1, the primers for loop-mediated isothermal amplification include two outer primers F3 and B3, two inner primers FIP and BIP, and two loop primers LF and LB.

[0013] Further, in step S1, the time for amplifying the target sequence in the nucleic acid sample to be tested using the loop-mediated isothermal amplification method is less than 20 min.

[0014] Further, when the detection target is the HPV58 virus, the nucleotide sequence of the sgRNA in the step is as shown in SEQ ID NO.7.

[0015] Further, the detection method is used for multiplex detection of HPV viruses. The Cas protein includes Cas13 protein and Cas14 protein. The reporter probe includes an ssRNA reporter probe and an ssDNA reporter probe. The Cas13 protein cleaves ssRNA and the ssRNA reporter probe, and the Cas14 protein cleaves ssDNA and the ssDNA reporter probe.

[0016] Further, when the method is used for detecting the HPV52 virus, the reporter probe sequence of the Cas13 cleavage substrate ssRNA is: 5'-FITC-UUAUU-Biotin, and the nucleotide sequence of SgRNA-52 is as shown in SEQ ID NO.14.

[0017] Another object of the present invention is to provide a kit for detecting high-risk HPV viruses, which includes a sample pad, a conjugate pad, and a nitrocellulose membrane that are sequentially overlapped. The sample pad is used for dropping or immersing the sample to be tested. The conjugate pad stores a first labeled antibody and / or a second labeled antibody. The NC membrane is provided with a control line and a detection line. The detection line includes a first detection line and / or a second detection line. Streptavidin is coated at the control line, and a species-specific antibody is coated at the detection line.

[0018] Furthermore, the kit contains LAMP Primer Mix, ssDNA reporter probe and / or ssRNA reporter probe, and one end of the reporter probe is modified with biotin.

[0019] Furthermore, it also contains transcription buffer, ribonucleotide mixture and T7 RNA polymerase.

[0020] Compared with the prior art, the beneficial effects of the present invention at least include the following:

[0021] 1. The present invention provides a convenient detection kit and detection method. In this detection method, the target sequence in the nucleic acid sample to be detected is first amplified, and then the CRISPR reaction is carried out using the CRISPR / Cas reaction system. Finally, the result is judged through the color reaction of the chromatographic test strip. By combining the LAMP amplification and CRISPR detection technologies, they complement each other's advantages, and the CRISPR / Cas technology is used to make up for the defect that LAMP amplification is prone to false positives; the CRISPR / Cas technology combined with LAMP can directly judge the detection result with the naked eye through the color development of the chromatographic test strip, realizing efficient, sensitive, specific and POCT detection without complex equipment.

[0022] 2. The detection method provided by the present invention can simultaneously detect the problem of multiple HPV subtype infections. In the same system, Cas13 and Cas14 enzymes are used to cut two reporter probes respectively, and then the chromatographic test strip can detect whether the sample contains two cut probes. The cut probes will present a "detection line" of a predetermined color on the test strip, and finally realize the dual-target nucleic acid detection of two different types of HPV viruses.

[0023] 3. When the detection method provided by the present invention is applied to single-index detection, weak positive results can appear when the sample concentration is 1×10 2 copies / μL, and obvious positive results can appear when it is 1×10 4 copies / μL.

[0024] 4. The sensitivity, specificity and accuracy of the dual-index detection method provided by the present invention are all greater than 94%. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 : Schematic diagram of the structure and color development judgment diagram of the single-index detection test strip provided in Example 1;

[0026] Figure 2 : Comparative diagram of experimental results at different amplification temperatures in the single-index detection method provided in Example 1;

[0027] Figure 3: Comparative chart of experimental results at different amplification times in the single-index detection method provided in Example 1;

[0028] Figure 4 : Comparative chart of experimental results at different Cas14 protein concentrations in the single-index detection method provided in Example 1;

[0029] Figure 5 : Comparative chart of experimental results at different sgRNA concentrations in the single-index detection method provided in Example 1;

[0030] Figure 6 : Comparative chart of experimental results of the sensitivity of the single-index detection method provided in Example 1;

[0031] Figure 7 : Structural schematic diagram and color development determination diagram of the dual-index detection test strip provided in Example 2;

[0032] Figure 8 : Comparative chart of experimental results of the specificity of the single-index detection method provided in Example 2. Detailed implementation manners

[0033] The object of the present invention is to provide a high-risk HPV comprehensive instant detection method and kit based on LAMP+CRISPR+chromatographic test strip, and this method and kit can provide a more convenient, efficient and user-friendly option for detecting high-risk HPV in the home self-test environment.

[0034] For a clearer presentation, the present invention will be described in detail below with reference to the accompanying drawings and specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention. Unless otherwise specified, the raw materials, reagents or equipment selected in the present invention are all commercially available.

[0035] The present invention first provides a new detection method for high-risk HPV. This method is a non-disease diagnosis and treatment method, and this method includes three steps:

[0036] S1. Using the loop-mediated isothermal amplification method to amplify the target sequence in the nucleic acid sample to be detected to obtain a LAMP amplification product;

[0037] S2. Configure a reaction system to carry out a CRISPR reaction to obtain a reaction product. The reaction system includes a Cas protein, an sgRNA, a reporter probe, and the LAMP amplification product obtained in step S1 and / or a transcription product obtained by in vitro transcription of the LAMP amplification product;

[0038] S3. Add the reaction product to the sample pad of the chromatographic test strip for detection, and read the color development result.

[0039] The present invention is based on the principle of CRISPR detection: when the target nucleic acid exists in the system to be detected, after the guide RNA (sgRNA) and the Cas protein complex bind to the target, the bypass cleavage activity of the Cas protein is activated, and then the reporter probe is non-specifically cleaved. By labeling the reporter probe with a fluorophore and a quencher group, the detection result is converted into a visual fluorescence signal or a test strip band, and then read.

[0040] In the present invention, step S1 performs nucleic acid amplification by the loop-mediated isothermal amplification (LAMP) method. The purpose of this step is to amplify the signal of the target gene, ensuring the detection of the target gene with high specificity and high sensitivity.

[0041] Since CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is an adaptive immune system of bacteria that can recognize and cleave specific DNA or RNA sequences through CRISPR-associated proteins (Cas). The CRISPR / Cas system consists of a guide / wizard RNA sequence (sgRNA) that targets a specific region of exogenous genomic material and an effector Cas (CRISPR-associated nuclease) protein.

[0042] The Cas proteins used in CRISPR detection technology mainly include Cas9, Cas12, Cas13, and Cas14. Among them, in addition to the function of specifically cleaving the target sequence, Cas12, Cas13, and Cas14 also have the function of non-specifically cleaving other nucleic acid sequences (i.e., the trans-cleavage activity of the Cas protein) after cleaving the target sequence. In the state of trans-cleavage activation, any single strand can be non-specifically cleaved, and the fluorescently labeled probe in the system can be chopped up, which can be used to detect signals. Thus, it can be used to develop various gene detection technologies.

[0043] The following will expand and explain each step in more detail according to different embodiments.

[0044] Example 1:

[0045] This example provides a method and a detection kit for detecting high-risk HPV viruses of a single type (also known as single-index detection). This example demonstrates the process of home detection of HPV58 virus using the CRISPR-Cas14 system, which includes the following steps:

[0046] S1. Use the loop-mediated isothermal amplification method to amplify the target sequence in the nucleic acid sample to be detected to obtain a LAMP amplification product;

[0047] Specifically, step S1 includes the following steps:

[0048] S111. Construction of the standard plasmid:

[0049] According to the GenBank database, in combination with the sequence of the publicly disclosed HPV58 gene (GenBank: PQ177798.1), it was synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the HPV58 gene was cloned into the pUC57 vector, and sequencing verification was completed.

[0050] S112. Design of the LAMP amplification primers for the HPV58 gene:

[0051] According to the conserved gene sequences registered in GenBank, the correctly sequenced HPV58 gene positive recombinant plasmid was used as the standard. Using a primer design website (https: / / lamp.neb.com / #! / ), 3 - 5 sets of primer designs were screened, and primers suitable for LAMP amplification were selected through aspects such as amplification efficiency and specificity. These primers include two outer primers: F3 and B3, two inner primers: FIP and BIP, and two loop primers: LF and LB. The sequence numbers of each primer are shown in Table 1. Then the primers in Table 1 were synthesized manually and reserved for use.

[0052] Table 1 HPV58 LAMP primer sequence table

[0053]

[0054]

[0055] S113. Configure the LAMP amplification reaction system of this embodiment (see Table 2), mix the prepared reaction system and place it in a metal bath, set the reaction temperature to 63°C, and after amplification for 15 minutes, obtain the LAMP amplification product, which can be taken out for the reaction in the subsequent step S2.

[0056] Table 2 HPV58 LAMP amplification reaction system

[0057] Component Added Volume Reaction Quantity / Final Concentration WarmStartLAMP2XMasterMix 12.5 μL 1x 10×LAMPPrimerMix 2.5 μL 1x TargetDNA 2 μL / 0 μL 100 copies / uL Nuclease-freeWater 25 μL /

[0058] In Table 2, the composition of WarmStart LAMP 2X Master Mix: 40 mM Tris-HCl, 8 U Bst polymerase, 6 mM MgCl2, 0.8 M betaine, 2.5 mM dNTP, 20 mM (NH4)2SO4, 0.1% Tween20, pH 8.8;

[0059] 10×LAMP Primer Mix: 2 μM each of HPV58-F3 and HPV58-B3, 16 μM each of HPV58-FIP and HPV58-BIP, and 4 μM each of HPV58-LF and HPV58-LB.

[0060] S2. Configure a reaction system for the CRISPR reaction to obtain a reaction product. The reaction system includes a Cas protein, an sgRNA, a reporter probe, and the LAMP amplification product obtained in step S1.

[0061] In this example, the CRISPR-Cas14 protein system is used for detection. Compared with Cas9, Cas12, and Cas13 proteins, the molecular weight of Cas14 protein is generally smaller (400 - 700 aa), which makes it easier for Cas14 protein to be delivered into cells, especially important for gene therapy and diagnostic applications. Cas14 protein also does not require a PAM sequence, which enables it to target more genomic sequences and makes the design of sgRNA simpler.

[0062] In this example, the composition of the reaction system for the CRISPR reaction is shown in Table 3. The addition of T7 exonuclease can make the double-stranded DNA (dsDNA) of the LAMP amplification product become single-stranded DNA (ssDNA), thus serving as a target strand for Cas14 protein-mediated molecular detection.

[0063] Table 3 CRISPR detection reaction system for single-index HPV58

[0064] Component Added Volume Reaction Quantity / Final Concentration 10×ReactionBuffer 2 μL 1× Cas14 1 μL 200 nM sgRNA-58 1 μL 500 nM ssDNA-Report58 1 μL 100 nM T7exonuclease 1 μL 5U LAMP Amplification Product 2 μL 0.1 - 100 nM <![CDATA[H2O]]> Make up to 20 μL

[0065] In Table 3, sgRNA is a key component in the CRISPR / Cas system. It can guide the Cas protein to recognize and cut specific DNA sequences. Cas14 can bind to and cut the target sequence of single-stranded DNA and does not require a specific PAM sequence. Therefore, the sequence of the LAMP amplification product of the HPV58 gene is mainly considered during the design of the guide RNA (sgRNA, also known as the guide RNA). The guide sRNA (gRNA) consists of CRISPR RNA (crRNA) and CRISPR RNA (tracrRNA). The three parts, the binding targets of both to the HPV58 product, are synthesized in vitro into sgRNA.

[0066] In the natural system, the function of CRISPR requires crRNA and trRNA, and these two RNAs are separate components in the natural system. In this example, we artificially synthesized these two separate RNAs in advance and combined them into one RNA, namely sgRNA. By designing sgRNA to replace the traditional two-component tracrRNA-crRNA, the stability and activity of the system were improved.

[0067] In this example, the nucleotide sequence of the in vitro synthesized guide RNA (sgRNA-58) is shown as follows:

[0068] sgRNA-58: 5'-CTTCACTGATAAAGTGGAGAACCGCTTCACCAAAAGCTGTCCCTT AGGGGATTAGAACTTGAGTGAAGGTGGGCTGCTTGCATCAGCCTAATGTCGAGAAG TGCTTTCTTCGGAAAGTAACCCTCGAAACAAATTCATTTGAAAGAATGAAGGAATGC AACACCGTGGTTGATACCACTCG-3'; as shown in SEQ ID NO.7.

[0069] The sequence of the reporter probe ssDNA-Report58 for Cas14 to cleave the substrate - ssDNA is: 5'-Dig-TTATT-Biotin-3'. This is a single-stranded DNA with a short sequence, whose 5′ end is modified with digoxin (Dig, DIG) and 3′ end is modified with biotin (Biotin). These two modification groups can specifically bind to the chromatographic test strip. Under the guidance of sgRNA, Cas14 can cleave the single-stranded template DNA and the fluorescently labeled probe. After the probe is activated, Cas14 is cleaved, and it can be determined whether HPV58 exists in the test sample by the chromatographic test strip or a fluorescence tester.

[0070] In Table 3, the composition of the 10×Reaction Buffer is: Tris-HCl: 4000 mM, pH 7.3, NaCl: 600 mM, MgCl2: 600 mM, 0.1% Tween20.

[0071] The reaction system provided in this example reacts at 37°C for 20 minutes to obtain a reaction product.

[0072] S3. Add the reaction product to the sample pad of the chromatographic test strip for detection and read the color development result.

[0073] Specifically, in step S3, it is first necessary to obtain a chromatographic test strip capable of result reading, which is mainly achieved by the high affinity between streptavidin (SA) and biotin (Biotin). The structure of the chromatographic test strip is shown in Figure 1 as follows:

[0074] Along the chromatographic extension direction, the test strip includes a sample pad, a conjugate pad, and a nitrocellulose membrane (NC membrane) that are sequentially lapped. The sample pad is used to drop or immerse the sample to be tested. The conjugate pad stores an anti-digoxin (DIG) specific antibody conjugated with gold nanoparticles. The NC membrane is provided with a control line (C line) and a test line (T line). Streptavidin ( Figure 1 abbreviated as avidin in the text) is coated at the control line, and goat anti-mouse IgG is coated at the test line.

[0075] The test strip may further include a blotting pad, a bottom plate, and a plastic cassette. The blotting pad is located at the end of the chromatographic direction and can provide continuous driving force for chromatography. The bottom plate is arranged below the sample pad, the conjugate pad, the NC membrane, and the blotting pad and is a skeleton supporting the shape of the test strip. The plastic cassette sheathes the test strip to protect it.

[0076] The preparation process of the test strip can be as follows:

[0077] Treatment of the sample pad: The sample pad (i.e., the specimen pad) treatment solution including buffer, surfactant, etc. is evenly coated on the specimen pad (i.e., the sample pad) and dried at 37 °C for 24 h;

[0078] Preparation of the conjugate pad: The mouse anti-digoxin (DIG) monoclonal antibody is combined with colloidal gold nanoparticles to form a labeled antibody, and the labeled antibody is evenly coated on the conjugate pad with the diluted conjugate treatment solution and dried at 37 °C for 24 h.

[0079] Treatment of the reaction membrane: Streptavidin and goat anti-mouse IgG are respectively sprayed onto the control line (C line) and test line (T line) positions of the nitrocellulose membrane using a membrane scribing instrument and dried at 37 °C for 48 h. The prepared specimen pad (i.e., the sample pad), conjugate pad (i.e., the conjugate pad), and NC membrane (i.e., the reaction membrane) are sequentially pasted on the PVC bottom plate and cut into strips with a width of 3 mm using a strip cutter.

[0080] In this embodiment, the reporter probe ssDNAReport58 labeled with fluorophore DIG and biotin can bind to the anti-digoxin (DIG) specific antibody conjugated with gold nanoparticles. When the reporter probe is not cleaved, biotin binds to streptavidin at the C line, forming the first color band; when the target DNA is present, the activation of bypass cleavage causes the reporter probe to be cleaved, and digoxin (DIG) and the DIG specific antibody conjugated with gold nanoparticles travel further on the strip and bind to the species-specific secondary antibody at the T line, forming the second color band.

[0081] During detection, immerse the sample application area of the test strip into the reaction product solution in step S2, and the result should appear within 5 minutes.

[0082] Refer to Figure 1 As shown, the following four detection results may occur after loading:

[0083] (1) One red band appears on the test strip at the test line (T line). A positive result indicates that the sample contains the nucleic acid fragment to be detected, and the quantity thereof ≥ the minimum detection amount of the test strip; this is a strong positive.

[0084] (2) Two red bands appear on the test strip at the control line (C line) and the test line (T line). Explanation: A positive result indicates that the sample contains the nucleic acid fragment to be detected, but the content of the HPV target gene is small and cannot completely cleave the reporter probe. The biotin on the intact reporter probe can bind to streptavidin to form the first color band. At the same time, the activation of bypass cleavage causes the reporter probe to be cleaved, and digoxin (DIG) and the DIG-specific antibody conjugated with gold nanoparticles travel further on the strip and bind to the species-specific secondary antibody at the T line to form the second color band; this is a weak positive.

[0085] (3) One red band appears on the test strip at the control line (C line), this is a negative result;

[0086] (4) No red band appears on the test strip, this is an invalid result.

[0087] The new detection method and kit provided by the present invention are applicable to self-sampling for HPV detection, with simple operation, convenient and confidential throughout the process, avoiding the time for registering and queuing in the hospital, and at the same time protecting personal privacy.

[0088] In order to obtain the optimal reaction conditions, this example also carried out a comparative optimization experiment on the LAMP reaction temperature, LAMP reaction time, sgRNA concentration for Cas14 detection, and Cas14 concentration to find the best experimental conditions.

[0089] Specifically, a single-factor experiment was used for comparison. In each experiment, nuclease-free water was used as a negative (blank) control, and plasmid standard was used as a positive sample.

[0090] The optimization of the LAMP (loop-mediated isothermal amplification) reaction temperature is a key step to ensure the high efficiency, specificity and sensitivity of the reaction. For the optimization experiment of the LAMP reaction temperature, the design is as follows: Since the conventional reaction temperature range of the LAMP system is between 60 °C and 65 °C, to determine the optimal reaction temperature for amplification, the copy number is 1×10 5Plasmid standards at copies / μL were amplified for 15 min at 60 °C, 63 °C, and 65 °C according to the above system. After the reaction, the amplification products were subjected to steps S2 and S3, and the color development results were read to select the optimal reaction temperature for the subsequent CRISPR / Cas14+ chromatographic test strip.

[0091] Refer to Figure 2 It can be seen that the color development effects at 63 °C and 65 °C are equivalent, both being positive, and 60 °C is weakly positive. Therefore, 63 °C was selected as the optimal reaction temperature.

[0092] Optimization of the LAMP (loop-mediated isothermal amplification) reaction time is an important link to ensure the detection efficiency and avoid "false positives". The experimental design for optimizing the LAMP reaction time was as follows: Plasmid standards at 5 copies / μL were incubated at a constant temperature of 63 °C for 10 min, 15 min, and 20 min respectively. After the reaction, the amplification products were subjected to steps S2 and S3, and the color development results were read to select the optimal reaction time for the subsequent CRISPR / Cas14+ chromatographic test strip.

[0093] Refer to Figure 3 It can be seen that a relatively clear positive result can be obtained after reacting for 15 minutes. Therefore, the optimal reaction time was determined to be 15 minutes. Compared with other LAMP reactions that require 30 - 60 minutes, the short reaction time in this experiment is related to the design of 6 pairs of primers.

[0094] The optimized Cas14 protein concentration should be able to complete efficient cleavage in the shortest time and produce sufficient cleavage products. The experimental design for optimizing the Cas14 protein concentration was as follows: On the basis of setting the amplification temperature and amplification time in step S1 to 63 °C and 15 min, the Cas14 protein concentration in the LAMP-CRISPR / Cas14 (reaction system of step S2) was changed alone, and it was set to 100 nM, 200 nM, and 300 nM. After steps S1 - S3, the color development results were read to select the optimal Cas14 protein concentration for the subsequent CRISPR / Cas14+ chromatographic test strip.

[0095] Refer to Figure 4 It can be seen that Cas14 has high cleavage efficiency for DNA at all three concentrations. Therefore, the optimal Cas14 protein concentration is 100 nM.

[0096] To verify that the sgRNA sequence does not contain a stable secondary structure and has high cleavage ability, the experimental design for optimizing the sgRNA concentration is as follows: on the basis of setting the amplification temperature and amplification time in step S1 to 63°C and 15 min, and the concentration of Cas14 protein to 100 nM, in the LAMP-CRISPR / Cas14 (reaction system in step S2), only the sgRNA protein concentration is changed and set to 100 nM, 200 nM, and 300 nM. After reading the color development results through steps S1 - S3, the optimal sgRNA protein concentration is selected for the subsequent CRISPR / Cas14 + chromatographic test strip.

[0097] Refer to Figure 5 It can be seen that a clear color development detection effect can appear when the sgRNA concentration is 100 nM. Therefore, our optimal sgRNA concentration is 100 nM.

[0098] Based on the above experimental results, fully considering the time and consumable costs, the LAMP reaction temperature in step S1 is preferably 63°C, the LAMP reaction time is preferably 15 min, the concentration of Cas14 protein in step S2 is preferably 100 nM, and the sgRNA concentration is preferably 100 nM.

[0099] Under the conditions of these experimental parameters (the LAMP reaction temperature in step S1 is preferably 63°C, the LAMP reaction time is preferably 15 min, the concentration of Cas14 protein in step S2 is preferably 100 nM, and the sgRNA concentration is preferably 100 nM), this example also conducts a sensitivity experiment on the single-index detection method to determine the lowest detectable concentration of the detection method. The specific experimental process is as follows: Use the 10-fold dilution method to dilute the HPV58 recombinant plasmid to 1×10 6 copies / μL, 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 a total of 6 gradients, and use these as templates for single-index method testing, and set up a negative control to determine the sensitivity of this detection method. At the same time, compare the sensitivity with the established conventional PCR method. The sensitivity analysis is repeated 3 times.

[0100] Refer to Figure 6 It can be seen that a weak positive can appear in this method at 1×10 2 copies / μL, and an obvious positive result can appear at 1×10 3 copies / μL. This result is more than 10 times higher than the sensitivity (LOD) of the conventional PCR detection.

[0101] Example 2:

[0102] This embodiment provides a method and a detection kit for detecting high-risk HPV viruses with dual models / dual indicators.

[0103] Current visual detection of HPV focuses on detecting single-target samples, which makes it difficult to meet the industry's detection requirements for multiple-target positives, especially the identification of different subtypes of the same disease. Previous research reports show that the common infectious types in China are HPV52 (19.7%), 16 (11.9%), 58 (11.5%). In addition to single-subtype infections, a considerable number of patients also have multiple HPV subtype infections (5.7%), and the most common combination of multiple HPV subtypes is HPV52+58.

[0104] Since the LAMP amplification products are all double-stranded DNA, Example 1 has demonstrated how to use Cas14 protein for single-indicator detection (it is easy to think that it is not limited to HPV58 in Example 1). However, compared with this single indicator, more complex problems are faced in detecting multiple indicators on the same test paper.

[0105] This embodiment selects to simultaneously use Cas13 and Cas14 proteins / enzymes in the same system to cleave the probes (Report52, Reprot58) respectively. Among them, the RNA signal Report52 probe corresponding to Cas13 enzyme (cleaved by Cas13), and the ssDNA signal Report58 probe corresponding to Cas14 enzyme (cleaved by Cas14). Since Cas13 itself is not directly used to detect DNA, in order to achieve the detection of HPV52 by Cas13, an indirect method for detecting DNA is considered. In this detection system, HPV52 DNA can be amplified to obtain dsDNA, then transcribed into RNA by T7 transcriptase, and then the RNA cleavage activity of Cas13 is used to achieve highly sensitive detection.

[0106] This embodiment demonstrates the process of simultaneously using Cas13 and Cas14 proteins / enzymes in the same system for home detection of HPV52 and HPV58, which includes the following steps:

[0107] S1. Use the loop-mediated isothermal amplification method to amplify the target sequence in the nucleic acid sample to be tested to obtain LAMP amplification products;

[0108] Specifically, step S1 includes the following steps:

[0109] S121. Construction of standard plasmid:

[0110] According to the GenBank database, combined with the sequences of the publicly disclosed HPV52 gene (GenBank: PQ177660.1) and HPV58 gene (GenBank: PQ177798.1), it was sent to Sangon Biotech (Shanghai) Co., Ltd. for synthesis, and the HPV52 gene and HPV58 gene were cloned into the pUC57 vector, and sequencing verification was completed.

[0111] S122. Design of LAMP amplification primers for S122, HPV52 gene and HPV gene:

[0112] The primer design of HPV58 is the same as that in Example 1 and will not be elaborated here.

[0113] For HPV52, based on the conserved gene sequences registered in GenBank, the correctly sequenced HPV52 gene positive recombinant plasmid was used as the standard. Using a primer design website (https: / / lamp.neb.com / #! / ), 3 - 5 sets of primer designs were screened, and primers suitable for LAMP amplification were selected through aspects such as amplification efficiency and specificity. These primers include two outer primers: F3 and B3, two inner primers: FIP and BIP, and two loop primers: LF and LB. The sequence numbers of each primer are shown in Table 1. Then the primers in Table 1 were synthesized manually and reserved for use.

[0114] Table 4 LAMP primer sequence table of HPV52

[0115]

[0116] S123. Configure the LAMP amplification reaction system of this example (see Table 5), mix the prepared reaction system and place it in a metal bath, set the reaction temperature at 63°C, and after amplification for 15 min, obtain the LAMP amplification product, which can be taken out for subsequent CRISPR reaction. It should be noted that in the dual - index detection method, different target sequences are amplified separately.

[0117] Table 5 LAMP amplification reaction system of HPV52

[0118] Component Added Volume Reaction Quantity / Final Concentration WarmStart LAMP 2X Master Mix 12.5 μL 1x 10×LAMP Primer Mix 2.5 μL 1x Target DNA 2 μL / 0 μL 100 copies / uL Nuclease-free Water 25 μL /

[0119] In Table 5, the composition of WarmStart LAMP 2X Master Mix: 40 mM Tris - HCl, 8 U Bst polymerase, 6 mM MgCl2, 0.8 M betaine, 2.5 mM dNTP, 20 mM (NH4)2SO4, 0.1% Tween20, pH 8.8;

[0120] 10×LAMP Primer Mix: 2 μM each of HPV52-F3 and HPV52-B3, 16 μM each of HPV52-FIP and HPV52-BIP, and 4 μM each of HPV52-LF and HPV52-LB.

[0121] S2. Configure a reaction system to perform a CRISPR reaction to obtain a reaction product. The reaction system includes a Cas protein, an sgRNA, a reporter probe, and the LAMP amplification product obtained in step S1 and / or a transcription product obtained by in vitro transcription of the LAMP amplification product;

[0122] In this example, it also includes a step of performing in vitro transcription on the amplification product of HPV52 to obtain a transcription product so that the Cas13 protein can recognize it. The composition of the transcription reaction system (taking a 20 μL system as an example) in this step is shown in Table 6.

[0123] Table 6 Transcription reaction system for HPV52 LAMP amplification product

[0124] Component Added Volume 10× Transcription Buffer 2 μL Ribonucleotide Mix (ATP, GTP, CTP, UTP 10 mM each) 2 μL T7 RNA Polymerase (20 U / μL) 1 μL LAMP Amplification Product of HPV52 1 - 2 μL <![CDATA[RNase-free ddH2O]]> Make up to 20 μL

[0125] In Table 6: The composition of the 10× transcription buffer: Tris-HCl: 500 - 1000 mM, pH 7.5 - 8.0; MgCl2: 20 - 200 mM; DTT (dithiothreitol): 10 - 100 mM; Spermidine: 10 - 100 mM.

[0126] This transcription reaction system can obtain a transcription product by incubating at 37°C for 30 minutes.

[0127] In this example, the composition of the reaction system for performing the CRISPR reaction is shown in Table 7. The addition of T7 exonuclease can make the double-stranded DNA (dsDNA) of the LAMP amplification product become single-stranded DNA (ssDNA), thereby serving as a target strand for Cas14 protein-mediated molecular detection.

[0128] Table 7 CRISPR detection reaction system for dual indicators HPV52 and HPV58

[0129] Component Added Volume Reaction Quantity / Final Concentration 10×ReactionBuffer 2 μL 1× Cas13 1 μL 200 nM Cas14 1 μL 200 nM sgRNA-52 1 μL 500 nM sgRNA-58 1 μL 500 nM ssRNA-Report52 1 μL 100 nM ssDNA-Report58 1 μL 100 nM T7exonuclease 1 μL 5U LAMP Amplification Product 2 μL 0.1 - 100 nM Transcription Product 2 μL 0.1 - 100 nM <![CDATA[H2O]]> Make up to 30 μL

[0130] In Table 7, sgRNA is a key component in the CRISPR / Cas system. It can guide the Cas protein to recognize and cleave specific DNA sequences. For multi-index detection, in this embodiment, the CRISPR detection technology utilizes the CRISPR-Cas13 and CRISPR-Cas14 systems. The Cas13 system mainly detects RNA and can efficiently recognize and cleave single-stranded RNA (ssRNA); the Cas14 system mainly detects DNA and can efficiently recognize and cleave single-stranded DNA (ssDNA). Due to the different cleavage types of the Cas13 and Cas14 proteins, different types of reporter genes (ssRNA-Report52 and ssDNA-Report58) need to be designed to achieve dual-index detection.

[0131] The nucleotide sequence number of sgRNA-58 of HPV58 and the sequence of the reporter probe ssDNA-Report58 of the Cas14 cleavage substrate-ssDNA are the same as those in Example 1 and will not be elaborated here.

[0132] The Cas13 system is a CRISPR-based RNA-targeting tool that binds and cleaves at specific sites of the transcribed RNA of HPV52 under the guidance of artificial sgRNA. It releases a powerful non-specific single-stranded RNA trans-cleavage activity that can efficiently cleave any single-stranded ssRNA in the system. The Cas13 sgRNA (i.e., sgRNA-52) consists of two parts: a repeat sequence (used to form a stem-loop structure, which is the binding site of the Cas13 protein) and a spacer sequence (used to bind the RNA transcribed by HPV52 and activate the binding and cleavage activity of the Cas13 protein).

[0133] Similarly, in this embodiment, we pre-synthesize 2 separate RNAs artificially into one RNA, namely sgRNA. By designing sgRNA, it replaces the traditional two-component tracrRNA-crRNA, improving the stability and activity of the system.

[0134] In this embodiment, the nucleotide sequence of the in vitro synthesized guide RNA sgRNA-52 is as follows:

[0135] sgRNA-52: 5’-GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACCUGCAAUACAGGGUAUUUAGAAUUAAAU-3'; as shown in SEQ ID NO.14.

[0136] The sequence of the ssRNA-Report52 reporter probe for Cas13 to cleave the substrate-ssRNA is as follows: 5'-FITC-UUAUU-Biotin-3'. This is a single-stranded RNA of a short sequence, with its 5′ end modified with fluorescein isothiocyanate (FITC) and its 3′ end modified with biotin (Biotin). These two modification groups can specifically bind to the test strip. Under the guidance of sgRNA, Cas13 can cleave the single-stranded template RNA and the reporter ssRNA-Report52 probe. By detecting the fluorescence signal and / or the lateral test strip, it can be known whether the HPV52 gene is present in the sample.

[0137] In Table 7, the composition of the 10×Reaction Buffer is: Tris-HCl: 4000 mM, pH 7.3, NaCl: 600 mM, MgCl2: 600 mM, 0.1% Tween20.

[0138] The CRISPR detection reaction system for the dual indicators HPV52 and HPV58 provided in this example reacts at 37°C for 20 minutes to obtain a reaction product.

[0139] S3. Add the reaction product to the sample pad of the chromatographic test strip for detection and read the color development result.

[0140] Specifically, in step S3, first, a chromatographic test strip for result reading needs to be obtained, which is mainly achieved by the high affinity between streptavidin (SA) and biotin (Biotin). The structure of the chromatographic test strip is shown in Figure 7 as follows:

[0141] Along the chromatographic extension direction, the test strip includes a sample pad, a conjugate pad, and a nitrocellulose membrane (NC membrane) that are sequentially overlapped. The sample pad is used to drop or immerse the sample to be tested. The conjugate pad stores an anti-digoxin (DIG) specific antibody conjugated with gold nanoparticles and an anti-FITC specific antibody conjugated with gold nanoparticles. The NC membrane is provided with a quality control line (C line) and two test lines (T1 line and T2 line). The quality control line is coated with streptavidin ( Figure 7 abbreviated as avidin in the text), the T1 line is coated with goat anti-rabbit IgG, and the T2 line is coated with goat anti-mouse IgG.

[0142] The test strip may further include an absorbent pad, a bottom plate, and a plastic cartridge. The absorbent pad is located at the end of the chromatographic direction and can provide continuous power for chromatography. The bottom plate is arranged below the sample pad, the conjugate pad, the NC membrane, and the absorbent pad and is a skeleton for supporting the shape of the test strip. The plastic cartridge sleeves the test strip to protect the test strip.

[0143] The preparation process of the test strip is as follows:

[0144] Treatment of the sample pad: The specimen pad (i.e., the sample pad) treatment solution containing buffer, surfactant, etc. was evenly coated on the specimen pad (i.e., the sample pad) and dried at 37°C for 24 h.

[0145] Preparation of the conjugate pad: The mouse anti-DIG monoclonal antibody was combined with colloidal gold nanoparticles to form labeled antibody I. The diluted conjugate treatment solution was used to evenly coat labeled antibody I on the conjugate pad and dried at 37°C for 24 h. The rabbit anti-FITC monoclonal antibody was combined with colloidal gold nanoparticles to form labeled antibody II. The diluted conjugate treatment solution was used to evenly coat labeled antibody II on the conjugate pad and dried at 37°C for 24 h.

[0146] Treatment of the reaction membrane: Using a membrane scribing instrument, streptavidin, goat anti-rabbit IgG, and goat anti-mouse IgG were respectively sprayed onto the positions of the control line (C line), test line T1 line, and test line T2 line of the nitrocellulose membrane and dried at 37°C for 48 h. The prepared specimen pad (i.e., the sample pad) (i.e., the sample pad), conjugate pad (i.e., the conjugate pad), and NC membrane (i.e., the reaction membrane) were successively pasted on the PVC bottom plate and cut into strips with a width of 3 mm using a strip cutting machine.

[0147] The reporter probe ssDNAReport58 labeled with the fluorophore DIG and biotin can bind to the anti-digoxin (DIG) specific antibody conjugated with gold nanoparticles; the reporter probe ssRNAReport52 labeled with FITC fluorescein and biotin can bind to the anti-FITC specific antibody conjugated with gold nanoparticles; when the reporter probe is not cleaved, biotin binds to streptavidin to form the first color band; when the target RNA is present, the activation of bypass cleavage causes the reporter probe to be cleaved, and the target RNA or FITC travels further on the strip with the anti-FITC specific antibody conjugated with gold nanoparticles and binds to the species-specific secondary antibody to form the second color band; when the target DNA is present, the activation of bypass cleavage causes the reporter probe to be cleaved, and digoxin (DIG) and the DIG specific antibody conjugated with gold nanoparticles travel further on the strip and bind to the species-specific secondary antibody to form the third color band.

[0148] During detection, the sample addition area of the test strip was immersed in the reaction product solution in step S2, and the result should appear within 5 minutes.

[0149] Refer to Figure 7 As shown, after loading, the following five detection results can occur:

[0150] (1) One red band appears on the test strip, located at the test line (T1 line or T2). A positive result indicates that the sample contains the nucleic acid fragment to be detected, and its quantity ≥ the minimum detection amount of the test strip; this is a strong positive, T1 represents positive for HPV52, and T2 represents positive for HPV58;

[0151] (2) Two red bands appear on the test strip, located at the test lines (T1 line, T2 line). A positive result indicates that the sample contains the nucleic acid fragment to be detected, and the quantity thereof ≥ the minimum detectable amount of the test strip; this is a strong positive, indicating dual infection with HPV52 and HPV58;

[0152] (3) Three red bands appear on the test strip, located at the control line (C line) and the test lines (T1 line, T2 line). Explanation: A positive result indicates that the sample contains the nucleic acid fragment to be detected, but the content of the HPV target gene is small and cannot completely cleave the reporter probe. This is a weak positive.

[0153] (4) One red band appears on the test strip, located at the control line (C line), this is a negative result;

[0154] (5) Zero red bands appear on the test strip, this is an invalid result.

[0155] The new detection method and kit provided by the present invention are applicable to self-sampling for HPV detection, with simple operation, convenient and confidential throughout the process, avoiding the time of registering and queuing in the hospital, and at the same time protecting personal privacy.

[0156] In order to evaluate the specificity of the dual-index detection method provided in this embodiment, in this embodiment, the positive plasmids of HPV52, 58, 16, 18, 33 and 40 subtypes are used as templates respectively by the established dual-index detection method, and the established cas13 and cas14 dual-index detection methods are used for detection, repeating 3 times, and observing the experimental results (see Figure 8 ). After testing, by using other nucleic acid samples similar to the target nucleic acid sequence for testing, the specificity of the detection method is ensured, and the experimental results show strong specificity.

[0157] In order to test the sensitivity, specificity and accuracy of the dual-index test for clinical samples, according to the existing PCR test results of clinical samples, 15 cases of single confirmed HPV52, 15 single HPV58, and 5 cases of dual infection patients are used as the positive group, and 35 healthy subjects in the same period are selected as the control group. By comparing the detection results of the real-time fluorescence quantitative PCR method and the dual-index method, the precision and accuracy of the dual-index method are investigated. The statistical results of the detection results of the dual-index detection method provided in this embodiment are shown in Table 8.

[0158] Table 8 Statistical results of the detection results of the dual-index detection method

[0159]

[0160] Sensitivity = number of true positives / (number of true positives + number of false negatives) × 100%. The proportion of positive results detected in patients (i.e., the missed diagnosis rate); Specificity = number of true negatives / (number of true negatives + number of false positives) × 100%. The proportion of negative results detected in non-patients (i.e., the misdiagnosis rate); Accuracy = (number of true positives + number of true negatives) / (number of true positives + number of true negatives) × 100%. It refers to the degree of consistency between the test result and the true value.

[0161] Combined with Table 8 and the above calculation formula, for the dual-index detection method provided in this embodiment, the sensitivity is 94.3% (33 / 35, where 33 refers to 4 cases of single HPV52 infection, 13 cases of single HPV58 infection, and 6 cases of dual HPV52 and 58 infections, and 35 is the number of cases in the case group); the specificity is 94.6% (35 / 37, where 35 are healthy subjects and 37 is the number of negative test results); the accuracy is 95.7% (67 / 70, 67 = 14 correct HPV52 positive results + 13 correct HPV52 positive results + 5 correct dual-index positive results + 35 healthy subjects; 70 is the total number of subjects).

[0162] The present invention ingeniously combines LAMP, CRISPR / Cas technology, and chromatographic strip technology. Although LAMP has the advantage of isothermal rapid amplification, it is prone to false positive problems; while CRISPR / Cas technology uses a reporter to detect specific targets, which can eliminate the limitations of LAMP, reduce the possibility of false positive results, and achieve highly sensitive and specific detection. In addition, CRISPR / Cas technology combines with fluorescent chromatographic strips or directly judges the test results with the naked eye, without the need for quantitative measurement like other nucleic acid detections, realizing POC detection that is efficient, sensitive, specific, and does not require complex equipment.

[0163] The present invention also realizes the dual-target detection of CRISPR nucleic acids. In the same system of the present invention, Cas13 and Cas14 enzymes are simultaneously used to cleave the probes (Report52, Reprot58) respectively. Among them, the RNA signal Report52 probe (cleaved by Cas13) corresponds to the Cas13 enzyme, and the ssDNA signal Report58 probe (cleaved by Cas14) corresponds to the Cas14 enzyme. The probes are modified as follows: the Report52 probe is an RNA with biotin (Biotin) modified at one end and fluorescein isothiocyanate (FITC) modified at the other end; the Report58 probe is an ssDNA with biotin (Biotin) modified at one end and digoxin (Dig) modified at the other end. When the test sample contains HPV52 / HPV58 gene fragments (one or two), the trans-cleavage of the Cas13 or Cas14 enzyme can be correspondingly activated, thereby cleaving the free probes (Report52 or Reprot58) in the reaction system. Subsequently, combined with the chromatographic test strip, it can be detected whether the sample contains two cleaved probes by the lateral test strip. The cleaved probes will present a "test line" of a predetermined color (red) on the test strip, and finally realize the dual-target nucleic acid detection of HPV52 and 58 by CRISPR. This provides a new option for the simultaneous detection of multiple HPV subtypes.

[0164] The above embodiments are only used to explain the technical solutions of the present invention rather than to limit them. Although the above embodiments have specifically described the present invention, those skilled in the art should understand that the specific implementation manners of the present invention can still be modified or equivalently replaced. Any modification and equivalent replacement without departing from the spirit and scope of the present invention shall be covered by the scope of the claims of the present invention.

Claims

1. A method for detecting human papillomavirus, characterized in that: It includes the following steps: S1. Amplify the target sequence in the nucleic acid sample to be tested by the loop-mediated isothermal amplification method to obtain a LAMP amplification product; S2. Configure a reaction system to perform a CRISPR reaction to obtain a reaction product. The reaction system includes a Cas protein, an sgRNA, a reporter probe, and the LAMP amplification product obtained in step S1 and / or a transcription product obtained by in vitro transcription of the LAMP amplification product; S3. Add the reaction product to the sample pad of the chromatographic test strip for detection and read the color development result.

2. The method for detecting human papillomavirus according to claim 1, wherein: The Cas protein is Cas13 protein and / or Cas14 protein.

3. The method for detecting human papillomavirus according to claim 1, characterized in that: In step S1, the primers for loop-mediated isothermal amplification include two outer primers F3 and B3, two inner primers FIP and BIP, and two loop primers LF and LB.

4. The method for detecting human papillomavirus according to claim 1, wherein: The time for amplifying the target sequence in the nucleic acid sample to be tested by the loop-mediated isothermal amplification method is less than 20 min.

5. The method for detecting human papillomavirus according to claim 1, characterized in that: When the detection target is the HPV58 virus, the nucleotide sequence of the sgRNA in the step is as shown in SEQ ID NO.

7.

6. The method for detecting human papillomavirus according to claim 1, characterized in that: The detection method is used for multiplex HPV virus detection. The Cas protein includes Cas13 protein and Cas14 protein. The reporter probe includes an ssRNA reporter probe and an ssDNA reporter probe. The Cas13 protein cleaves the ssRNA and the ssRNA reporter probe, and the Cas14 protein cleaves the ssDNA and the ssDNA reporter probe.

7. The method for detecting human papillomavirus according to claim 1, characterized in that: The method is used for detecting the HPV52 virus. The nucleotide sequence of the reporter probe for the Cas13 to cleave the substrate ssRNA is: 5'-FITC-UUAUU-Biotin, and the nucleotide sequence of the sgRNA-52 is as shown in SEQ ID NO.

14.

8. A kit for detecting human papillomavirus, characterized in that: It includes a sample pad, a conjugate pad, and a cellulose acetate membrane that are sequentially lapped. The sample pad is used to drop or immerse the sample to be tested. The conjugate pad stores a first labeled antibody and / or a second labeled antibody. The NC membrane is provided with a control line and a test line. The test line includes a first test line and / or a second test line. The control line is coated with streptavidin, and the test line is coated with a species-specific antibody.

9. The kit for detecting human papillomavirus according to claim 8, characterized in that: The kit contains LAMP Primer Mix, ssDNA reporter probe and / or ssRNA reporter probe, and one end of the reporter probe is modified with biotin.

10. The kit for detecting human papillomavirus according to claim 9, wherein: It also contains a transcription buffer, a ribonucleotide mixture, and T7 RNA polymerase.