Device and method for concentrating biomolecules

By using high ionic strength draw solution and transmembrane pressure control methods during the TFF process, the problem of insufficient oligonucleotide concentration in the prior art was solved, and efficient and economical oligonucleotide concentration was achieved, and a concentration of ≥100 mg/mL was achieved.

CN120265372APending Publication Date: 2025-07-04ELI LILLY & CO
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202380081803.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2022-10-14
Filing Date
2023-10-13
Publication Date
2025-07-04

AI Technical Summary

Technical Problem

Existing methods for concentrating oligonucleotides cannot reliably increase the concentration of oligonucleotides in the solution to greater than 100 mg/mL, especially because factors such as increased viscosity and osmotic pressure of the retentate solution lead to membrane fouling limit the high concentration capability of tangential flow filtration (TFF).

Method used

Using a device and method, including using a membrane with <5 kDa retention molecular weight (MWCO), the efficient concentration of oligonucleotides is achieved by circulating the solution separately on the retentate and permeate side and using a draw solution with high ionic strength, combined with transmembrane pressure (TMP) control.

Benefits of technology

A high concentration of oligonucleotide concentration of ≥100 mg/mL in a low volume solution is achieved, which simplifies the device setup and reduces technical and economic costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120265372A_ABST
    Figure CN120265372A_ABST
Patent Text Reader

Abstract

There is described a device for concentrating biomolecules in a solution, such as an oligonucleotide-containing solution, via tangential flow filtration (TFF), wherein the device can concentrate oligonucleotides to a concentration gt; and 100 mg / mL. Also described are methods of concentrating a biomolecule-containing solution, such as an oligonucleotide-containing solution, via a TFF for high dose / low volume applications.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Reference to the Sequence Listing Submitted Electronically

[0002] This disclosure is submitted together with a Sequence Listing in ST.26 XML format. The Sequence Listing is provided as a file named "30194_US_PRI", which was created on October 5, 2022 and is 28 kilobytes (kb) in size. The Sequence Listing information in ST.26 XML format is incorporated herein by reference in its entirety. Technical Field

[0003] This disclosure relates to chemistry and engineering, and more particularly, it relates to devices and methods for concentrating biomolecules in solution, such as single-stranded (ss) or double-stranded (ds) oligonucleotides, for use as drug substance (DS) in the manufacture of drug products (DP).

[0004] Background

[0005] Therapeutic oligonucleotides are a relatively new modality for treating and preventing diseases and disorders. The synthesis of therapeutic oligonucleotides may involve many upstream and downstream steps, such as synthesis, cleavage and deprotection, purification, and concentration. Particular attention is paid herein to the concentration of therapeutic oligonucleotides in solution, which is required as DS in the manufacture of DP or other pharmaceutical compositions.

[0006] A variety of methods for concentrating oligonucleotides in solution are known, such as chromatography, dialysis, evaporation, precipitation, and ultrafiltration / diafiltration (UF / DF). Currently, these methods for concentrating oligonucleotides cannot reliably achieve a final oligonucleotide concentration in solution greater than about 100 mg / mL. Regarding UF / DF, particularly the form known as tangential flow filtration (TFF), several factors limit its ability to reach high final concentrations, such as the increasing viscosity / osmotic pressure of the retentate solution as the oligonucleotide concentration increases, and membrane fouling as the oligonucleotide concentration increases. However, highly concentrated oligonucleotides are needed to formulate and administer to individuals in need in the smallest possible solution volume.

[0007] Accordingly, there is a need for devices and methods for concentrating solutions containing biomolecules, such as solutions containing oligonucleotides, to a concentration >100 mg / mL.

[0008] Brief Summary

[0009] To meet this need, this disclosure first describes a device for concentrating biomolecules in solution, such as oligonucleotides, for high-dose / low-volume administration. The device includes:

[0010] i. A first reservoir in fluid communication with the first side of the membrane, wherein the first reservoir is a retentate feed, and wherein the membrane has a molecular weight cut-off (MWCO) of < about 5 kDa;

[0011] ii. A second reservoir in fluid communication with the second opposite side of the membrane, wherein the second reservoir is a draw solution feed and a permeate collector;

[0012] iii. A first feed pump for circulating the retentate across the first side of the membrane;

[0013] iv. A second feed pump for circulating the draw solution or draw solution / permeate mixture across the second opposite side of the membrane;

[0014] v. A first balance with a stirring plate, wherein the first balance with the stirring plate is used to stir the retentate in the first reservoir and measure the retentate;

[0015] vi. A second balance with a stirring plate, wherein the second balance with the stirring plate is used to stir the draw solution / permeate mixture in the second reservoir and measure the draw solution / permeate mixture; and

[0016] vii. A transmembrane pressure (TMP) controller.

[0017] In some cases, the MWCO is at least about 1 kDa. In other cases, the MWCO is at least about 2 kDa.

[0018] In some cases, the membrane further includes a surface area of at least about 0.02 m 2 to about 0.1 m 2 of surface area.

[0019] In some cases, the membrane is a polyethersulfone (PES) membrane or a regenerated cellulose membrane.

[0020] Additionally, the present disclosure describes a method for concentrating a solution containing oligonucleotides, which at least includes the following steps:

[0021] a. Circulating a first solution across the first side of the membrane, wherein the first solution is a retentate having an initial oligonucleotide concentration of < about 95 mg / mL and a pH of about 6 to about 7, and wherein the membrane has a MWCO of < about 5 kDa;

[0022] b. Circulating a second solution across the second opposite side of the membrane, wherein the second solution is a permeate having a pH of about 6 to about 8 and an ionic strength greater than that of the first solution;

[0023] c. Maintaining the TMP across the membrane at about 30 psi to about 45 psi; and

[0024] d. Maintain the circulation of the retentate and permeate through the first and second opposite membrane sides, respectively, until the first solution has a final oligonucleotide concentration of at least about 100 mg / mL.

[0025] In some cases, the starting oligonucleotide concentration is at least about 20 mg / mL.

[0026] In some cases, the first solution is water.

[0027] In some cases, the MWCO is at least about 1 kDa. In other cases, the MWCO is at least about 2 kDa.

[0028] In some cases, the membrane further includes a surface area of at least about 0.02 m 2 to about 0.1 m 2 of surface area.

[0029] In some cases, the membrane is a PES membrane or a regenerated cellulose membrane.

[0030] In some cases, the ionic strength of the second solution is from about 0.01 mol / L to about 2 mol / L.

[0031] In some cases, the second solution includes a NaCl concentration of from about 0.01 M to about 2 M.

[0032] In some cases, the second solution contains a MgCl2 concentration of from about 0.03 M to about 2.0 M.

[0033] In some cases, the second solution contains a dextran sulfate concentration of from about 100 mg / mL to about 200 mg / mL.

[0034] In some cases, the ionic strength of the second solution is increased during the circulation. In other cases, the ionic strength of the second solution is maintained during the circulation.

[0035] In some cases, the final oligonucleotide concentration is from about 150 mg / mL to about 200 mg / mL. In other cases, the final oligonucleotide concentration is from about 200 mg / mL to about 250 mg / mL. In still other cases, the final oligonucleotide concentration is from about 250 mg / mL to about 300 mg / mL.

[0036] In some cases, the final oligonucleotide concentration is from about 150 mg / mL to about 300 mg / mL.

[0037] In addition, the present disclosure describes a composition comprising an oligonucleotide, such as a therapeutic oligonucleotide, having a concentration >100 mg / mL. In some cases, the composition is a solution. In other cases, the composition is a lyophilized powder.

[0038] The advantages of the devices herein are that, compared to conventional TFF setups, they do not require complex setups and are thus technically and economically viable.

[0039] The advantages of the methods herein are that, compared to the concentrations achievable in conventional TFF setups, they allow a significant increase in the concentration of oligonucleotides in solution. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Advantages, effects, features, and objects other than those set forth above will become more apparent when considering the following detailed description. Such detailed description refers to the following drawings, in which:

[0042] Figure 1 a through 1d show devices for concentrating ds therapeutic oligonucleotides, where the blue dashed lines indicate the oligonucleotide (e.g., siRNA) solution / permeate flow path ( Figure 1 a and 1c), and where the green dashed lines indicate the draw solution / permeate flow path ( Figure 1 b and 1d). Figure 1 a and 1c depict a typical TFF flow path for the concentrated retentate when the retentate is recycled through the retentate side of the membrane; and Figure 1 b and 1d depict an exemplary TFF flow path with an additional pathway for the permeate to be recycled through the permeate side of the membrane.

[0043] Figure 2 Shows the retentate weigh and permeate flux over time after a typical TFF. In Figure 2 the retentate weigh and permeate flux decreased over time during the concentration experiment. After 30 minutes, the TMP increased from 40 psi to 42 psi. The final concentration of the retentate was 101 mg / mL.

[0044] Figure 3 Shows the retentate weigh over time after TFF using draw solutions with different NaCl concentrations. In Figure 3 the run was ended when the retentate weigh remained constant for 30 minutes or when the minimum reservoir volume (for the 500 mM draw solution sample) was reached. The data was adjusted to start at the same weight at time 0 to account for slight variations in the delay time between the start of data collection and the start of the run for each experiment.

[0045] Figure 4 Shows the permeate flux data collected over time during the TFF process for the first hour (the exponential decay curve is fitted to the data starting from the initial highest permeate flux value).

[0046] Figure 5Shows the retentate scale weights collected over time during the TFF process. In Figure 5 the run is ended when the retentate scale weight remains constant for 30 minutes or when the minimum reservoir volume is reached (for the 167 mM MgCl2 draw solution sample). The data is adjusted to start at the same weight at time 0 to account for the slight variation in the delay time between the start of data collection and the start of the run for each experiment.

[0047] Figure 6 Shows the retentate scale weights collected over time during the TFF process. In Figure 6 the run is ended when the retentate scale weight remains constant for 30 minutes. The data is adjusted to start at the same weight at time 0 to account for the slight variation in the delay time between the start of data collection and the start of the run for each experiment.

[0048] Details

[0049] Overview

[0050] Therapeutic oligonucleotides, especially those based on activating RNA (aRNA), editing RNA (eRNA), and inhibitory RNA (iRNA), are an emerging class of biomolecules. Current devices and methods for concentrating therapeutic oligonucleotides, especially ds oligonucleotides, via TFF are hindered by the inherent properties of oligonucleotides such as flow-induced elongation, which requires the use of membranes with small MWCO and also reduces flux. Additionally, oligonucleotides are highly negatively charged, which rapidly increases the osmotic pressure upon concentration. Furthermore, the increased osmotic pressure offsets the TMP, further slowing down the flux.

[0051] As shown herein, these drawbacks can be addressed by incorporating a forward osmosis process with an osmolyte (i.e., draw solution) having a high ionic strength. The devices and methods herein provide high concentrations of therapeutic oligonucleotides (i.e., ≥100 mg / mL) in low volume solutions (i.e., ≤2 mL).

[0052] Abbreviations and Definitions

[0053] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the methods herein.

[0054] Furthermore, the mention of an element by the indefinite article "a" or "an" does not exclude the possibility of the presence of more than one element, unless the context clearly requires the presence of one and only one element. Thus, the indefinite article "a" or "an" generally means "at least one".

[0055] In addition, the use of "including" and other forms such as "including but not limited to", "include", "includes", and "included" is not restrictive.

[0056] Certain abbreviations used herein are as follows:

[0057] "ADAR" refers to adenosine deaminase acting on RNA; "API" refers to active pharmaceutical ingredient; "aRNA" refers to activated RNA; "ASO" refers to antisense oligonucleotide; "DNA" refers to deoxyribonucleic acid; "DP" refers to drug product; "ds" refers to double-stranded; "DS" refers to drug substance; "DsiRNA" refers to Dicer-substrate interfering RNA; "eRNA" refers to editing RNA; "H2O" refers to water; "hr" refers to hour; "iRNA" refers to inhibitory RNA; "kDa" refers to kilodalton; "L" refers to liter; "mg" refers to milligram; "MgCl2" refers to magnesium chloride; "MgSO4" refers to magnesium sulfate; "min" refers to minute; "mol" refers to mole; "mRNA" refers to messenger RNA; "miRNA" refers to microRNA; "mL" refers to milliliter; "MW" refers to molecular weight; "MWCO" refers to molecular weight cut-off; "Na3C6H5O7" refers to sodium citrate; "NaCl" refers to sodium chloride; "Na2SO4" refers to sodium sulfate; "PES" refers to polyethersulfone; "psi" refers to pounds per square inch; "RISC" refers to RNA-induced silencing complex; "RITA" refers to RNA-induced transcriptional activation; "RNA" refers to ribonucleic acid; "rRNA" refers to ribosomal RNA; "shRNA" refers to short hairpin RNA; "siRNA" refers to small interfering RNA; "SPS" refers to solid-phase synthesis; "ss" refers to single-stranded; "TFF" refers to tangential flow filtration; "TMP" refers to transmembrane pressure; "tRNA" refers to transfer RNA; and "UV" refers to ultraviolet light.

[0058] Certain definitions used herein are defined as follows:

[0059] As used herein, "about" means within a statistically significant range of one or more values, such as the stated area, concentration, length, molecular weight, pH, sequence similarity, time range, temperature, volume, etc. Such values or ranges may be within an order of magnitude that is typically within 20% of a given value or range, more typically within 10%, and even more typically within 5%. The allowable deviation covered by "about" will depend on the particular system under study and can be readily appreciated by those skilled in the art.

[0060] As used herein, "activated RNA" or "aRNA" means a nucleic acid that contains RNA and mediates the targeted activation of promoters of RNA transcripts or other non-coding transcripts via the RNA-induced transcriptional activation (RITA) complex pathway. aRNA is typically ds. aRNA activates, increases, regulates, or upregulates the expression of target nucleotide sequences in cells.

[0061] As used herein, "biomolecule" and the like mean a molecule or compound that includes or incorporates amino acids, carbohydrates, lipids, and / or nucleotides. Examples of biomolecules of interest herein include, but are not limited to, nucleic acids (e.g., oligonucleotides and polynucleotides), peptides, polypeptides, and proteins.

[0062] As used herein, "deoxyribonucleotide" means a nucleotide that has a hydrogen in place of a hydroxyl group at the 2'-position of its pentose sugar when compared to a ribonucleotide. Modified deoxyribonucleotides have one or more modifications or substitutions of atoms other than a hydroxyl group at the 2'-position, including modifications or substitutions of the nucleobase, sugar, or phosphate group.

[0063] As used herein, "draw solution" means a solution that is circulated on the permeate side of a membrane for the purpose of creating an osmotic pressure / ionic strength difference across the membrane to facilitate or "draw" further permeation of water.

[0064] As used herein, "drug product" or "DP" means a finished product of any therapeutic agent, such as a therapeutic oligonucleotide, that is available on the market and is typically (but not necessarily) used in combination with one or more other pharmaceutically acceptable ingredients.

[0065] As used herein, "drug substance" or "DS" means the active ingredient (e.g., a therapeutic oligonucleotide) that is intended to diagnose, cure, mitigate, treat, and / or prevent disease or to provide pharmacological activity or other direct effect in the diagnosis, cure, mitigation, treatment, and / or prevention of disease or to affect the structure or any function of the body, but does not include intermediates used in the synthesis of such ingredients. DS is also referred to as the active pharmaceutical ingredient (API). DS is used to prepare DP.

[0066] As used herein, "edited RNA" or "eRNA" means a nucleic acid that contains RNA and mediates nucleotide insertions, deletions, and even base substitutions within a target nucleotide sequence. RNA editing has been observed in many different types of RNA, such as messenger RNA (mRNA), microRNA (miRNA), transfer RNA (tRNA), and ribosomal RNA (rRNA). RNA editing is enzymatically mediated by exogenously providing adenosine deaminase acting on RNA (ADAR) or by directing endogenous ADAR to a specific site within the target RNA nucleotide sequence, typically involving editing at a single nucleotide site by directing ADAR to the site via a complementary oligonucleotide. eRNA is typically ss.

[0067] As used herein, "inhibitory RNA" or "iRNA" means a nucleic acid that contains RNA and mediates the targeted cleavage of an RNA transcript via RNA interference, such as through the RNA-induced silencing complex (RISC) pathway. Some iRNAs are single-stranded (ss), while other iRNAs are ds and have a sense strand and an antisense strand, where the sense strand and the antisense strand form a duplex. iRNA directs the sequence-specific degradation of mRNA via RNA interference. iRNA attenuates, inhibits, regulates, or reduces the expression of a target nucleotide sequence in a cell. Examples of iRNA include, but are not limited to, antisense oligonucleotides (ASO), Dicer-substrate interfering RNA (DsiRNA), miRNA, short hairpin RNA (shRNA), or small interfering RNA (siRNA).

[0068] As used herein, "nucleotide" means an organic compound having a nucleoside (a nucleobase, such as adenine, cytosine, guanine, thymine, or uracil; and a pentose, such as ribose or 2'-deoxyribose) and a phosphate group. Nucleotides can serve as monomeric units of nucleic acid polymers such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).

[0069] As used herein, "oligonucleotide" means a short nucleic acid compound (e.g., a polymer having a length of less than about 100 nucleotides) and can include deoxyribonucleotides (or modified deoxyribonucleotides), ribonucleotides (or modified ribonucleotides), or both. Similarly, an oligonucleotide can be ss or ds and thus may or may not have a duplex region.

[0070] As used herein, "synthetic" refers to a nucleic acid or other compound that is artificially synthesized (e.g., using a machine such as a solid-phase nucleic acid synthesizer) or otherwise not derived from a natural source (e.g., a cell or an organism) that normally produces nucleic acids or other compounds.

[0071] As used herein, "ribonucleotide" means a nucleotide having ribose as its pentose sugar and having a hydroxyl group at its 2'-position. A modified ribonucleotide is a ribonucleotide having one or more modifications or substitutions of atoms other than hydrogen at the 2'-position, including modifications or substitutions in the nucleobase, sugar, or phosphate group or thereof.

[0072] As used herein, "therapeutic oligonucleotide" means a ss or ds nucleic acid having a therapeutic application (i.e., an application in treating a disease). Such nucleic acids typically contain one or more modified nucleotide residues or linkages and may also include targeting ligands and / or delivery vehicles. Examples of therapeutic oligonucleotides include, but are not limited to, aRNA, eRNA, and iRNA. Specific examples of therapeutic oligonucleotides include, but are not limited to, ASO, aptamers, short activating RNAs (saRNAs), siRNAs, miRNAs, and decoys.

[0073] Device

[0074] A typical TFF setup is shown in Figure 1 a. The solution to be concentrated, such as a solution containing an oligonucleotide, such as a solution containing a ds oligonucleotide, is loaded into the reservoir (1) and pumped through the flow path shown in blue via the feed pump (3). The solution enters the cassette (6) through the retentate inlet port (4), flows across or tangentially to the semipermeable membrane of the cassette (6), and then exits through the permeate outlet port (7) to continue back to the reservoir (1). The semipermeable membrane of the cassette (6) has a MWCO less than that of the molecule to be concentrated (e.g., an oligonucleotide such as a ds therapeutic oligonucleotide), such that only the solvent passes through and is collected in a separate permeate container (10). The molecule to be concentrated is retained in the retentate and is concentrated in the retentate reservoir (1) as the solvent passes through the membrane. As the retentate is concentrated, the weight recorded on the retentate scale (2) decreases, while the weight of the permeate scale (9) increases. The permeation is facilitated and driven across the semipermeable membrane of the cassette (6) by the TMP controller. The TMP is defined as the average applied pressure from the retentate to the permeate side of the membrane and varies with the TMP controller (8), which presses on the pipe to apply pressure.

[0075] An exemplary TFF setup of the present disclosure including a flow path for the draw solution is shown in Figure 1 b and 1d, the setup being based on Figure 1Constructed with the settings in a and 1c. Here, a solution containing ss or ds oligonucleotides is loaded into the reservoir (1) and circulated at a constant feed flow rate along the retentate flow path (blue). A controlled TMP is applied across the membrane to drive H2O to leave through the permeate outlet valve (12) and enter a separate permeate container (10). As H2O permeates the membrane, the weight of the retentate scale (2) decreases while the weight of the permeate scale (9) increases. Contrasted with the TFF setup shown in Figure 1 a, a draw solution of high ionic strength is added to the permeate container (10) to facilitate continuous H2O permeation and is circulated at a constant flow rate via the permeate side of the membrane into the inlet (5) through the draw solution pump (11), leaves the membrane support via the permeate outlet valve (12) and returns to the permeate collection container, thereby driving the ds oligonucleotide concentration to a higher level than in the case of not using a high ionic strength draw solution.

[0076] Method

[0077] The method may include the steps described herein, and these steps may (but not necessarily) be carried out in the order described. However, other orders are also conceivable. In addition, each or multiple steps may be parallel and / or temporally overlapping and / or individually or in multiple repeated steps. In addition, the method may include additional, unspecified steps.

[0078] In addition, oligonucleotides can be prepared by any method known in the art, such as solid-phase synthesis (SPS) of individual strands, which may then optionally undergo additional steps for purification, solvent exchange, desalting, and concentration before and / or after annealing into duplexes in H2O for ds oligonucleotides.

[0079] Briefly, a method for concentrating a solution containing oligonucleotides may include the step of circulating a first solution through a first side of a membrane, wherein the first solution is a retentate having an initial oligonucleotide concentration of ≤95 mg / mL and a pH of about 6 to about 7, and wherein the membrane has a surface area of about 0.02 m 2 to about 0.1 m 2 and / or an MWCO of <5 kDa.

[0080] In some cases, the oligonucleotide is an ss oligonucleotide. In other cases, the oligonucleotide is a ds oligonucleotide.

[0081] In some cases, the starting oligonucleotide concentration of the first solution is < about 95 mg / mL. In other cases, the starting oligonucleotide concentration is from about 5 mg / mL to about 95 mg / mL, from about 10 mg / mL to about 90 mg / mL, from about 15 mg / mL to about 85 mg / mL, from about 20 mg / mL to about 80 mg / mL, from about 25 mg / mL to about 75 mg / mL, from about 30 mg / mL to about 70 mg / mL, from about 35 mg / mL to about 65 mg / mL, from about 40 mg / mL to about 60 mg / mL, from about 45 mg / mL to about 55 mg / mL, or about 50 mg / mL. In still other cases, the starting oligonucleotide concentration is about 5 mg / mL, about 10 mg / mL, about 15 mg / mL, about 20 mg / mL, about 25 mg / mL, about 30 mg / mL, about 35 mg / mL, about 40 mg / mL, about 45 mg / mL, about 50 mg / mL, about 55 mg / mL, about 60 mg / mL, about 65 mg / mL, about 70 mg / mL, about 75 mg / mL, about 80 mg / mL, about 85 mg / mL, about 90 mg / mL, or even about 95 mg / mL. In yet other cases, the starting oligonucleotide concentration is > about 95 mg / mL.

[0082] In some cases, the pH of the first solution is about 6.0, about 6.1, about 6.2, about 6.3, about 6.4, about 6.5, about 6.6, about 6.7, about 6.8, about 6.9, or about 7.0.

[0083] In some cases, the first solution is H2O.

[0084] In some cases, the MWCO of the membrane is > about 1 kDa. In other cases, the MWCO is from about 1 kDa to about 5 kDa, from about 2 kDa to about 4 kDa, or about 3 kDa. In still other cases, the MWCO is about 1 kDa, about 1.5 kDa, about 2 kDa, about 2.5 kDa, about 3 kDa, about 3.5 kDa, about 4 kDa, about 4.5 kDa, or about 5 kDa. In some cases, the MWCO is about 2 kDa. In certain other cases, the MWCO is < 3 kDa.

[0085] In some cases, the membrane is a PES membrane or a regenerated cellulose membrane.

[0086] Additionally, the method can include the step of circulating a second solution through the second opposite side of the membrane, wherein the second solution is a draw solution having an ionic strength greater than that of the first solution and a pH of about 6 to about 8. It should be noted that as the draw solution circulates through, it becomes a draw solution / permeate mixture as H2O is drawn from the first solution.

[0087] In some cases, the pH of the second solution is about 6.0, about 6.1, about 6.2, about 6.3, about 6.4, about 6.5, about 6.6, about 6.7, about 6.8, about 6.9, about 7.0, about 7.1, about 7.2, about 7.3, about 7.4, about 7.5, about 7.6, about 7.7, about 7.8, about 7.9 or about 8.0. In other cases, the pH of the second solution is the same as the pH of the first solution. In still other cases, the pH of the second solution is different from the pH of the first solution.

[0088] In some cases, the ionic strength of the second solution is > about 0.01 mol / L. In other cases, the ionic strength is from about 0.01 mol / L to about 2 mol / L. In still other cases, the ionic strength of the second solution is from about 0.05 mol / L to about 1.95 mol / L, from about 0.1 mol / L to about 1.9 mol / L, from about 0.15 mol / L to about 1.85 mol / L, from about 0.2 mol / L to about 1.80 mol / L, from about 0.25 mol / L to about 1.75 mol / L, from about 0.3 mol / L to about 1.7 mol / L, from about 0.35 mol / L to about 1.65 mol / L, from about 0.4 mol / L to about 1.6 mol / L, from about 0.45 mol / L to about 1.55 mol / L, from about 0.5 mol / L to about 1.5 mol / L, from about 0.55 mol / L to about 1.45 mol / L, from about 0.6 mol / L to about 1.4 mol / L, from about 0.65 mol / L to about 1.35 mol / L, from about 0.7 mol / L to about 1.3 mol / L, from about 0.75 mol / L to about 1.25 mol / L, from about 0.8 mol / L to about 1.2 mol / L, from about 0.85 mol / L to about 1.15 mol / L, from about 0.9 mol / L to about 1.1 mol / L, from about 0.95 mol / L to about 1.05 mol / L, or about 1.0 mol / L. Optionally, the ionic strength is about 0.01 mol / L, about 0.05 mol / L, about 0.1 mol / L, about 0.15 mol / L, about 0.2 mol / L, about 0.25, about 0.3 mol / L, about 0.35 mol / L, about 0.4 mol / L, about 0.45 mol / L, about 0.5 mol / L, about 0.55 mol / L, about 0.6 mol / L, about 0.65 mol / L, about 0.7 mol / L, about 0.75 mol / L, about 0.8 mol / L, about 0.85 mol / L, about 0.9 mol / L, about 0.95 mol / L, about 1.0 mol / L, about 1.1 mol / L, about 1.15 mol / L, about 1.2 mol / L, about 1.25 mol / L, about 1.3 mol / L, about 1.35 mol / L, about 1.4 mol / L, about 1.45 mol / L, about 1.5 mol / L, about 1.55 mol / L, about 1.6 mol / L, about 1.65 mol / L, about 1.7 mol / L, about 1.75 mol / L, about 1.8 mol / L, about 1.85 mol / L, about 1.9 mol / L, about 1.95 mol / L or about 2.0 mol / L.

[0089] In some cases, the second solution contains NaCl at a concentration of from about 0.01 M to about 2 M NaCl. In other cases, the NaCl concentration is from about 0.05 M to about 1.95 M, from about 0.1 M to about 1.90 M, from about 0.15 M to about 1.85 M, from about 0.2 M to about 1.8 M, from about 0.25 M to about 1.75 M, from about 0.3 M to about 1.7 M, from about 0.35 M to about 1.65 M, from about 0.4 M to about 1.6 M, from about 0.45 M to about 1.55 M, from about 0.5 M to about 1.5 M, from about 0.55 M to about 1.45 M, from about 0.6 M to about 1.4 M, from about 0.65 M to about 1.35 M, from about 0.7 M to about 1.3 M, from about 0.75 M to about 1.25 M, from about 0.8 M to about 1.2 M, from about 0.85 M to about 1.15 M, from about 0.9 M to about 1.1 M, from about 0.95 M to about 1.05 M, or about 1.0 M. Optionally, the NaCl concentration is about 0.01 M, about 0.15 M, about 0.2 M, about 0.25 M, about 0.3 M, about 0.35 M, about 0.4 M, about 0.45 M, about 0.5 M, about 0.55 M, about 0.6 M, about 0.65 M, about 0.7 M, about 0.75 M, about 0.8 M, about 0.85 M, about 0.9 M, about 0.95 M, about 1.0 M, about 1.05 M, about 1.1 M, about 1.15 M, about 1.2 M, about 1.25 M, about 1.3 M, about 1.35 M, about 1.4 M, about 1.45 M, about 1.5 M, about 1.55 M, about 1.6 M, about 1.65 M, about 1.7 M, about 1.75 M, about 1.8 M, about 1.85 M, about 1.9 M, about 1.95 M or about 2.0 M.

[0090] Additionally, the method can include the steps of maintaining the TMP across the membrane at about 30 psi to about 45 psi, at least until there is no longer any change in the weigh scale or until the minimum volume of the reservoir is reached. In other cases, the TMP can increase over time, where the upper limit is determined by the instrument pressure limit. In some cases, the TMP is about 31 psi to about 44 psi, about 32 psi to about 43 psi, about 33 psi to about 42 psi, about 34 psi to about 41 psi, about 35 psi to about 40 psi, about 36 psi to about 39 psi, or about 37 psi to about 38 psi. In other cases, the TMP is about 30 psi to about 32 psi, about 32 psi to about 34 psi, about 34 psi to about 36 psi, about 36 psi to about 38 psi, about 38 psi to about 40 psi, about 40 psi to about 42 psi, about 42 psi to about 44 psi, about 30 psi to about 35 psi, about 35 psi to about 40 psi, or about 40 psi to about 45 psi. In still other cases, the TMP is about 30 psi, about 31 psi, about 32 psi, about 33 psi, about 34 psi, about 35 psi, about 36 psi, about 37 psi, about 38 psi, about 39 psi, about 40 psi, about 41 psi, about 42 psi, about 43 psi, about 44 psi, or about 45 psi.

[0091] In some cases, the first solution flows across the first side of the membrane at a rate of about 0.1 L / minute to about 1.5 L / minute, about 0.2 L / minute to about 1.4 L / minute, about 0.3 L / minute to about 1.3 L / minute, about 0.4 L / minute to about 1.2 L / minute, about 0.5 L / minute to about 1.1 L / minute, about 0.6 L / minute to about 1.0 L / minute, about 0.7 L / minute to about 0.9 L / minute, or about 0.8 L / minute. In other cases, the rate is about 0.1 L / minute to about 0.25 L / minute, about 0.25 L / minute to about 0.5 L / minute, about 0.5 L / minute to about 0.75 L / minute, about 0.75 L / minute to about 1.0 L / minute, about 1.0 L / minute to about 1.25 L / minute, or about 1.25 L / minute to about 1.5 L / minute. In still other cases, the rate is about 0.1 L / minute, about 0.2 L / minute, about 0.3 L / minute, about 0.4 L / minute, about 0.5 L / minute, about 0.6 L / minute, about 0.7 L / minute, about 0.8 L / minute, about 0.9, about 1.0 L / minute, about 1.1 L / minute, about 1.2 L / minute, about 1.3 L / minute, about 1.4 L / minute, or about 1.5 L / minute.

[0092] In some cases, the second solution flows across the second opposite side of the membrane at a rate of from about 1.0 L / minute to about 15.0 L / minute, from about 1.5 L / minute to about 14.5 L / minute, from about 2.0 L / minute to about 14.0 L / minute, from about 2.5 L / minute to about 13.5 L / minute, from about 3.0 L / minute to about 13.0 L / minute, from about 3.5 L / minute to about 12.5 L / minute, from about 4.0 L / minute to about 12.0 L / minute, from about 4.5 L / minute to about 11.5 L / minute, from about 5.0 L / minute to about 11.0 L / minute, from about 5.5 L / minute to about 10.5 L / minute, from about 6.0 L / minute to about 10.0 L / minute, from about 6.5 L / minute to about 9.5 L / minute, from about 7.0 L / minute to about 9.0 L / minute, from about 7.5 L / minute to about 8.5 L / minute, or about 8.0 L / minute. In other cases, the rate is from about 1.0 L / minute to about 1.5 L / minute, from about 1.5 L / minute to about 2.0 L / minute, from about 2.0 L / minute to about 2.5 L / minute, from about 2.5 L / minute to about 3.0 L / minute, from about 3.0 L / minute to about 3.5 L / minute, from about 3.5 L / minute to about 4.0 L / minute, from about 4.0 L / minute to about 4.5 L / minute, from about 4.5 L / minute to about 5.0 L / minute, from about 5.0 L / minute to about 5.5 L / minute, from about 5.5 L / minute to about 6.0 L / minute, from about 6.0 L / minute to about 6.5 L / minute, from about 6.5 L / minute to about 7.0 L / minute, from about 7.0 L / minute to about 7.5 L / minute, from about 7.5 L / minute to about 8.0 L / minute, from about 8.0 L / minute to about 8.5 L / minute, from about 8.5 L / minute to about 9.0 L / minute, from about 9.0 L / minute to about 9.5 L / minute, from about 9.5 L / minute to about 10.0 L / minute, from about 10.0 L / minute to about 10.5 L / minute, from about 10.5 L / minute to about 11.0 L / minute (about 10.5L / min over 11.0L / min), from about 11.0 L / minute to about 11.5 L / minute, from about 11.5 L / minute to about 12.0 L / minute, from about 12.0 L / minute to about 12.5 L / minute, from about 12.5 L / minute to about 13.0 L / minute, from about 13.0 L / minute to about 13.5 L / minute, from about 13.5 L / minute to about 14.0 L / minute, from about 14.0 L / minute to about 14.5 L / minute, or from about 14.5 L / minute to about 15.0 L / minute.In certain other cases, the rate is about 1.0 L / minute, about 1.5 L / minute, about 2.0 L / minute, about 2.5 L / minute, about 3.0 L / minute, about 3.5 L / minute, about 4.0 L / minute, about 4.5 L / minute, about 5.0 L / minute, about 5.5 L / minute, about 6.0 L / minute, about 6.5 L / minute, about 7.0 L / minute, about 7.5 L / minute, about 8.0 L / minute, about 8.5 L / minute, about 9.0 L / minute, about 9.5 L / minute, about 10.0 L / minute, about 10.5 L / minute, about 11.0 L / minute, about 11.5 L / minute, about 12.0 L / minute, about 12.5 L / minute, about 13.0 L / minute, about 13.5 L / minute, about 14.0 L / minute, about 14.5 L / minute or about 15.0 L / minute.

[0093] In some cases, the ionic strength of the second solution is increased during the cycle. In other cases, the ionic strength of the second solution is increased by about 1% to about 10% compared to its starting ionic strength. In certain cases, the ionic strength of the second solution is increased by about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9% or about 10% compared to its starting ionic strength.

[0094] In addition, the method can include the steps of maintaining the recycle of the retentate and permeate across the first and second opposing membrane sides until the ds oligonucleotide in the first solution is at a final concentration of at least about 100 mg / mL to about 150 mg / mL. In some cases, the final concentration is about 150 mg / mL to about 300 mg / mL, about 160 mg / mL to about 290 mg / mL, about 170 mg / mL to about 280 mg / mL, about 180 mg / mL to about 270 mg / mL, about 190 mg / mL to about 260 mg / mL, about 200 mg / mL to about 250 mg / mL, about 210 mg / mL to about 240 mg / mL, or about 220 mg / mL to about 230 mg / mL. In other cases, the final concentration is about 150 mg / mL, about 160 mg / mL, about 170 mg / mL, about 180 mg / mL, about 190 mg / mL, about 200 mg / mL, about 210 mg / mL, about 220 mg / mL, about 230 mg / mL, about 240 mg / mL, about 250 mg / mL, about 260 mg / mL, about 270 mg / mL, about 280 mg / mL, about 290 mg / mL or about 300 mg / mL. In still other cases, the final concentration is > 300 mg / mL. Examples

[0095] The following non-limiting examples are provided for illustrative rather than limiting purposes.

[0096] Example 1: TFF of a solution containing ds oligonucleotides without a draw solution

[0097] Purpose: To concentrate a solution of ds oligonucleotides to a concentration greater than 100 mg / mL.

[0098] Method:

[0099] TFF concentration (without draw solution): The concentration TFF step was run without a draw solution to concentrate a pooled mixture of several diluted samples of a solution containing ds oligonucleotides. The experimental parameters are listed in Table 1. After about 30 minutes, the TMP was increased from 40 psi to 42 psi to extend the permeate flux as much as possible, and the experiment was ended when the permeate flux was zero at the highest TMP value. Retentate weigh and permeate flux data over time are shown in Figure 2 . The concentration of the final ds oligonucleotide retentate solution was measured to be 101 mg / mL. The oligonucleotide was a sodium salt duplex consisting of a 36-nucleotide sense strand (SEQ ID NO:3) containing a GalNAc sugar at positions 28 - 30 complexed with a 22-nucleotide antisense strand (SEQ ID NO:4).

[0100] Density and concentration measurements: The concentrated samples were filtered through a 0.22 μM filter (Millipore, Burlington, MA; Steriflip 50 mL with a 0.22 μM Durapore PVDF membrane) before density and concentration measurements. Density measurements were recorded at 20 °C using a DMA 4100M Density Meter (Anton Paar, Ashland, Virginia). Density measurements were used to prepare weight dilutions of the siRNA solution for concentration measurements.

[0101] UV assay for oligonucleotide concentration measurement: Using an extinction coefficient of 5.48 x 105 M-1 cm-1, the concentration of a solution containing ds oligonucleotides (e.g., siRNA) was determined at 258 nm using a UV assay. The samples were diluted to approximately 0.02 mg / mL to be within the linear range of the Beer-Lambert law for measurements using a 1 cm path length cuvette. The reported concentration is the average of triplicate dilutions from each sample, and the duplex purity was corrected using water as a reference. The following equation was used to generate the average concentration value, where Ab is the average absorbance value at 258 nm from triplicate measurements, V is the volume of the first dilution, density is the measured density of the concentrated solution, MW is the molecular weight of the free acid form of the molecule (20675 g / mol), DF is the dilution factor of the second dilution, W is the sample weight of the concentrated sample, MEC is the molar extinction coefficient (548000 M -1cm -1 ) The path length is 1 cm, and the purity is determined by non-denaturing UHPLC (98.7%).

[0102]

[0103] Table 1: TFF parameters for TFF without draw solution

[0104]

[0105] Results: Without draw solution, the retentate weight and permeate flux decreased over time ( Figure 2 ). After 30 minutes, the TMP increased from 40 psi to 42 psi. The ds oligonucleotide concentration in the final retentate was 101 mg / mL.

[0106] Example 2: TFF of a solution containing ds oligonucleotide with draw solution

[0107] Objective: To increase the final concentration of a solution containing ds oligonucleotide relative to typical TFF.

[0108] Method:

[0109] TFF concentration (with draw solution): The same general procedure as described above is followed here, but with specific parameters varied as indicated for each example. Before use, the system and membrane are rinsed and equilibrated with H2O, and then a solution containing ds oligonucleotide is loaded into the retentate reservoir. As in Example 1, the oligonucleotide is a sodium salt duplex composed of a 36-nucleotide sense strand (SEQ ID NO:3) complexed with a 22-nucleotide antisense strand (SEQ ID NO:4) and containing GalNAc sugar at positions 28 - 30.

[0110] In addition, draw solution is added to the permeate collection reservoir. A tube is connected from the draw solution to the permeate inlet valve on the cassette holder and fed through a peristaltic pump. The draw solution flushes through the permeate side of the line and membrane, and the permeate balance is tared. The concentration experiment is run at the specified TMP and flow rate until a minimum volume is reached in the retentate reservoir or until no measurable permeate flow persists for 30 minutes. Unless otherwise stated, the draw solution is circulated at a flow rate of 10 mL / minute from the start of the experiment. The main retentate is collected, followed by a wash with H2O. The system is sterilized and stored in NaOH solution.

[0111] Here, in contrast to using only H2O as the draw solution, three different concentrations of NaCl draw solutions were used to concentrate a solution containing ds oligonucleotides via TFF. The concentrations of the NaCl solutions were 0, 10, 100, and 500 mM (with ionic strengths of 0, 0.01, 0.1, and 0.5 mol / L, respectively). Except for the draw solution concentration, all other experimental parameters were kept constant according to Table 2 and the same general TFF protocol as described above was followed. For the 0, 10, and 100 mM samples, the run was stopped when the retentate weight remained constant for 30 minutes. For the 500 mM sample, the run was stopped when the minimum reservoir volume was reached or when the retentate weight remained constant for 30 minutes.

[0112] Table 2: TFF parameters for TFF using draw solutions.

[0113]

[0114] Results: As shown in Table 3 below, the effect of changing the draw solution was highlighted by an increase in the final ds oligonucleotide concentration with increasing draw solution concentration and ionic strength. This trend was associated with a more rapid decrease in the retentate weight obtained from the bulk solution during the TFF process ( Figure 3 ), resulting in an increase in the amount of H2O removed from the solution containing ds oligonucleotides. The final ds oligonucleotide concentrations produced by the 100 mM and 500 mM draw solutions were greater than those achieved in Example 1 without using a draw solution.

[0115] Table 3: Effects of the concentrations and ionic strengths of various NaCl draw solutions.

[0116]

[0117]

[0118] Example 3: TFF of a solution containing ds oligonucleotides using alternative draw solutions

[0119] Objective: To evaluate the effect of changing the draw solution concentration and ionic strength on the final concentration of a solution containing ds oligonucleotides during TFF.

[0120] Method:

[0121] TFF Concentration (using draw solution): A 2 M (2000 mM, with an ionic strength of 2 mol / L) NaCl draw solution was used to concentrate a solution containing ds oligonucleotides via TFF, using the parameters listed in Table 4. As in Examples 1 and 2, the ds oligonucleotide was a sodium salt duplex composed of a 36-nucleotide sense strand (SEQ ID NO: 3) containing GalNAc sugar at positions 28 - 30 and complexed with a 22-nucleotide antisense strand (SEQ ID NO: 4).

[0122] Table 4: TFF parameters for TFF using draw solution.

[0123]

[0124] Results: The concentration of ds oligonucleotide in the final retentate solution was measured to be 308 mg / mL. While the results in Example 2 showed that draw solution concentration and ionic strength led to an increase in the final concentration of ds oligonucleotide, this example shows that even higher concentrations were achieved by using a higher starting amount of material, a higher concentration and ionic strength of the NaCl draw solution, and a higher TMP.

[0125] Example 4: TFF of a solution containing ds oligonucleotides using an alternative draw solution and alternative draw solution pump start

[0126] Purpose: To evaluate the effect of changing the conditions of TFF to determine the effect on concentrating a solution containing ds oligonucleotides.

[0127] Method:

[0128] TFF Concentration (using draw solution): A 1.8 M arginine HCl draw solution was used to concentrate a solution containing ds oligonucleotides (i.e., the oligonucleotide was a sodium salt duplex composed of a 36-nucleotide sense strand (SEQ ID NO: 3) containing GalNAc sugar at positions 28 - 30 and complexed with a 22-nucleotide antisense strand (SEQ ID NO: 4)) via TFF, using the parameters listed in Table 5 below. Here, TFF was initially run without the draw solution until the permeate flux was 0 and the retentate scale weight no longer decreased, and then the draw solution pump was turned on.

[0129] Table 5: TFF parameters for TFF using draw solution.

[0130]

[0131] * Concentration measured from the old method using SoloVPE.

[0132] Results: After the addition of the draw solution, the effect of the draw solution was evident by the immediate sharp decrease in the retentate weight. The ds oligonucleotide concentration of the final retentate solution was measured to be 228 mg / mL.

[0133] Example 5: Effect of Changing the Salt in the Draw Solution on TFF

[0134] Purpose: To evaluate the effect of changing the salt type in the draw solution to determine the effect on concentrating a solution containing ds oligonucleotides.

[0135] Methods:

[0136] TFF Concentration: Using various salts as draw solutions, a solution containing ds oligonucleotides (i.e., an oligonucleotide is a sodium salt duplex composed of a 36-nucleotide sense strand (SEQ ID NO: 3) containing a GalNAc sugar at positions 28 - 30 complexed with an antisense strand of 22 nucleotides (SEQ ID NO: 4)) was concentrated via TFF using the parameters listed in Table 6. Different draw solutions and concentrations are listed in Table 7. All other experimental parameters were kept constant for comparison except for the draw solution. The experimental conditions were the same as those in Example 1, and the 0 mM control sample described in Example 1 was used as a comparison to determine whether various draw solutions could achieve higher concentrations. The final siRNA concentrations are listed in Table 6, the permeate flux data was plotted in Figure 4 and the retentate weight data is shown in Figure 5

[0137] The run was ended when the retentate weight remained constant for 30 minutes or when the minimum reservoir volume was reached (for the 167 mM MgCl2 draw solution sample). The data was adjusted to start from the same weight at time 0 to account for the slight variation in the delay time between the start of data collection and the start of the run for each TFF experiment.

[0138] Table 6: TFF Parameters for TFF Using Draw Solutions.

[0139]

[0140] Table 7: Draw Solutions and Final ds Oligonucleotide Concentrations.

[0141]

[0142]

[0143] ​Results: The draw solutions of 33.3 mM MgCl2, 25 mM MgSO4, Na2SO4, and 16.5 mM Na3C6H5O7 had approximately the same ionic strength as listed in Table 7 and achieved relatively similar final ds oligonucleotide concentration values (ranging from 102 mg / mL to 116 mg / mL). All draw solutions were able to achieve a greater ds oligonucleotide concentration than the control solution of H2O, with the solution having the highest ionic strength reaching the greatest ds oligonucleotide concentration. Although the different salts affected the overall run time, as demonstrated by the retentate scale data in Figure 5 , solutions with similar ionic strength had nearly the same permeate flux values during the first hour ( Figure 4 ).

[0144] Example 6: High Molecular Weight Molecules in Draw Solutions for TFF

[0145] Objective: To evaluate the effect of using high molecular weight molecules in draw solutions to determine the concentration of solutions containing ds oligonucleotides.

[0146] Method: The sodium salt of dextran sulfate (a sulfated polysaccharide) was used as the draw solution to concentrate a solution containing ds oligonucleotides (i.e., the oligonucleotide was a sodium salt duplex composed of a 36-nucleotide sense strand (SEQ ID NO: 3) containing a GalNAc sugar at positions 28 - 30 complexed with a 22-nucleotide antisense strand (SEQ ID NO: 4)) via TFF, using the parameters listed in Table 8. The average molecular weight of dextran sulfate was ~500 kDa, which should not be able to cross a TFF membrane with a MWCO of 2 kDa. Draw solutions at concentrations of 100 mg / mL and 150 mg / mL were tested. All other experimental parameters were kept constant for comparison except for the draw solution. The experimental conditions were comparable to those in Example 1, and a 0 mM control sample described in Example 1 was used for comparison to determine whether the dextran sulfate draw solution could achieve a higher ds oligonucleotide concentration. The final ds oligonucleotide concentrations are listed in Table 9, and the retentate scale weight data are shown in Figure 6 .

[0147] The run was ended when the retentate scale weight remained constant for 30 minutes. The data were adjusted to start from the same weight at time 0 to account for slight variations in the delay time between the start of data collection and the start of the run for each TFF experiment.

[0148] Table 8: TFF Parameters for TFF Using Draw Solutions

[0149]

[0150]

[0151] *Concentration measured from the old method using SoloVPE.

[0152] Table 9: Absorbing solution and final ds oligonucleotide concentration.

[0153]

[0154] Result: Both absorbing solutions containing dextran sulfate were able to achieve a greater concentration than the control solution of H2O.

[0155] Sequence Listing

[0156] The following nucleotide and / or amino acid sequences are mentioned in the above disclosure and are provided below for reference.

[0157] SEQ ID NO: 1 - Synthetic oligonucleotide 1 (36 nt)

[0158] UCAAAAUGGAAGGUUAUACAGCAGCCGAAAGGCUGC

[0159] SEQ ID NO: 2 - Synthetic oligonucleotide 2 (22 nt)

[0160] UGUAUAACCUUCCAUUUUGAGG

[0161] SEQ ID NO: 3 - Synthetic oligonucleotide 3 (36 nt)

[0162] [mUs][mC][mA][mA][mA][mA][mU][fG][fG][fA][fA][mG][mG][mU][mU][mA][mU]

[0163] mA][mC][mA][mG][mC][mA][mG][mC][mC][mG][ademA - GalNAc][ademA -

[0164] GalNAc][ademA - GalNAc][mG][mG][mC][mU][mG][mC]

[0165] SEQ ID NO: 4 - Synthetic oligonucleotide 4 (22 nt)

[0166] [Me phosphate - 4O - mUs][fGs][fUs][fA][fU][mA][fA][mC][mC][fU][mU][mC][mC][fA][mU][mU][mU][mU][mG][mAs][mGs][mG]

Claims

1. An apparatus for concentrating biomolecules in a solution, the apparatus comprising: i. A first reservoir in fluid communication with a first side of a membrane, wherein the first reservoir is a retentate feed, and wherein the membrane has a molecular weight cut-off (MWCO) of < about 5 kDa; ii. A second reservoir in fluid communication with a second, opposite side of the membrane, wherein the second reservoir is a draw solution feed and a permeate collector; iii. A first feed pump for circulating the retentate across the first side of the membrane; iv. A second feed pump for circulating the draw solution or draw solution / permeate mixture across the second, opposite side of the membrane; v. A first balance with a stirring plate, wherein the first balance with the stirring plate is for stirring the retentate in the first reservoir and for measuring the retentate; vi. A second balance with a stirring plate, wherein the second balance with the stirring plate is for stirring the draw solution or draw solution / permeate mixture in the second reservoir and for measuring the draw solution or draw solution / permeate mixture; and vii. A transmembrane pressure (TMP) controller.

2. The apparatus according to claim 1, wherein the MWCO is at least about 1 kDa.

3. The apparatus according to claim 1 or claim 2, wherein the MWCO is at least about 2 kDa.

4. The device according to any one of claims 1 to 3, wherein the membrane has a surface area of from about 0.02 m 2 to about 0.1 m 2 .

5. The apparatus according to any one of claims 1 to 4, wherein the membrane is a polyethersulfone (PES) membrane or a regenerated cellulose membrane.

6. A method for concentrating oligonucleotides in a solution, the method comprising the steps of: a. Circulating a first solution across a first side of a membrane, wherein the first solution is a retentate having an initial oligonucleotide concentration of < about 95 mg / mL and a pH of about 6 to about 7, and wherein the membrane has a MWCO of < about 5 kDa; b. Circulating a second solution across a second, opposite side of the membrane, wherein the second solution is a draw solution having a pH of about 6 to about 8 and an ionic strength greater than that of the first solution; c. Maintaining a transmembrane pressure (TMP) across the membrane at about 30 psi to about 45 psi; and d. Maintaining the circulation of the retentate and the permeate across the first and second, opposite membrane sides, respectively, until the first solution has a final oligonucleotide concentration of at least about 100 mg / mL.

7. The method according to claim 6, wherein the initial oligonucleotide concentration is at least about 20 mg / mL.

8. The method according to claim 6 or 7, wherein the first solution is water.

9. The method according to any one of claims 6 to 8, wherein the MWCO is at least about 1 kDa.

10. The method according to any one of claims 6 to 9, wherein the MWCO is at least about 2 kDa.

11. The method according to any one of claims 6-10, wherein the membrane has a surface area of from about 0.02 m 2 to about 0.1 m 2 .

12. The method according to any one of claims 6 to 11, wherein the membrane is a polyethersulfone (PES) membrane or a regenerated cellulose membrane.

13. The method according to any one of claims 6 to 12, wherein the ionic strength of the second solution is about 0.01 mol / L to about 2.0 mol / L.

14. The method according to any one of claims 6 to 13, wherein the second solution comprises a NaCl concentration of from about 0.01 M to about 2.0 M.

15. The method according to any one of claims 6 to 13, wherein the second solution comprises a MgCl2 concentration of from about 0.03 M to about 2.0 M.

16. The method according to any one of claims 6 to 13, wherein the second solution comprises a dextran sulfate concentration of from about 100 mg / mL to about 200 mg / mL.

17. The method according to any one of claims 6 to 16, wherein the oligonucleotide is single-stranded (ss).

18. The method according to any one of claims 6 to 16, wherein the oligonucleotide is double-stranded (ds).

19. The method according to any one of claims 6 to 18, wherein the first solution flows across the first side of the membrane at a rate of from about 0.1 L / minute to about 1.5 L / minute.

20. The method according to any one of claims 6 to 19, wherein the second solution flows across the second, opposite side of the membrane at a rate of from about 1.0 L / minute to about 15.0 L / minute.

21. The method according to any one of claims 6 to 20, wherein the ionic strength of the second solution is maintained during the cycle.

22. The method according to any one of claims 6 to 20, wherein the ionic strength of the second solution is increased during the cycle.

23. The method according to claim 22, wherein the ionic strength of the second solution is increased by about 1% to about 10% compared to its initial ionic strength.

24. The method according to any one of claims 6 to 23, wherein the final oligonucleotide concentration is from about 150 mg / mL to about 200 mg / mL.

25. The method according to any one of claims 6 to 23, wherein the final oligonucleotide concentration is from about 200 mg / mL to about 250 mg / mL.

26. The method according to any one of claims 6 to 23, wherein the final oligonucleotide concentration is from about 250 mg / mL to about 300 mg / mL.

27. The method according to any one of claims 6 to 23, wherein the final oligonucleotide concentration is > 300 mg / mL.