Polynucleic acid molecule for inhibiting expression of FXI, pharmaceutical composition and application thereof

Abstract

Disclosed herein are polynucleic acid molecules, pharmaceutical compositions, and methods for repressing expression of the blood coagulation factor XI (FXI) gene. Specifically, the polynucleic acid molecule comprises a sequence-defined nucleic acid sequence for targeting FXI to achieve an anti-thrombogenic effect without causing severe bleeding, and further provides prevention or treatment of thrombosis.

Description

[0001] Cross-reference

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 410,084, filed on September 26, 2022, which is hereby incorporated by reference in its entirety. Background Art

[0003] As a cellular mechanism for the selective degradation of mRNA, the discovery of RNA interference (RNAi) has allowed for the targeted manipulation of cellular phenotypes in cell culture and the potential for the development of directed therapies (Behlke, 2006, Mol. Ther. 13, 644 - 670; Xie et al., 2006, Drug Discov. Today 11, 67 - 73).

[0004] Thrombosis is the formation of a blood clot (termed a thrombus) within a blood vessel. This can prevent the normal flow of blood through the circulatory system and can be fatal. Coagulation factor XI (FXI or F11) is a protein encoded by the FXI gene. FXI plays an important role in the coagulation cascade and is mainly made by cells in the liver. Accordingly, there is a need to develop an effective and non - cytotoxic FXI inhibitor. The polynucleic acid molecules, their conjugates, and methods described herein meet this need and provide related advantages.

[0005] Incorporated by reference

[0006] All publications, patents, and patent applications mentioned in this specification are hereby incorporated by reference to the same extent as if each individual publication, patent, or patent application were specifically and individually indicated to be incorporated by reference. To the extent that any incorporated publication and patent or patent application contradicts the disclosure contained herein, the specification is intended to supersede and / or take precedence over any such conflicting material. Summary of the Invention

[0007] To meet the need for more effective FXI inhibitors, in one aspect, the present disclosure provides a polynucleic acid molecule for modulating the expression of coagulation factor XI (FXI) gene, wherein the polynucleic acid molecule comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90% identical to the nucleic acid sequences in Tables 1-2 and Tables 7-9. In some cases, the polynucleic acid molecule is a double-stranded nucleic acid molecule comprising a sense strand (passenger strand) and an antisense strand (guide strand). In some cases, the sense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to the nucleic acid sequences selected from SEQ ID NO: 101-150 and 220. In some cases, the antisense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to the nucleic acid sequences selected from SEQ ID NO: 1-50 and 215-216.

[0008] In some cases, the sense strand comprises a nucleic acid sequence that comprises at least 14, 15, 16, 17, 18, 19 or 20 consecutive sequences of the nucleic acid sequences selected from SEQ ID NO: 101-150 and 220 and has no more than 1, 2, 3 or 4 mismatches. In some cases, the antisense strand comprises a nucleic acid sequence that comprises at least 14, 15, 16, 17, 18, 19, 20, 21 or 22 consecutive sequences of the nucleic acid sequences selected from SEQ ID NO: 1-50 and 215-216 and has no more than 1, 2, 3 or 4 mismatches. In some cases, the sense strand comprises the nucleic acid sequences of SEQ ID NO: 101-150 and 220, and the antisense strand comprises the nucleic acid sequences of SEQ ID NO: 1-50 and 215-216. In some cases, the sense strand comprises a nucleic acid sequence that is at least 90%, at least 95% identical to the nucleic acid sequences selected from SEQ ID NO: 104, 106-107, 109-111, 113-114, 135, 150 and 220. In some cases, the antisense strand comprises a nucleic acid sequence that is at least 90%, at least 95% identical to the nucleic acid sequences selected from SEQ ID NO: 4, 6-7, 9-11, 13-14, 35, 50 and 215-216. In some cases, the sense strand comprises the nucleic acid sequences selected from SEQ ID NO: 104, 106-107, 109-111, 113-114, 135, 150 and 220, and the antisense strand comprises the nucleic acid sequences selected from SEQ ID NO: 4, 6-7, 9-11, 13-14, 35, 50 and 215-216.

[0009] In some cases, the antisense strand comprises 5'-nNfnnnNfnNfNfnnnnNfnNfnnnnnnn-3', 5'-nNfnnnNfnnnnnnnNfnNfnnnnnnn-3', 5'-nNfnnnnNfnnnnNfnNfnnnnnnnnn-3', 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnnn-3' or 5'-nNfnnnnnnnnnNfnNfnNfnnnnnnn-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide. In some cases, the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3', 5'-nnnnnnnnNfNfNfnnnnnnnnnn-3' or 5'-nnnnnnNfnNfnNfnnnnnnnnnn-invdN-invdN-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide, and wherein "invdN" represents an inverted deoxynucleotide. In some cases, the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnNfnnnnnnn-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide. In some cases, the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnnn-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0010] In some cases, the polynucleic acid molecule comprises a modified internucleotide bond, optionally, wherein the modified internucleotide bond is a phosphorothioate internucleotide bond. In some cases, the modified internucleotide bond comprises a stereochemically enriched phosphorothioate internucleotide bond. In some cases, the modified internucleotide bond is an SP chiral internucleotide phosphorothioate bond. In some cases, the polynucleic acid comprises a plurality of modified internucleotide bonds, and at least 1, 2, 3, or 4 of the plurality of modified internucleotide bonds are stereochemically enriched phosphorothioate internucleotide bonds. In some cases, the stereochemically enriched phosphorothioate internucleotide bond comprises both R-isomers and S-isomers. In some cases, the stereochemically enriched phosphorothioate is between two consecutive nucleosides, and the two nucleosides are two of the six 5' or 3' terminal nucleosides of the sense strand or the antisense strand.

[0011] In some cases, the polynucleic acid molecule comprises a nucleoside substitution with a hypoxanthine nucleobase. In some cases, the nucleoside substitution with a hypoxanthine nucleobase is an inosine substitution, optionally, wherein the inosine substitution comprises 2'-O-methylinosine-3'-phosphate. In some cases, the inosine substitution is within the seed region of the antisense strand. In some cases, the inosine substitution is within 7 nucleotides from the 5' end of the antisense strand, optionally, wherein the inosine substitution is in the first nucleotide from the 5' end of the antisense strand.

[0012] In some cases, the first nucleotide from the 5' end of the antisense strand is substituted with uridine or adenosine, optionally, wherein the uridine comprises 2'-O-methyluridine-3'-phosphate, or optionally, wherein the adenosine comprises 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0013] In some cases, the sense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 151-200, 214, and 221. In some cases, the antisense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 51-100, 201-213, and 217-219. In some cases, the sense strand comprises a nucleic acid sequence selected from the nucleic acid sequences of SEQ ID NOs: 151-200, 214, and 221, and the antisense strand comprises a nucleic acid sequence selected from the nucleic acid sequences of SEQ ID NOs: 51-100, 201-213, and 217-219.

[0014] In another aspect, the present disclosure includes a polynucleic acid molecule for regulating the expression of coagulation factor XI (FXI) gene, wherein the polynucleic acid molecule comprises:

[0015] (a) The antisense strand of the nucleotide sequence comprising SEQ ID NO: 4, 6 - 7, 9 - 11, 13 - 14, 35, 50 and 215 - 216 and the sense strand of the nucleotide sequence comprising SEQ ID NO: 104, 106 - 107, 109 - 111, 113 - 114, 135, 150 and 220; or

[0016] (b) The antisense strand of the nucleotide sequence comprising SEQ ID NO: 54, 56 - 57, 59 - 61, 63 - 64, 85, 100, 201 - 213 and 217 - 219 and the sense strand of the nucleotide sequence comprising SEQ ID NO: 154, 156 - 157, 159 - 161, 163 - 164, 185, 200, 214 and 221.

[0017] In some cases, the polynucleotide molecule comprises:

[0018] (a) The antisense strand of the nucleotide sequence comprising AUAAAUGUCUUUGUUGCAAGCGC (SEQ ID NO: 11) and the sense strand of the nucleotide sequence comprising GCUUGCAACAAAGACAUUUAU (SEQ ID NO: 111);

[0019] (b) The antisense strand of the nucleotide sequence comprising AUGUCUUUGUUGCAAGCGCUUAU (SEQ ID NO: 9) and the sense strand of the nucleotide sequence comprising AAGCGCUUGCAACAAAGACAU (SEQ ID NO: 109);

[0020] (c) The antisense strand of the nucleotide sequence comprising AAUGUCUUUGUUGCAAGCGCUUA (SEQ ID NO: 10) and the sense strand of the nucleotide sequence comprising AGCGCUUGCAACAAAGACAUU (SEQ ID NO: 110);

[0021] (d) The antisense strand of the nucleotide sequence comprising UUAUAGUUUAUGCCCUUCAUGUC (SEQ ID NO: 13) and the sense strand of the nucleotide sequence comprising CAUGAAGGGCAUAAACUAUAA

[0022] (SEQ ID NO: 113);

[0023] (e) The antisense strand of the nucleotide sequence comprising AUAGGUAAAAAACUGGCAGCGGA (SEQ ID NO: 35) and the sense strand of the nucleotide sequence comprising CGCUGCCAGUUUUUUACCUAU

[0024] The sense strand of the nucleotide sequence of (SEQ ID NO:135);

[0025] (f) The antisense strand containing the nucleotide sequence of IUAAAUGUCUUUGUUGCAAGCGC (SEQ ID NO:215) and the sense strand containing GCUUGCAACAAAGACAUUUAU

[0026] (SEQ ID NO:111); or

[0027] (g) The antisense strand containing the nucleotide sequence of UUAAAUGUCUUUGUUGCAAGCGC (SEQ ID NO:216) and the sense strand containing GCUUGCAACAAAGACAUUUAA

[0028] (SEQ ID NO:220).

[0029] In another aspect, the present disclosure includes a polynucleic acid molecule for regulating the expression of coagulation factor XI (FXI) gene, wherein the polynucleic acid molecule comprises:

[0030] (a) The antisense strand containing the nucleotide sequence of asUfsaaaugucuuUfgUfuGfcaagcsgsc (SEQ ID NO:61) and the sense strand containing gscsuugcAfaCfaAfagacauuuau (SEQ ID NO:161);

[0031] (b) The antisense strand containing the nucleotide sequence of asUfsaaaugucuuUfgUfuGfcsaagcsgsc (SEQ ID NO:211) and the sense strand containing gscsuugcAfaCfaAfagacauuuau (SEQID NO:161);

[0032] (c) The antisense strand containing the nucleotide sequence of asUfsaaaugucuuUfgUfsuGfcaagcsgsc (SEQ ID NO:212) and the sense strand containing gscsuugcAfaCfaAfagacauuuau (SEQID NO:161);

[0033] (d) The antisense strand containing the nucleotide sequence of asUfsaaaugucuuUfgUfuGfcaasgcsgsc (SEQ ID NO:213) and the sense strand containing gscsuugcAfaCfaAfagacauuuau (SEQID NO:161);

[0034] (e) The antisense strand of the nucleotide sequence comprising asUfsaaaugucuuUfgUfuGfcaagcsgsc (SEQ ID NO:61) and the sense strand of the nucleotide sequence comprising gscsuugcAfaCfaAfagacauuuau (invdT)(invdT)(SEQ ID NO:214);

[0035] (f) The antisense strand of the nucleotide sequence comprising asUfsgucuUfuguuGfcAfaGfcgcuusasu (SEQ ID NO:204) and the sense strand of the nucleotide sequence comprising asasgcgcUfuGfcAfacaaagacau (SEQ ID NO:159);

[0036] (g) The antisense strand of the nucleotide sequence comprising asAfsugucUfuuguUfgCfaAfgcgcususa (SEQ ID NO:205) and the sense strand of the nucleotide sequence comprising asgscgcuUfgCfaAfcaaagacauu (SEQ ID NO:160);

[0037] (h) The antisense strand of the nucleotide sequence comprising asUfsaaauGfucuuUfgUfuGfcaagcsgsc (SEQ ID NO:206) and the sense strand of the nucleotide sequence comprising gscsuugcAfaCfaAfagacauuuau (SEQ ID NO:161);

[0038] (i) The antisense strand of the nucleotide sequence comprising usUfsauagUfuuauGfcCfcUfucaugsusc (SEQ ID NO:207) and the sense strand of the nucleotide sequence comprising csasugaaGfgGfcAfuaaacuauaa (SEQ ID NO:163);

[0039] (j) The antisense strand of the nucleotide sequence comprising asUfsagguAfaaaaAfcUfgGfcagcgsgsa (SEQ ID NO:209) and the sense strand of the nucleotide sequence comprising csgscugcCfaGfuUfuuuuaccuau (SEQ ID NO:185);

[0040] (k) The antisense strand of the nucleotide sequence comprising isUfsaaaugucuuUfgUfuGfcaagcsgsc (SEQ ID NO:217) and the sense strand of the nucleotide sequence comprising gscsuugcAfaCfaAfagacauuuau (SEQ ID NO:161);

[0041] (l) The antisense strand of the nucleotide sequence containing usUfsaaauGfucuuUfgUfuGfcaagcsgsc (SEQ ID NO:218) and the sense strand of the nucleotide sequence containing gscsuugcAfaCfaAfagacauuuaa (SEQ ID NO:222); or

[0042] (m) The antisense strand of the nucleotide sequence containing a4sUfsaaauGfucuuUfgUfuGfcaagcsgsc (SEQ ID NO:219) and the sense strand of the nucleotide sequence containing gscsuugcAfaCfaAfagacauuuau (SEQ ID NO:161);

[0043] wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u"

[0044] refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "dU"

[0045] refers to 2'-deoxyuridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate;

[0046] "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thio-phosphate, "invdT"

[0047] refers to 3'-inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, and "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0048] In another aspect, the present disclosure includes a polynucleic acid molecule conjugate for regulating the expression of the coagulation factor XI (FXI) gene, wherein the polynucleic acid molecule conjugate comprises a polynucleic acid molecule as disclosed herein and an asialoglycoprotein receptor targeting moiety.

[0049] In some cases, the polynucleic acid molecule and the asialoglycoprotein receptor targeting moiety are conjugated via a linker. In some cases, the linker comprises the following formula (IV),

[0050] wherein at least one of Y1 and Y2 is a nucleotide in the polynucleic acid molecule. In some cases, Y1 is the last nucleotide at the 3'-end of the sense strand of the polynucleic acid molecule, or wherein Y2 is the first nucleotide at the 5'-end of the sense strand of the polynucleic acid molecule. In some cases, Y1 and Y2 are two consecutive nucleotides in the polynucleic acid molecule.

[0051] In some cases, the asialoglycoprotein receptor targeting moiety comprises N-acetylgalactosamine (GalNAc) or galactose.

[0052] In some cases, the linker bearing the last nucleotide at the 3'-end of the sense strand of the polynucleic acid molecule and the asialoglycoprotein receptor targeting moiety are as shown in the following formula:

[0053]

[0054]

[0055] wherein Z in formula (V'), (V''), (V''') or (V'''') is -H,

[0056] -OH, -O-methyl, -F or -O-methoxyethyl, and R in formula (V') is adenine, uracil, guanine, cytosine, thymine, abasic, etc.

[0057] In another aspect, the present disclosure includes a pharmaceutical composition comprising a polynucleic acid molecule or a polynucleic acid molecule conjugate as disclosed herein, and a pharmaceutically acceptable excipient.

[0058] In another aspect, the present disclosure includes a method of modulating the mRNA expression of coagulation factor XI (FXI) gene in a subject, comprising: administering to the subject a polynucleic acid molecule, a polynucleic acid molecule conjugate or a pharmaceutical composition as disclosed herein, thereby modulating the mRNA expression of the FXI gene in the subject.

[0059] In another aspect, the present disclosure includes a method of modulating the FXI or FXIa protein level or FXI or FXIa activity in a subject in need thereof, comprising: administering to the subject a polynucleic acid molecule, a polynucleic acid molecule conjugate or a pharmaceutical composition as disclosed herein, thereby modulating the FXI or FXIa protein level or FXI or FXIa activity in the subject. In some cases, the subject in need thereof is diagnosed with or suffering from thrombosis or its symptoms. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Aspects of the present disclosure are set forth specifically in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that illustrates illustrative aspects, in which the principles of the present disclosure are utilized, and the following drawings.

[0061] Figure 1 Depicts the in vitro efficacy of siRNAs targeting FXI from SRS-000579 to SRS-000602 in human primary hepatocytes. Each siRNA was tested at three concentrations: 100 nM, 30 nM, and 10 nM. The three bars for each siRNA in the bar graph represent the average percent inhibition at 100 nM, 30 nM, and 10 nM from left to right, respectively. Each siRNA was assayed in triplicate at each dose level. Error bars represent the standard deviation.

[0062] Figure 2 Depicts the in vitro efficacy of siRNAs targeting FXI from SRS-000603 to SRS-000628 in human primary hepatocytes. Each siRNA was tested at three concentrations: 100 nM, 30 nM, and 10 nM. The three bars for each siRNA in the bar graph represent the average percent inhibition at 100 nM, 30 nM, and 10 nM from left to right, respectively. Each siRNA was assayed in triplicate at each dose level. Error bars represent the standard deviation.

[0063] Figure 3 Depicts the in vivo efficacy of siRNA SRS-000007 targeting FXI or saline control in cynomolgus monkeys. SRS-000007 was tested at two dose levels (1 mg / kg and 5 mg / kg) via a single subcutaneous injection. Results are shown as the percent change in plasma FXI protein compared to the pre-dose baseline.

[0064] Figure 4 Depicts the dose-response curves of SRS-000007 in human primary hepatocytes from three different donor batches.

[0065] Figure 5 Depicts the percent change in plasma FXI circulating protein levels in cynomolgus monkeys treated with the siRNAs shown in Table 7 relative to the pre-dose baseline.

[0066] Figure 6 Depicts the percent change in plasma FXI circulating protein levels in cynomolgus monkeys treated with the siRNAs shown in Table 8 relative to the pre-dose baseline.

[0067] Figure 7 Depicts the dose-response curves of SRS-000007 and SRS-002331 in human primary hepatocytes from two different donor batches. Detailed Description

[0068] The FXI gene is located at the distal end of the long arm of chromosome 4 (4q35.2). The mRNA of FXI (NM_000128.4) contains 3053 bp and is divided into 15 exons (exon 2 is the signal peptide, exons 3-10 are the apple domains, and exons 11-15 are the protease domain). (See, for example, Mohammed et al., Thromb Res. 2018; 161:94-105 and NCBI reference sequence number: NM_000128.4).

[0069] Factor XI (FXI) is the zymogen of the coagulation protease factor XIa (FXIa) and consists of 625 amino acid residues, which contains four apple domains (or PAN domains, which represent plasminogen - apple - nematode ( P lasminogen - A pple - N ematode); A1 to A4) and a trypsin - like catalytic domain. In some cases, FXI is also referred to as plasma thromboplastin antecedent or PTA. Similar to other coagulation protease precursors, plasma FXI is mainly synthesized in hepatocytes. In some cases, FXI in humans is also expressed in the pancreatic islets and in the renal tubular cells of the kidney. Each FXI subunit can be converted into its active form by thrombin (e.g., α - thrombin, β - thrombin, γ - thrombin, and meizothrombin) or factor XIIa. In some cases, FXI can be auto - activated by FXIa in the presence of polyanions. Regardless of the activating protease, the action of FXI requires the cleavage of the Arg369 - Ile370 bond to become active FXIa.

[0070] Therefore, targeting FXI can achieve an antithrombotic effect without causing severe bleeding and further provide prevention or treatment for thrombosis.

[0071] This article describes a polynucleic acid molecule for regulating the expression of the FXI gene. In some aspects, the polynucleic acid molecule is a single - stranded nucleic acid molecule. In some aspects, the polynucleic acid molecule is a double - stranded nucleic acid molecule containing a sense strand and an antisense strand. In some aspects, the polynucleic acid molecule contains the nucleic acid sequences in Tables 1 - 2 and Tables 7 - 9. Correspondingly, this article provides various target regions of human FXI mRNA that hybridize with the polynucleic acid molecules described herein. In some cases, this article provides the sequences of the polynucleic acid molecules described herein. In some cases, this article provides possible modifications of the polynucleic acid molecules described herein. In some cases, this article provides possible conjugates of the polynucleic acid molecules described herein.

[0072] The present disclosure also describes a method of modulating the expression of FXI mRNA or protein in a subject. The present disclosure further describes a method of modulating the level of FXI or FXIa activity in a subject in need thereof.

[0073] Definitions

[0074] Unless the context clearly dictates otherwise, the singular forms "a," "an," and "the" include plural referents. For example, the term "cell" includes one or more cells, including mixtures thereof. "A and / or B" is used herein to include all of the following alternatives: "A," "B," "A or B," and "A and B."

[0075] When ranges of values are provided, it is to be understood that each intermediate value between the upper and lower limits of that range and any other stated value or intermediate value in that stated range (to one-tenth of the unit of the lower limit unless the context clearly dictates otherwise) is encompassed within the present disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the present disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the present disclosure.

[0076] Certain ranges are presented herein with numerical values preceded by the term "about." The term "about" is used herein to provide literal support for the exact number that it follows as well as numbers that are close to or approximate the number that follows. In determining whether a number is close to or approximate a specifically recited number, an unrecited number that is close to or approximate the specifically recited number may be a number that provides substantially the same value as the specifically recited number in the context in which it is presented.

[0077] "Percent sequence identity (%)" or "percent identity (%)" with respect to the nucleic acid sequences identified herein is defined as the percentage of nucleic acids in a candidate sequence that are identical to the nucleic acid sequence being compared after alignment of the sequences where any conservative substitutions are considered part of the sequence identity.

[0078] All ranges disclosed herein also cover any and all possible sub-ranges and combinations of sub-ranges. Any recited range can be considered to sufficiently describe and enable the same range being divided into at least two equal parts, three equal parts, four equal parts, five equal parts, ten equal parts, etc. As non-limiting examples, each range discussed herein can be readily divided into a lower third, a middle third, and an upper third, etc. Those skilled in the art will also understand that all terms such as "up to", "at least", "greater than", "less than", etc. include the recited numbers and refer to ranges that can subsequently be divided into sub-ranges as discussed above. Finally, those skilled in the art will understand that a range includes each individual member. Thus, for example, a group having 1 - 3 items refers to a group having 1, 2, or 3 items. Similarly, a group having 1 - 5 items refers to a group having 1, 2, 3, 4, or 5 items, and so on.

[0079] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which polynucleic acid molecules, polynucleic acid molecule conjugates, pharmaceutical compositions, methods, and other aspects pertain.

[0080] As used herein, the term "complementary" indicates a sufficient degree of complementarity between two nucleic acid molecules that bind stably and specifically to avoid non-specific binding.

[0081] As used herein, the terms "polynucleic acid" and "polynucleotide" are used interchangeably to refer to a nucleotide chain. The term "nucleotide" includes the sequences "G", "C", "A", "T", and "U", each of which typically represents a nucleotide containing the bases guanine, cytosine, adenine, thymidine, and uracil, respectively. In some cases, "nucleotide" can refer to a modified nucleotide (e.g., having a modified sugar moiety, modified base, modified internucleotide linkage, or combinations thereof, including but not limited to 2'-modified nucleotides, LNA, ENA, BNA, UNA, GNA, etc.). In some cases, "nucleotide" can refer to a modified nucleotide having a non-canonical base (e.g., including but not limited to 2-thiouridine, 2-thiothymidine, inosine, 2-aminopurine, 2,6-diaminopurine, dihydrouridine, 4-thiouridine, 4-thiothymidine, 2-thiocytidine).

[0082] As used herein, an "object" can be any mammal, including humans and non-human primates.

[0083] As used herein, the term "condition" includes diseases, disorders, and susceptibilities. In some cases, the condition is an FXI-related disorder or its symptoms.

[0084] As used herein, the term "treat" or "treatment" of any disease or disorder in one context refers to ameliorating the disease or disorder (i.e., slowing or arresting or reducing the development of the disease or at least one of its clinical symptoms). In another context, "treat" or "treatment" refers to alleviating or ameliorating at least one physical parameter, including those that may not be perceptible to the patient. In yet another context, "treat" or "treatment" refers to physically (e.g., stabilizing a perceptible symptom), physiologically (e.g., stabilizing a physical parameter), or both, modulating the disease or disorder.

[0085] As used herein, the term "prevent" or "prevention" refers to reducing the occurrence of the pathology of a condition in a subject who does not have the disease or condition but is at risk of developing or is susceptible to the disease or condition. Prevention can be complete, e.g., the complete absence of the pathology of the condition in the subject. Prevention can also be partial, such that the occurrence of the pathology of the condition in the subject is less than would occur in the absence of the present disclosure.

[0086] As used herein, "administer" and its grammatical equivalents can refer to providing a pharmaceutical composition described herein to a subject or patient. The composition can be administered to the subject using conventional methods known to those of ordinary skill in the medical arts, depending on the type of disease or site of the disease to be treated. For example, the composition can be administered, e.g., orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally, via an implantable reservoir, or via infusion. One or more such routes can be employed.

[0087] As used herein, the term "pharmaceutical composition" and its grammatical equivalents can refer to a mixture or solution that comprises a therapeutically effective amount of an active pharmaceutical ingredient and one or more pharmaceutically acceptable excipients, carriers, and / or therapeutic agents to be administered to a subject in need (e.g., a human).

[0088] As used herein, the term "pharmaceutically acceptable" and its grammatical equivalents can refer to the property of a material that can be used to prepare a pharmaceutical composition that is generally safe, non-toxic, neither biologically nor otherwise undesirable, and acceptable for veterinary as well as human pharmaceutical use. "Pharmaceutically acceptable" can refer to a material such as a carrier or diluent that does not abrogate the biological activity or properties of a compound and is relatively non-toxic, i.e., the material can be administered to a subject without causing adverse biological effects or interacting in a harmful manner with any component of the pharmaceutical composition containing the material.

[0089] A "pharmaceutically acceptable excipient" is an excipient that can be administered with an agent to a subject and that does not destroy the pharmacological activity of the agent and is non-toxic when administered in a dose sufficient to deliver a therapeutic amount of the agent.

[0090] The term "therapeutic agent" can refer to any agent that has a therapeutic, diagnostic, and / or prophylactic effect, and / or causes a desired biological and / or pharmacological effect when administered to a subject. A therapeutic agent can also be referred to as an "active agent" or "active pharmaceutical ingredient". Such agents include, but are not limited to, cytotoxins, radioisotopes, chemotherapeutic agents, small molecule drugs, proteins, and nucleic acids.

[0091] It should be understood that certain features of polynucleotide molecules and / or polynucleotide molecule conjugates, pharmaceutical compositions, methods, and other aspects described in the context of separate embodiments for clarity may also be provided in combination in a single embodiment. Conversely, the various features of polynucleotide molecules and / or polynucleotide molecule conjugates, pharmaceutical compositions, methods, and other aspects described in the context of a single embodiment for brevity may also be provided separately or in any suitable sub-combination. All combinations of embodiments are specifically included in the present disclosure and are disclosed herein as if each combination were separately and explicitly disclosed, to the extent that such combinations include operable processes and / or compositions. In addition, all sub-combinations listed in embodiments describing such variables are also specifically included in the present disclosure of polynucleotide molecules and / or polynucleotide molecule conjugates, pharmaceutical compositions, methods, and other aspects and are disclosed herein as if each such sub-combination were separately and explicitly disclosed herein.

[0092] As used herein, the term "sense strand" can be used interchangeably with the term "passenger strand", and the term "antisense strand" can be used interchangeably with the term "guide strand".

[0093] As used herein, the term "contiguous sequence" refers to a sequence that contains multiple contiguous nucleotides from a reference sequence. For example, if the reference sequence is N1N2N3N4N5N6N7, a contiguous sequence can be N1N2N3N4 or N3N4N5N6, but the sequences N1N3N4N5 or N3N4N7 cannot be contiguous sequences.

[0094] As used herein, the term "negative control" refers to a subject or cell that has not received treatment or has received a placebo.

[0095] Polynucleotide molecule

[0096] Target region of a polynucleotide molecule

[0097] This article describes a polynucleic acid molecule for regulating the expression of the FXI gene. In some cases, the polynucleic acid molecule comprises a single-stranded nucleic acid molecule that hybridizes to certain regions of the mRNA. In some cases, the polynucleic acid molecule is a double-stranded nucleic acid molecule. This article also describes a polynucleic acid molecule for regulating the expression of the FXI gene, wherein the polynucleic acid molecule is a double-stranded nucleic acid molecule comprising a sense strand and an antisense strand, and the antisense strand hybridizes to certain regions of the FXI mRNA.

[0098] In some aspects, the polynucleic acid molecule described in this article hybridizes to certain regions of the human FXI mRNA. In some cases, the human FXI mRNA is NM_000128.4. In some aspects, the polynucleic acid molecule described in this article hybridizes to certain regions of the non-human FXI mRNA.

[0099] In some aspects, the polynucleic acid molecule described in this article hybridizes to the 5’UTR region of the human FXI mRNA. In some aspects, the polynucleic acid molecule described in this article hybridizes to the coding region of the human FXI mRNA. In some aspects, the polynucleic acid molecule described in this article hybridizes to a part of exon 1 of the human FXI mRNA. In some aspects, the polynucleic acid molecule described in this article hybridizes to a part of exon 2 of the human FXI mRNA. In some aspects, the polynucleic acid molecule described in this article hybridizes to a part of exon 3 of the human FXI mRNA. In some aspects, the polynucleic acid molecule described in this article hybridizes to a part of exon 4 of the human FXI mRNA. In some aspects, the polynucleic acid molecule described in this article hybridizes to a part of exon 5 of the human FXI mRNA. In some aspects, the polynucleic acid molecule described in this article hybridizes to a part of exon 6 of the human FXI mRNA. In some aspects, the polynucleic acid molecule described in this article hybridizes to a part of exon 7 of the human FXI mRNA. In some aspects, the polynucleic acid molecule described in this article hybridizes to a part of exon 8 of the human FXI mRNA. In some aspects, the polynucleic acid molecule described in this article hybridizes to a part of exon 9 of the human FXI mRNA. In some aspects, the polynucleic acid molecule described in this article hybridizes to a part of exon 10 of the human FXI mRNA. In some aspects, the polynucleic acid molecule described in this article hybridizes to a part of exon 11 of the human FXI mRNA. In some aspects, the polynucleic acid molecule described in this article hybridizes to a part of exon 12 of the human FXI mRNA. In some aspects, the polynucleic acid molecule described in this article hybridizes to a part of exon 13 of the human FXI mRNA. In some aspects, the polynucleic acid molecule described in this article hybridizes to a part of exon 14 of the human FXI mRNA. In some aspects, the polynucleic acid molecule described in this article hybridizes to a part of exon 15 of the human FXI mRNA. In some aspects, the polynucleic acid molecule described in this article hybridizes to the 3’UTR region of the human FXI mRNA.

[0100] In some aspects, the target regions for hybridization of the polynucleic acid molecules described herein are determined by the FXI silencing efficacy and possible off-target effects. In some cases, the starting point of the target region falls between positions 1-10, 11-20, 21-30, 31-40, 41-50, 51-60, 61-70, 71-80, 81-90, or 91-100 of NM_000128.4. In some cases, the starting point of the target region falls between positions 101-110, 111-120, 121-130, 131-140, 141-150, 151-160, 161-170, 171-180, 181-190, or 191-200 of NM_000128.4. In some cases, the starting point of the target region falls between positions 201-210, 211-220, 221-230, 231-240, 241-250, 251-260, 261-270, 271-280, 281-290, or 291-300 of NM_000128.4. In some cases, the starting point of the target region falls between positions 301-310, 311-320, 321-330, 331-340, 341-350, 351-360, 361-370, 371-380, 381-390, or 391-400 of NM_000128.4. In some cases, the starting point of the target region falls between positions 401-410, 411-420, 421-430, 431-440, 441-450, 451-460, 461-470, 471-480, 481-490, or 491-500 of NM_000128.4. In some cases, the starting point of the target region falls between positions 501-510, 511-520, 521-530, 531-540, 541-550, 551-560, 561-570, 571-580, 581-590, or 591-600 of NM_000128.4. In some cases, the starting point of the target region falls between positions 601-610, 611-620, 621-630, 631-640, 641-650, 651-660, 661-670, 671-680, 681-690, or 691-700 of NM_000128.4. In some cases, the starting point of the target region falls between positions 701-710, 711-720, 721-730, 731-740, 741-750, 751-760, 761-770, 771-780, 781-790, or 791-800 of NM_000128.4.In some cases, the starting point of the target region falls between positions 801 - 810, 811 - 820, 821 - 830, 831 - 840, 841 - 850, 851 - 860, 861 - 870, 871 - 880, 881 - 890, or 891 - 900 of NM_000128.4. In some cases, the starting point of the target region falls between positions 901 - 910, 911 - 920, 921 - 930, 931 - 940, 941 - 950, 951 - 960, 961 - 970, 971 - 980, 981 - 990, or 991 - 1000 of NM_000128.4. In some cases, the starting point of the target region falls between positions 1001 - 1010, 1011 - 1020, 1021 - 1030, 1031 - 1040, 1041 - 1050, 1051 - 1060, 1061 - 1070, 1071 - 1080, 1081 - 1090, or 1091 - 1100 of NM_000128.4. In some cases, the starting point of the target region falls between positions 1101 - 1110, 1111 - 1120, 1121 - 1130, 1131 - 1140, 1141 - 1150, 1151 - 1160, 1161 - 1170, 1171 - 1180, 1181 - 1190, or 1191 - 1200 of NM_000128.4. In some cases, the starting point of the target region falls between positions 1201 - 1210, 1211 - 1220, 1221 - 1230, 1231 - 1240, 1241 - 1250, 1251 - 1260, 1261 - 1270, 1271 - 1280, 1281 - 1290, or 1291 - 1300 of NM_000128.4. In some cases, the starting point of the target region falls between positions 1301 - 1310, 1311 - 1320, 1321 - 1330, 1331 - 1340, 1341 - 1350, 1351 - 1360, 1361 - 1370, 1371 - 1380, 1381 - 1390, or 1391 - 1400 of NM_000128.4. In some cases, the starting point of the target region falls between positions 1401 - 1410, 1411 - 1420, 1421 - 1430, 1431 - 1440, 1441 - 1450, 1451 - 1460, 1461 - 1470, 1471 - 1480, 1481 - 1490, or 1491 - 1500 of NM_000128.4.In some cases, the starting point of the target region falls between positions 1501 - 1510, 1511 - 1520, 1521 - 1530, 1531 - 1540, 1541 - 1550, 1551 - 1560, 1561 - 1570, 1571 - 1580, 1581 - 1590 or 1591 - 1600 of NM_000128.4. In some cases, the starting point of the target region falls between positions 1601 - 1610, 1611 - 1620, 1621 - 1630, 1631 - 1640, 1641 - 1650, 1651 - 1660, 1661 - 1670, 1671 - 1680, 1681 - 1690 or 1691 - 1700 of NM_000128.4. In some cases, the starting point of the target region falls between positions 1701 - 1710, 1711 - 1720, 1721 - 1730, 1731 - 1740, 1741 - 1750, 1751 - 1760, 1761 - 1770, 1771 - 1780, 1781 - 1790 or 1791 - 1800 of NM_000128.4. In some cases, the starting point of the target region falls between positions 1801 - 1810, 1811 - 1820, 1821 - 1830, 1831 - 1840, 1841 - 1850, 1851 - 1860, 1861 - 1870, 1871 - 1880, 1881 - 1890 or 1891 - 1900 of NM_000128.4. In some cases, the starting point of the target region falls between positions 1901 - 1910, 1911 - 1920, 1921 - 1930, 1931 - 1940, 1941 - 1950, 1951 - 1960, 1961 - 1970, 1971 - 1980, 1981 - 1990 or 1991 - 2000 of NM_000128.4. In some cases, the starting point of the target region falls between positions 2001 - 2010, 2011 - 2020, 2021 - 2030, 2031 - 2040, 2041 - 2050, 2051 - 2060, 2061 - 2070, 2071 - 2080, 2081 - 2090 or 2091 - 2100 of NM_000128.4. In some cases, the starting point of the target region falls between positions 2101 - 2110, 2111 - 2120, 2121 - 2130, 2131 - 2140, 2141 - 2150, 2151 - 2160, 2161 - 2170, 2171 - 2180, 2181 - 2190 or 2191 - 2200 of NM_000128.4.In some cases, the starting point of the target region falls between positions 2201 - 2210, 2211 - 2220, 2221 - 2230, 2231 - 2240, 2241 - 2250, 2251 - 2260, 2261 - 2270, 2271 - 2280, 2281 - 2290, or 2291 - 2300 of NM_000128.4. In some cases, the starting point of the target region falls between positions 2301 - 2310, 2311 - 2320, 2321 - 2330, 2331 - 2340, 2341 - 2350, 2351 - 2360, 2361 - 2370, 2371 - 2380, 2381 - 2390, or 2391 - 2400 of NM_000128.4. In some cases, the starting point of the target region falls between positions 2401 - 2410, 2411 - 2420, 2421 - 2430, 2431 - 2440, 2441 - 2450, 2451 - 2460, 2461 - 2470, 2471 - 2480, 2481 - 2490, or 2491 - 2500 of NM_000128.4. In some cases, the starting point of the target region falls between positions 2501 - 2510, 2511 - 2520, 2521 - 2530, 2531 - 2540, 2541 - 2550, 2551 - 2560, 2561 - 2570, 2571 - 2580, 2581 - 2590, or 2591 - 2600 of NM_000128.4. In some cases, the starting point of the target region falls between positions 2601 - 2610, 2611 - 2620, 2621 - 2630, 2631 - 2640, 2641 - 2650, 2651 - 2660, 2661 - 2670, 2671 - 2680, 2681 - 2690, or 2691 - 2700 of NM_000128.4. In some cases, the starting point of the target region falls between positions 2701 - 2710, 2711 - 2720, 2721 - 2730, 2731 - 2740, 2741 - 2750, 2751 - 2760, 2761 - 2770, 2771 - 2780, 2781 - 2790, or 2791 - 2800 of NM_000128.4. In some cases, the starting point of the target region falls between positions 2801 - 2810, 2811 - 2820, 2821 - 2830, 2831 - 2840, 2841 - 2850, 2851 - 2860, 2861 - 2870, 2871 - 2880, 2881 - 2890, or 2891 - 2900 of NM_000128.4.In some cases, the starting point of the target region falls between positions 2901 - 2910, 2911 - 2920, 2921 - 2930, 2931 - 2940, 2941 - 2950, 2951 - 2960, 2961 - 2970, 2971 - 2980, 2981 - 2990 or 2991 - 3000 of NM_000128.4. In some cases, the starting point of the target region falls between positions 3001 - 3010, 3011 - 3020, 3021 - 3030, 3031 - 3040, 3041 - 3050 or 3051 - 3053 of NM_000128.4.

[0101] Structure of the polynucleic acid molecule

[0102] Single-stranded nucleic acid molecule

[0103] The present disclosure describes a polynucleic acid molecule for regulating the expression of the FXI gene, wherein the polynucleic acid molecule comprises a single-stranded nucleic acid molecule that is reverse complementary to the target region of the FXI mRNA as described above.

[0104] In some aspects, the polynucleic acid molecule described herein is not 100% complementary to the target region of the FXI mRNA. Thus, in some cases, the polynucleic acid molecule described herein is about 95% complementary to the target region of the FXI mRNA. In some cases, the polynucleic acid molecule described herein is about 90% complementary to the target region of the FXI mRNA. In some cases, the polynucleic acid molecule described herein is about 85% complementary to the target region of the FXI mRNA. In some cases, the polynucleic acid molecule described herein is about 80% complementary to the target region of the FXI mRNA. In some cases, the polynucleic acid molecule described herein is about 75% complementary to the target region of the FXI mRNA. In some cases, the polynucleic acid molecule described herein is about 70% complementary to the target region of the FXI mRNA.

[0105] In some aspects, the polynucleic acid molecule described herein comprises the nucleic acid sequences in Tables 1 - 2 and 7 - 9. In some cases, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90% or at least 95% complementary to the sequences in Tables 1 - 2 and 7 - 9. In some cases, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90% or at least 95% complementary to the nucleic acid sequences selected from SEQ ID NO: 101 - 150 and 220. In some cases, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90% or at least 95% complementary to the nucleic acid sequences selected from SEQ ID NO: 104, 106 - 107, 109 - 111, 113 - 114, 135, 150 and 220.

[0106] In some cases, the polynucleic acid molecules described herein comprise nucleic acid sequences that are at least 80%, at least 85%, at least 90% or at least 95% complementary to the sequences in Tables 1-2 and 7-9, excluding overhangs. In some cases, the polynucleic acid molecules described herein comprise nucleic acid sequences that are at least 80%, at least 85%, at least 90% or at least 95% complementary to the nucleic acid sequences selected from SEQ ID NOs: 101-150 and 220, excluding overhangs. In some cases, the polynucleic acid molecules described herein comprise nucleic acid sequences that are at least 80%, at least 85%, at least 90% or at least 95% complementary to the nucleic acid sequences selected from SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150 and 220, excluding overhangs.

[0107] In other aspects, the polynucleic acid molecules described herein comprise nucleic acid sequences that comprise 14 consecutive nucleotides complementary to the sequences in Tables 1-2 and 7-9 and have no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise nucleic acid sequences that comprise 14 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 101-150 and 220 and have no more than 1, 2, 3, or 4 mismatches. In other aspects, the polynucleic acid molecules described herein comprise nucleic acid sequences that comprise 15 consecutive nucleotides complementary to the sequences in Tables 1-2 and 7-9 and have no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise nucleic acid sequences that comprise 15 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 101-150 and 220 and have no more than 1, 2, 3, or 4 mismatches. In other aspects, the polynucleic acid molecules described herein comprise nucleic acid sequences that comprise 16 consecutive nucleotides complementary to the sequences in Tables 1-2 and 7-9 and have no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise nucleic acid sequences that comprise 16 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 101-150 and 220 and have no more than 1, 2, 3, or 4 mismatches. In other aspects, the polynucleic acid molecules described herein comprise nucleic acid sequences that comprise 17 consecutive nucleotides complementary to the sequences in Tables 1-2 and 7-9 and have no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise nucleic acid sequences that comprise 17 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 101-150 and 220 and have no more than 1, 2, 3, or 4 mismatches. In other aspects, the polynucleic acid molecules described herein comprise nucleic acid sequences that comprise 18 consecutive nucleotides complementary to the sequences in Tables 1-2 and 7-9 and have no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise nucleic acid sequences that comprise 18 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 101-150 and 220 and have no more than 1, 2, 3, or 4 mismatches. In other aspects, the polynucleic acid molecules described herein comprise nucleic acid sequences that comprise 19 consecutive nucleotides complementary to the sequences in Tables 1-2 and 7-9 and have no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise nucleic acid sequences that comprise 19 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 101-150 and 220 and have no more than 1, 2, 3, or 4 mismatches. In other aspects, the polynucleic acid molecules described herein comprise nucleic acid sequences that comprise 20 consecutive nucleotides complementary to the sequences in Tables 1-2 and 7-9 and have no more than 1, 2, 3, or 4 mismatches.In some aspects, the polynucleic acid molecules described herein include nucleic acid sequences that include 20 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 101-150 and 220 and have no more than 1, 2, 3, or 4 mismatches. In other aspects, the polynucleic acid molecules described herein include nucleic acid sequences that include 21 consecutive nucleotides complementary to the sequences in Tables 1-2 and 7-9 and have no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein include nucleic acid sequences that include 21 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 101-150 and 220 and have no more than 1, 2, 3, or 4 mismatches. In other aspects, the polynucleic acid molecules described herein include nucleic acid sequences that include 22 consecutive nucleotides complementary to the sequences in Tables 1-2 and 7-9 and have no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein include nucleic acid sequences that include 22 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 101-150 and 220 and have no more than 1, 2, 3, or 4 mismatches.

[0108] In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 14 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 104, 106 - 107, 109 - 111, 113 - 114, 135, 150, and 220 and having no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 15 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 104, 106 - 107, 109 - 111, 113 - 114, 135, 150, and 220 and having no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 16 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 104, 106 - 107, 109 - 111, 113 - 114, 135, 150, and 220 and having no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 17 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 104, 106 - 107, 109 - 111, 113 - 114, 135, 150, and 220 and having no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 18 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 104, 106 - 107, 109 - 111, 113 - 114, 135, 150, and 220 and having no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 19 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 104, 106 - 107, 109 - 111, 113 - 114, 135, 150, and 220 and having no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 20 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 104, 106 - 107, 109 - 111, 113 - 114, 135, 150, and 220 and having no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 21 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 104, 106 - 107, 109 - 111, 113 - 114, 135, 150, and 220 and having no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 22 consecutive nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 104, 106 - 107, 109 - 111, 113 - 114, 135, 150, and 220 and having no more than 1, 2, 3, or 4 mismatches.

[0109] In other aspects, the polynucleic acid molecules described herein comprise nucleic acid sequences that include 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides that are complementary to the sequences in Tables 1-2 and 7-9, have no overhangs, and have no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise nucleic acid sequences that include 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides that are complementary to the nucleic acid sequences of SEQ ID NOs: 101-150 and 220, have no overhangs, and have no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecules described herein comprise nucleic acid sequences that include 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides that are complementary to the nucleic acid sequences of SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, have no overhangs, and have no more than 1, 2, 3, or 4 mismatches.

[0110] In some aspects, the polynucleic acid molecules described herein comprise chains that are at least 10, 11, 12, 13, 14, or 15 nucleotides in length. In some aspects, the polynucleic acid molecules described herein comprise chains that are about 15-40, 16-30, 17-30, 18-30, 18-27, 18-25, 18-23, 19-23, 20-23, or 21-23 nucleotides in length. In some aspects, the polynucleic acid molecules described herein comprise chains that are about 15, 16, 17, 18, 19, 20 nucleotides in length. In some aspects, the polynucleic acid molecules described herein comprise chains that are about 21, 22, 23, 24, 25 nucleotides in length. In some aspects, the polynucleic acid molecules described herein comprise chains that are about 26, 27, 28, 29, 30 nucleotides in length.

[0111] In some aspects, the polynucleic acid molecules described herein comprise single-stranded nucleic acids that are at least 10, 11, 12, 13, 14, or 15 nucleotides in length. In some aspects, the polynucleic acid molecules described herein comprise single-stranded nucleic acids that are about 15-30, 16-30, 17-30, 18-30, 18-27, 18-25, 18-23, 19-23, 20-23, or 21-23 nucleotides in length. In some aspects, the polynucleic acid molecules described herein comprise single-stranded nucleic acids that are about 15, 16, 17, 18, 19, 20 nucleotides in length. In some aspects, the polynucleic acid molecules described herein comprise single-stranded nucleic acids that are about 21, 22, 23, 24, 25 nucleotides in length. In some aspects, the polynucleic acid molecules described herein comprise single-stranded nucleic acids that are about 26, 27, 28, 29, 30 nucleotides in length. In some aspects, the polynucleic acid molecules described herein comprise single-stranded nucleic acids that are about 21 nucleotides in length. In some aspects, the polynucleic acid molecules described herein comprise single-stranded nucleic acids that are about 23 nucleotides in length.

[0112] Double-stranded nucleic acid molecule

[0113] The present invention further describes a polynucleic acid molecule for regulating the expression of the FXI gene, wherein the polynucleic acid molecule is a double-stranded molecule comprising a sense strand and an antisense strand, and the antisense strand is reverse complementary to the target region of the FXI mRNA as described above.

[0114] In some aspects, the antisense strand described herein is 100% complementary to the target region of the FXI mRNA. In other aspects, the antisense strand described herein is not 100% complementary to the target region of the FXI mRNA. Thus, in some cases, the antisense strand described herein is about 95% complementary to the target region of the FXI mRNA. In some aspects, the antisense strand described herein is about 90% complementary to the target region of the FXI mRNA. In some aspects, the antisense strand described herein is about 85% complementary to the target region of the FXI mRNA. In some aspects, the antisense strand described herein is about 80% complementary to the target region of the FXI mRNA. In some aspects, the antisense strand described herein is about 75% complementary to the target region of the FXI mRNA. In some aspects, the antisense strand described herein is about 70% complementary to the target region of the FXI mRNA.

[0115] In some aspects, the polynucleic acid molecules described herein comprise the nucleic acid sequences in Tables 1-2 and 7-9. In other aspects, the polynucleic acid molecules described herein comprise nucleic acid sequences that are at least 80%, at least 85%, at least 90% or at least 95% identical to the sequences in Tables 1-2 and 7-9. In some cases, the sense strand described herein comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90% or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 101-150 and 220. In some cases, the antisense strand described herein comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90% or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 1-50 and 215-216. In some cases, the sense strand described herein comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90% or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150 and 220. In some cases, the antisense strand described herein comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90% or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50 and 215-216.

[0116] In other aspects, the polynucleic acid molecules described herein comprise nucleic acid sequences that comprise 14 contiguous sequences from the sequences in Tables 1-2 and 7-9 and have no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strands described herein comprise nucleic acid sequences that comprise 14 contiguous sequences from SEQ ID NOs: 101-150 and 220 and have no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strands described herein comprise nucleic acid sequences that comprise 14 contiguous sequences from SEQ ID NOs: 1-50 and 215-216 and have no more than 1, 2, 3, or 4 mismatches. In other aspects, the polynucleic acid molecules described herein comprise nucleic acid sequences that comprise 15 contiguous sequences from the sequences in Tables 1-2 and 7-9 and have no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strands described herein comprise nucleic acid sequences that comprise 15 contiguous sequences from SEQ ID NOs: 101-150 and 220 and have no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strands described herein comprise nucleic acid sequences that comprise 15 contiguous sequences from SEQ ID NOs: 1-50 and 215-216 and have no more than 1, 2, 3, or 4 mismatches. In yet other aspects, the polynucleic acid molecules described herein comprise nucleic acid sequences that comprise 16 contiguous sequences from the sequences in Tables 1-2 and 7-9 and have no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strands described herein comprise nucleic acid sequences that comprise 16 contiguous sequences from SEQ ID NOs: 101-150 and 220 and have no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strands described herein comprise nucleic acid sequences that comprise 16 contiguous sequences from SEQ ID NOs: 1-50 and 215-216 and have no more than 1, 2, 3, or 4 mismatches. In yet other aspects, the polynucleic acid molecules described herein comprise nucleic acid sequences that comprise 17 contiguous sequences from the sequences in Tables 1-2 and 7-9 and have no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strands described herein comprise nucleic acid sequences that comprise 17 contiguous sequences from SEQ ID NOs: 101-150 and 220 and have no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strands described herein comprise nucleic acid sequences that comprise 17 contiguous sequences from SEQ ID NOs: 1-50 and 215-216 and have no more than 1, 2, 3, or 4 mismatches. In other aspects, the polynucleic acid molecules described herein comprise nucleic acid sequences that comprise 18 contiguous sequences from the sequences in Tables 1-2 and 7-9 and have no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strands described herein comprise nucleic acid sequences that comprise 18 contiguous sequences from SEQ ID NOs: 101-150 and 220 and have no more than 1, 2, 3, or 4 mismatches.In some aspects, the antisense strands described herein comprise nucleic acid sequences that contain 18 contiguous sequences encompassing SEQ ID NOs: 1-50 and 215-216 and have no more than 1, 2, 3, or 4 mismatches. In other aspects, the polynucleotide molecules described herein comprise nucleic acid sequences that contain 19 contiguous sequences from the sequences in Tables 1-2 and 7-9 and have no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strands described herein comprise nucleic acid sequences that contain 19 contiguous sequences encompassing SEQ ID NOs: 101-150 and 220 and have no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strands described herein comprise nucleic acid sequences that contain 19 contiguous sequences encompassing SEQ ID NOs: 1-50 and 215-216 and have no more than 1, 2, 3, or 4 mismatches. In other aspects, the polynucleotide molecules described herein comprise nucleic acid sequences that contain 20 contiguous sequences from the sequences in Tables 1-2 and 7-9 and have no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strands described herein comprise nucleic acid sequences that contain 20 contiguous sequences encompassing SEQ ID NOs: 101-150 and 220 and have no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strands described herein comprise nucleic acid sequences that contain 20 contiguous sequences encompassing SEQ ID NOs: 1-50 and 215-216 and have no more than 1, 2, 3, or 4 mismatches. In other aspects, the polynucleotide molecules described herein comprise nucleic acid sequences that contain 21 contiguous sequences from the sequences in Tables 1-2 and 7-9 and have no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strands described herein comprise nucleic acid sequences that contain 21 contiguous sequences encompassing SEQ ID NOs: 101-150 and 220 and have no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strands described herein comprise nucleic acid sequences that contain 21 contiguous sequences encompassing SEQ ID NOs: 1-50 and 215-216 and have no more than 1, 2, 3, or 4 mismatches. In other aspects, the polynucleotide molecules described herein comprise nucleic acid sequences that contain 22 contiguous sequences from the sequences in Tables 1-2 and 7-9 and have no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strands described herein comprise nucleic acid sequences that contain 22 contiguous sequences encompassing SEQ ID NOs: 101-150 and 220 and have no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strands described herein comprise nucleic acid sequences that contain 22 contiguous sequences encompassing SEQ ID NOs: 1-50 and 215-216 and have no more than 1, 2, 3, or 4 mismatches.

[0117] In some aspects, the sense strand described herein comprises a nucleic acid sequence having 15 consecutive sequences comprising SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220 and having no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strand described herein comprises a nucleic acid sequence having 15 consecutive sequences comprising SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216 and having no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strand described herein comprises a nucleic acid sequence having 16 consecutive sequences comprising SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220 and having no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strand described herein comprises a nucleic acid sequence having 16 consecutive sequences comprising SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216 and having no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strand described herein comprises a nucleic acid sequence having 17 consecutive sequences comprising SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220 and having no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strand described herein comprises a nucleic acid sequence having 17 consecutive sequences comprising SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216 and having no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strand described herein comprises a nucleic acid sequence having 18 consecutive sequences comprising SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220 and having no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strand described herein comprises a nucleic acid sequence having 18 consecutive sequences comprising SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216 and having no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strand described herein comprises a nucleic acid sequence having 19 consecutive sequences comprising SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220 and having no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strand described herein comprises a nucleic acid sequence having 19 consecutive sequences comprising SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216 and having no more than 1, 2, 3, or 4 mismatches.In some aspects, the sense strand described herein comprises a nucleic acid sequence having 20 contiguous sequences comprising SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220 and having no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strand described herein comprises a nucleic acid sequence having 20 contiguous sequences comprising SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216 and having no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strand described herein comprises a nucleic acid sequence having 21 contiguous sequences comprising SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220 and having no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strand described herein comprises a nucleic acid sequence having 21 contiguous sequences comprising SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216 and having no more than 1, 2, 3, or 4 mismatches. In some aspects, the sense strand described herein comprises a nucleic acid sequence having 22 contiguous sequences comprising SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220 and having no more than 1, 2, 3, or 4 mismatches. In some aspects, the antisense strand described herein comprises a nucleic acid sequence having 22 contiguous sequences comprising SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216 and having no more than 1, 2, 3, or 4 mismatches.

[0118] In some aspects, the polynucleic acid molecules described herein comprise sense and antisense strands that are at least 10, 11, 12, 13, 14, or 15 nucleotides in length. In some aspects, the polynucleic acid molecules described herein comprise sense and antisense strands that are about 15-30, 16-30, 17-30, 18-30, 18-27, 18-25, 18-23, 19-23, 20-23, or 21-23 nucleotides in length. In some aspects, the polynucleic acid molecules described herein comprise sense and antisense strands that are about 15, 16, 17, 18, 19, 20 nucleotides in length. In some aspects, the polynucleic acid molecules described herein comprise sense and antisense strands that are about 21, 22, 23, 24, 25 nucleotides in length. In some aspects, the polynucleic acid molecules described herein comprise sense and antisense strands that are about 26, 27, 28, 29, 30 nucleotides in length. In some aspects, the polynucleic acid molecules described herein comprise a sense strand that is 19 nucleotides in length and an antisense strand that is about 21 nucleotides in length. In some aspects, the polynucleic acid molecules described herein comprise a sense strand that is 21 nucleotides in length and an antisense strand that is about 23 nucleotides in length.

[0119] In some aspects, the sense strand and the antisense strand described herein are reverse complementary to each other and form a duplex having a 3' overhang on the antisense strand. In some aspects, the sense strand and the antisense strand described herein are reverse complementary to each other and form a duplex having a 5' overhang on the antisense strand. In some aspects, the sense strand and the antisense strand described herein are reverse complementary to each other and form a duplex having a 3' overhang on the sense strand. In some aspects, the sense strand and the antisense strand described herein are reverse complementary to each other and form a duplex having a 5' overhang on the sense strand.

[0120] Modification of polynucleic acid molecules

[0121] In some aspects, the present disclosure describes polynucleic acid molecules described herein having modifications. In some aspects, the modifications described herein occur on one or more different structures of the polynucleic acid molecules described herein (e.g., modifications on the sugar ring, backbone, bases). In some aspects, the modifications described herein include substitutions of one or more nucleotides in the polynucleic acid molecules described herein. In some aspects, different percentages of the polynucleic acid molecules described herein contain the modifications described herein. In some aspects, different positions of the polynucleic acid molecules described herein contain the modifications described herein. In some aspects, the modifications described herein include the modification patterns disclosed in WO / 2018 / 035380, which application is incorporated herein by reference in its entirety.

[0122] Type of modification

[0123] In some aspects, the polynucleotide molecules described herein comprise one or more sugar-modified nucleotides. In some aspects, the sugar-modified nucleotide is a 2'-fluoro-modified nucleotide. In some cases, the sugar-modified nucleotide comprises a modification at the 2'-hydroxyl of the ribose moiety. In some cases, the sugar-modified nucleotide comprises a modification with H, OR, R, halogen, SH, SR, NH2, NHR, NR2, or CN, where R is an alkyl moiety. In some aspects, the sugar-modified nucleotide is a 2'-O-methyl-modified nucleotide or a 2'-alkoxy-modified nucleotide (e.g., a 2'-methoxy-modified nucleotide). In some cases, the 2'-hydroxyl modification includes 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-O-N-methylacetamido (2'-O-NMA). In some cases, the 2'-hydroxyl of the ribose moiety includes a locked or bridged ribose modification (e.g., LNA), an unlocked ribose modification (e.g., UNA), or an ethylene nucleic acid (ENA). In some cases, the alkyl moiety comprises a hetero substitution. In some cases, the carbon of the heterocyclic group is substituted with nitrogen, oxygen, or sulfur. In some aspects, the sugar-modified nucleotide is a 2'-amino-modified nucleotide. In some aspects, the sugar-modified nucleotide is a 2'-azido-modified nucleotide. In some aspects, the sugar-modified nucleotide is a 2'-deoxy-modified nucleotide. In some aspects, the sugar-modified nucleotide is 2'-O-methoxyethyl (2'-MOE). In some aspects, the sugar-modified nucleotide is a locked nucleic acid (LNA). In some aspects, the sugar-modified nucleotide is an ethylene-bridged nucleic acid (ENA). In some aspects, the sugar-modified nucleotide is an (S)-constrained ethyl (cEt). In some aspects, the sugar-modified nucleotide is a tricyclic DNA (tcDNA). In some aspects, the sugar-modified nucleotide is a 2'-NH2 nucleic acid.

[0124] In some aspects, the polynucleotide molecules described herein comprise one or more sugar-phosphate-modified nucleotides. In some aspects, the modified sugar-phosphate is a phosphorodiamidate morpholino (PMO). In some aspects, the modified sugar-phosphate is an aminophosphate. In some cases, the heterocyclic substitution includes imidazole and pyrrolidino. In some aspects, the modified sugar-phosphate is a phosphorothioate. In some aspects, the modified sugar-phosphate is a peptide nucleic acid (PNA).

[0125] In some aspects, the polynucleotide molecules described herein include one or more backbone-modified nucleotides. In some aspects, the modified backbone is a methylphosphonate. In some aspects, the modified backbone is a phosphorothioate. In some aspects, the modified backbone is a guanidinopropylaminophosphate. In some aspects, the modified backbone is a methanesulfonyl-amidophosphate (MsPA) bond. In some cases, the modified backbone includes one or more of dithiophosphates, methylphosphonates, 5'-alkylphosphonates, 5'-methylphosphonates, 3'-alkylphosphonates, trifluoroborates, 3'-5' bonds or 2'-5' boranophosphates, and selenophosphates, phosphotriesters, thiocarbonylalkylphosphotriesters, hydrogen phosphonate bonds, alkylphosphonates, alkylthiophosphonates, arylthiophosphonates, selenophosphates, and aminophosphates.

[0126] In some cases, one or more phosphorothioate internucleotide bonds are located at the 5' end of the guide strand. In some cases, two phosphorothioate internucleotide bonds are located between the nucleotides at positions 1, 2, and 3 from the 5' end of the guide strand. In some cases, one or more phosphorothioate internucleotide bonds are located at the 3' end of the guide strand. In some cases, two phosphorothioate internucleotide bonds are located between the nucleotides at positions 1, 2, and 3 from the 3' end of the guide strand. In some cases, two phosphorothioate internucleotide bonds are located between the nucleotides at positions 1, 2, and 3 from the 5' end of the guide strand, and two phosphorothioate internucleotide bonds are located between the nucleotides at positions 1, 2, and 3 from the 3' end of the guide strand. In some cases, the guide strand includes phosphorothioate internucleotide bonds between the nucleotides at positions 1, 2, 3, 4 of the guide strand (between 1 and 2, between 2 and 3, and between 3 and 4) and between the nucleotides at positions 1, 2, and 3 from the 3' end of the guide strand (between 1 and 2 and between 2 and 3).

[0127] In some cases, more phosphorothioate internucleotide bonds are located at the 5' end of the passenger strand. In some cases, two phosphorothioate internucleotide bonds are located between the nucleotides at positions 1, 2, and 3 from the 5' end of the passenger strand. In some cases, two phosphorothioate internucleotide bonds are located between the nucleotides at positions 1, 2, and 3 from the 5' end of the passenger strand, and two phosphorothioate internucleotide bonds are located between the nucleotides at positions 1, 2, and 3 from the 5' end of the guide strand, and two phosphorothioate internucleotide bonds are located between the nucleotides at positions 1, 2, and 3 from the 3' end of the guide strand.

[0128] In some cases, one or more phosphorothioate internucleotide linkages are located in the seed region of the guide strand. In some cases, the guide strand contains a phosphorothioate internucleotide linkage between nucleotides at positions 5 and 6 counting from the 5' end of the guide strand. In some cases, the guide strand contains a phosphorothioate internucleotide linkage between nucleotides 6 and 7 counting from the 3' end of the guide strand. In some cases, the guide strand contains a phosphorothioate internucleotide linkage between nucleotides 9 and 10 counting from the 3' end of the guide strand. In some cases, the guide strand contains a phosphorothioate internucleotide linkage between nucleotides at positions 5 and 6 counting from the 5' end of the guide strand and between nucleotides 6 and 7 counting from the 3' end of the guide strand. In some cases, the guide strand contains a phosphorothioate internucleotide linkage between nucleotides at positions 5 and 6 counting from the 5' end of the guide strand and between nucleotides 9 and 10 counting from the 3' end of the guide strand. In some cases, the guide strand contains a phosphorothioate internucleotide linkage between nucleotides at positions 1, 2, 3 and 5 and 6 counting from the 5' end of the guide strand and between nucleotides 1, 2 and 3 counting from the 3' end of the guide strand. In some cases, the guide strand contains a phosphorothioate internucleotide linkage between nucleotides at positions 1, 2, 3 and 5 and 6 counting from the 5' end of the guide strand and between nucleotides at positions 1, 2, 3 and 9 and 10 counting from the 3' end of the guide strand. In some cases, the guide strand contains a phosphorothioate internucleotide linkage between nucleotides at positions 1, 2, 3 and 5 and 6 counting from the 5' end of the guide strand and between nucleotides at positions 1, 2, 3 and 6 and 7 counting from the 3' end of the guide strand.

[0129] In some aspects, the modified nucleotides include modified guanine (e.g., inosine) or one or more non-natural nucleic acids of any type.

[0130] In some aspects, the modified backbone is a phosphorothioate, and the phosphorothioate is a stereochemically enriched phosphorothioate. In certain aspects, the chain contains at least one stereochemically enriched phosphorothioate. In some aspects, the chain contains at least 1, 2, 3 stereochemically enriched phosphorothioates. In some aspects, the chain contains only 1, 2, 3 or 4 stereochemically enriched phosphorothioates. In a further aspect, at least one (e.g., one or two) stereochemically enriched phosphorothioates are located between two consecutive nucleotides of two of the six 5'-terminal nucleotides of the chain. In a still further aspect, at least one (e.g., one or two) stereochemically enriched phosphorothioates are located between two consecutive nucleotides of two of the six 3'-terminal nucleotides of the chain. In yet a further aspect, one stereochemically enriched phosphorothioate is covalently bonded to the first and second nucleotides from the 5'-end within the chain. In some aspects, one stereochemically enriched phosphorothioate is covalently bonded to the twenty-first and twenty-second nucleotides from the 5'-end within the chain. In certain aspects, one stereochemically enriched phosphorothioate is covalently bonded to the twenty-second and twenty-third nucleotides from the 5'-end within the chain. In a particular aspect, the stereochemically enriched phosphorothioate has an R P stereochemical identity. In certain aspects, the stereochemically enriched phosphorothioate has an S P stereochemical identity.

[0131] In some aspects, the polynucleotide molecules described herein contain one or more (e.g., 1 to 20, 1 to 10, or 1 to 5) stereochemically enriched (e.g., internucleotide) phosphorothioates (e.g., with an enantiomeric excess of at least 10%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the P-stereogenic center, e.g., up to about 99%). The polynucleotide molecules described herein contain one or more (e.g., 1 to 20, 1 to 10, or 1 to 5; e.g., internucleoside) dithiophosphates. The dithiophosphates in the polynucleotide molecules described herein can be non-P-stereogenic. The phosphorothioates and dithiophosphates can enhance the stability of the polynucleotide molecules described herein against serum exonuclease activity. Non-P-stereogenic dithiophosphates can simplify the synthesis of the polynucleotide molecules described herein by reducing the number of possible diastereomers. Generally, the phosphorothioate or dithiophosphate can link two adjacent nucleotides within the six 3'-terminal nucleotides and the six 5'-terminal nucleotides of the polynucleotide molecules described herein. In some aspects, the stereochemically enriched phosphorothioate (e.g., R P-enriched phosphorothioates) can be covalently bonded to the first nucleoside (e.g., the 3'-carbon atom of the first nucleoside) and the second nucleoside (e.g., the 5'-carbon atom of the second nucleoside) of the antisense strand starting from the 5'-end. Additionally or alternatively, stereochemically enriched phosphorothioates (e.g., S P -enriched phosphorothioates) can be covalently bonded to the 21st nucleoside (e.g., the 3'-carbon atom of the 21st nucleoside) and the 22nd nucleoside (e.g., the 5'-carbon atom of the 22nd nucleoside) of the antisense strand starting from the 5'-end. Further, additionally or alternatively, stereochemically enriched phosphorothioates (e.g., S P -enriched phosphorothioates or Rp-enriched phosphorothioates) can be covalently bonded to the 22nd nucleoside (e.g., the 3'-carbon atom of the 22nd nucleoside) and the 23rd nucleoside (e.g., the 5'-carbon atom of the 23rd nucleoside) of the antisense strand starting from the 5'-end.

[0132] 5'R in the antisense strand P -enriched phosphorothioates (e.g., R covalently bonded to the first nucleoside (e.g., the 3'-carbon atom of the first nucleoside) and the second nucleoside (e.g., the 5'-carbon atom of the second nucleoside) starting from the 5'-end P -enriched phosphorothioates) and 3'S P -enriched phosphorothioates (e.g., S covalently bonded to the 21st nucleoside (e.g., the 3'-carbon atom of the 21st nucleoside) and the 22nd nucleoside (e.g., the 5'-carbon atom of the 22nd nucleoside) starting from the 5'-end P -enriched phosphorothioates) combination can produce better efficacy and / or duration of action, e.g., as measured by a decrease in activity against the target relative to a reference guide strand lacking 5'R P -enriched phosphorothioates and 3'S P -enriched phosphorothioates or a combination of 5'Rp-enriched phosphorothioates and 3'Sp and Rp-enriched phosphorothioates. In some cases, stereochemically enriched phosphorothioates can contain R p R p S p S p (R p R p Located at positions 1 and 2 of the guide strand, and S p S p Located at positions 21 and 22 of the guide strand) or R p R p S p R p (R p R p Located at positions 1 and 2 of the guide strand, and S p R pat positions 21 and 22 of the guide strand). In some aspects, the polynucleotide molecules described herein comprise four stereochemically enriched phosphorothioates: (1) an Rp-enriched phosphorothioate covalently bonded to the 1st nucleoside (e.g., the 3'-carbon atom of the 1st nucleoside) and the 2nd nucleoside (e.g., the 5'-carbon atom of the 2nd nucleoside) from the 5'-end of the antisense strand; (2) an Rp-enriched phosphorothioate covalently bonded to the 2nd nucleoside (e.g., the 3'-carbon atom of the 2nd nucleoside) and the 3rd nucleoside (e.g., the 5'-carbon atom of the 3rd nucleoside) from the 5'-end of the antisense strand; (3) an Sp-enriched phosphorothioate covalently bonded to the 21st nucleoside (e.g., the 3'-carbon atom of the 21st nucleoside) and the 22nd nucleoside (e.g., the 5'-carbon atom of the 22nd nucleoside) from the 5'-end of the antisense strand; and (4) an Sp-enriched phosphorothioate covalently bonded to the 22nd nucleoside (e.g., the 3'-carbon atom of the 22nd nucleoside) and the 23rd nucleoside (e.g., the 5'-carbon atom of the 23rd nucleoside) from the 5'-end of the antisense strand. In some aspects, the polynucleotide molecules described herein comprise four stereochemically enriched phosphorothioates: (1) an Rp-enriched phosphorothioate covalently bonded to the 1st nucleoside (e.g., the 3'-carbon atom of the 1st nucleoside) and the 2nd nucleoside (e.g., the 5'-carbon atom of the 2nd nucleoside) from the 5'-end of the antisense strand; (2) an Rp-enriched phosphorothioate covalently bonded to the 2nd nucleoside (e.g., the 3'-carbon atom of the 2nd nucleoside) and the 3rd nucleoside (e.g., the 5'-carbon atom of the 3rd nucleoside) from the 5'-end of the antisense strand; (3) an Sp-enriched phosphorothioate covalently bonded to the 21st nucleoside (e.g., the 3'-carbon atom of the 21st nucleoside) and the 22nd nucleoside (e.g., the 5'-carbon atom of the 22nd nucleoside) from the 5'-end of the antisense strand; and (4) an Rp-enriched phosphorothioate covalently bonded to the 22nd nucleoside (e.g., the 3'-carbon atom of the 22nd nucleoside) and the 23rd nucleoside (e.g., the 5'-carbon atom of the 23rd nucleoside) from the 5'-end of the antisense strand.

[0133] In some aspects, the stereochemically enriched phosphorothioate internucleotide bonds in the polynucleic acid comprise R p R p S p (R p R p at positions 1 and 2 of the guide strand, and S p at position 21 of the guide strand) or R p R p R p S p (R p R p at positions 1, 2, 3 of the guide strand, and S p at position 21 of the guide strand).

[0134] In some aspects, the polynucleotide molecules described herein contain one or more purine modifications. In some aspects, the purine modification described herein is 2,6-diaminopurine. In some aspects, the purine modification described herein is 3-deaza-adenine. In some aspects, the purine modification described herein is 7-deaza-guanine. In some aspects, the purine modification described herein is 8-azido-adenine.

[0135] In some aspects, the polynucleotide molecules described herein contain one or more pyrimidine modifications. In some aspects, the pyrimidine modification described herein is 2-thio-thymidine. In some aspects, the pyrimidine modification described herein is 5-formamido-uracil. In some aspects, the pyrimidine modification described herein is 5-methyl-cytosine. In some aspects, the pyrimidine modification described herein is 5-ethynyluracil.

[0136] In some cases, the polynucleic acid molecules described herein contain abasic substitutions. In those cases where hybridized polynucleotide constructs are contemplated for use as siRNAs, it is desirable to reduce miRNA-like off-target effects. Because abasic substitutions lack nucleobases capable of participating in base-pairing interactions and relieve steric hindrance, including one or more (e.g., one or two) abasic substitutions in a hybridized polynucleotide construct can reduce or even eliminate miRNA-like off-target effects. Accordingly, the polynucleotide molecules disclosed herein can include one or more (e.g., one or two) abasic substitutions. In some aspects, the abasic substitution is located at the 5th nucleotide from the 5' end of the antisense strand described herein. In some aspects, the abasic substitution is located at the 7th nucleotide from the 5' end of the antisense strand described herein.

[0137] When the polynucleotide molecules disclosed herein include two or more abasic substitutions, their structures can be the same or different. In certain aspects, the sense strand contains one abasic substitution (e.g., the antisense strand can be devoid of abasic substitutions). In other aspects, the antisense strand contains one abasic substitution (e.g., the sense strand can be devoid of abasic substitutions). In still other aspects, the antisense strand contains one abasic substitution and the sense strand contains one abasic substitution. In further aspects, the sense strand includes an abasic substitution between nucleoside number (x) and nucleoside number (x + 1), where x is an integer from 2 to 7. In still further aspects, the antisense strand includes an abasic substitution between nucleoside number (x) and nucleoside number (x + 1), where x is an integer from 2 to 7.

[0138] The abasic substitution can be of formula (III):

[0139]

[0140] where

[0141] L is a sugar analog, or is substituted with a heteroacyl group from A, U, C, G, or is any other substituted nucleic acid (e.g., locked nucleic acid or unlocked nucleic acid, glycol nucleic acid, etc.);

[0142] Each X 4 is independently O or S;

[0143] Each X 5 is independently O, S, NH, or a bond;

[0144] Each R 9 is independently H, optionally substituted C 1-6 alkyl, optionally substituted C 2-6 alkenyl, optionally substituted C 2-6 alkynyl, optionally substituted (C 1-9 heterocyclyl)-C 1-6 -alkyl, optionally substituted (C 6-10 aryl)-C 1-6 -alkyl, optionally substituted (C 3-8 cycloalkyl)-C 1-6 -alkyl, -LinkA(-T) p or a conjugating moiety;

[0145] Each LinkA is independently a polyvalent linker (e.g., including -C(O)-N(H)-);

[0146] Each T is independently an auxiliary moiety;

[0147] R 10 is a bond to the 3'-carbon atom of the nucleoside (x) in the chain;

[0148] R 11 is a bond to the 5'-oxygen atom of the nucleoside (x + 1) in the chain;

[0149] p is an integer from 1 to 6; and

[0150] t is an integer from 1 to 6.

[0151] In some aspects, the abasic substitutions described herein are attached to the antisense strand of the polynucleic acid molecules described herein. In certain aspects, the antisense strands described herein (e.g., within the seed region of the guide strand) can include abasic substitutions (e.g., the internucleoside abasic spacer of formula (III) where t is 1). In some aspects, the abasic substitution (e.g., the internucleoside abasic spacer of formula (III) where t is 1) can be bonded to the 3'-carbon atom of the second, third, fourth, or fifth nucleoside from the 5'-end of the antisense strand described herein. In certain aspects, the abasic substitution (e.g., the internucleoside abasic spacer of formula (III) where t is 1) can be bonded to the 3'-carbon atom of the thirteenth, fourteenth, fifteenth, or sixteenth nucleoside from the 5'-end of the antisense strand described herein. In some aspects, there are abasic substitutions at the fourth, fifth, sixth, seventh, eighth, and / or ninth nucleosides from the 5'-end of the antisense strand described herein.

[0152] The polynucleotide molecules described herein can contain a strand that includes a seed region that includes a nucleoside containing a hypoxanthine nucleobase (e.g., inosine).

[0153] In certain aspects, the nucleoside containing a hypoxanthine nucleobase is the second nucleoside from the 5'-end of the strand. In a further aspect, the nucleoside containing a hypoxanthine nucleobase is the third nucleoside from the 5'-end of the strand. In a still further aspect, the nucleoside containing a hypoxanthine nucleobase is the fourth nucleoside from the 5'-end of the strand. In yet a further aspect, the nucleoside containing a hypoxanthine nucleobase is the fifth nucleoside from the 5'-end of the strand. In certain aspects, the nucleoside containing a hypoxanthine nucleobase is the sixth nucleoside of the strand. In certain aspects, the nucleoside containing a hypoxanthine nucleobase is the seventh nucleoside of the strand.

[0154] In some aspects, the polynucleotide molecules described herein contain at least one inosine substitution. In some cases, at least one inosine substitution is within the seed region of the antisense strand. In some cases, at least one inosine substitution is within 7 nucleotides from the 5'-end of the antisense strand. In some cases, at least one inosine substitution is in the first nucleotide from the 5'-end of the antisense strand (e.g., SRS-002331). In some cases, at least one inosine substitution includes 2'-O-methylinosine-3'-phosphate.

[0155] In some aspects, the polynucleotide molecules described herein comprise a sense strand and an antisense strand, and the first nucleotide of the antisense strand starting from the 5'-end is replaced by uridine, and the last nucleotide of the sense strand starting from the 3'-end is replaced by adenosine (e.g., SRS-002376). In some cases, the uridine and / or adenosine are modified. In some cases, the uridine comprises 2'-O-methyluridine-3'-phosphate, and the adenosine comprises 2'-O-methyladenosine-3'-phosphate. In some cases, the uridine comprises 2'-O-methyluridine-3'-phosphate, or the adenosine comprises 2'-O-methyladenosine-3'-phosphate.

[0156] In some aspects, the first nucleotide of the antisense strand of the polynucleotide molecules described herein starting from the 5'-end is replaced by adenosine. In some cases, the adenosine is a modified adenosine. In some cases, the adenosine comprises 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0157] Amount and location of modification

[0158] In some aspects, the polynucleotide molecules described herein comprise one or more types of modifications as described above. Thus, in some aspects, about 10% of the nucleotides from the polynucleotide molecules described herein are modified by one or more types of the above-described modifications. In other aspects, about 20% of the nucleotides from the polynucleotide molecules described herein are modified by one or more types of the above-described modifications. In other aspects, about 30% of the nucleotides from the polynucleotide molecules described herein are modified by one or more types of the above-described modifications. In other aspects, about 40% of the nucleotides from the polynucleotide molecules described herein are modified by one or more types of the above-described modifications. In other aspects, about 50% of the nucleotides from the polynucleotide molecules described herein are modified by one or more types of the above-described modifications. In other aspects, about 60% of the nucleotides from the polynucleotide molecules described herein are modified by one or more types of the above-described modifications. In other aspects, about 70% of the nucleotides from the polynucleotide molecules described herein are modified by one or more types of the above-described modifications. In other aspects, about 80% of the nucleotides from the polynucleotide molecules described herein are modified by one or more types of the above-described modifications. In other aspects, about 90% of the nucleotides from the polynucleotide molecules described herein are modified by one or more types of the above-described modifications. In other aspects, 100% of the nucleotides from the polynucleotide molecules described herein are modified by one or more types of the above-described modifications.

[0159] In some aspects, one or more types of modifications described herein occur at different positions within the polynucleotide molecules described herein. In some aspects, one or more types of modifications described herein occur in the seed region within the polynucleotide molecules described herein. In some aspects, one or more types of modifications described herein occur at the 3' end of the polynucleotide molecules described herein. In some aspects, one or more types of modifications described herein occur at the 5' end of the polynucleotide molecules described herein. In some aspects, one or more types of modifications described herein occur dispersedly within the polynucleotide molecules described herein. In some aspects, one or more types of modifications described herein occur in clusters within the polynucleotide molecules described herein.

[0160] Specific modification patterns

[0161] In some aspects, the present disclosure describes specific modification patterns of a polynucleic acid molecule that is a double-stranded nucleic acid molecule comprising a sense strand and an antisense strand. In some aspects, the antisense strand comprises a 2'-fluoro-modified nucleotide at position 2 from the 5' end. In some aspects, the antisense strand comprises a 2'-fluoro-modified nucleotide at position 14 from the 5' end. In some aspects, the antisense strand comprises 2'-fluoro-modified nucleotides at positions 2 and 14 from the 5' end. In some aspects, the antisense strand comprises a 2'-fluoro-modified nucleotide at position 12 from the 5' end. In some aspects, the antisense strand comprises a 2'-fluoro-modified nucleotide at position 16 from the 5' end. In other aspects, the antisense strand comprises a 2'-fluoro-modified nucleotide at position 6 from the 5' end. In other aspects, the antisense strand comprises a 2'-fluoro-modified nucleotide at position 7 from the 5' end. In other aspects, the antisense strand comprises a 2'-fluoro-modified nucleotide at position 8 from the 5' end. In other aspects, the antisense strand comprises a 2'-fluoro-modified nucleotide at position 9 from the 5' end. In other aspects, the antisense strand comprises a 2'-fluoro-modified nucleotide at position 4 from the 5' end.

[0162] In some aspects, the present disclosure describes a specific modification pattern of a polynucleic acid molecule, which is a double-stranded nucleic acid molecule comprising a sense strand and an antisense strand. In some aspects, the sense strand comprises a 2'-fluoro-modified nucleotide at position 9 counting from the 5' end. In some aspects, the sense strand comprises a 2'-fluoro-modified nucleotide at position 11 counting from the 5' end. In some aspects, the sense strand comprises 2'-fluoro-modified nucleotides at positions 9 and 11 counting from the 5' end. In some aspects, the sense strand comprises a 2'-fluoro-modified nucleotide at position 7 counting from the 5' end. In some aspects, the sense strand comprises a 2'-fluoro-modified nucleotide at position 10 counting from the 5' end. In some aspects, the sense strand comprises 2'-fluoro-modified nucleotides at positions 9, 11 and 7 counting from the 5' end. The sense strand comprises 2'-fluoro-modified nucleotides at positions 9, 11 and 10 counting from the 5' end. The sense strand comprises 2'-fluoro-modified nucleotides at positions 9 and 7 counting from the 5' end. The sense strand comprises 2'-fluoro-modified nucleotides at positions 9 and 10 counting from the 5' end. The sense strand comprises 2'-fluoro-modified nucleotides at positions 9, 11, 7 and 10 counting from the 5' end. In other aspects, the sense strand comprises a 2'-fluoro-modified nucleotide at position 8 counting from the 5' end. In other aspects, the sense strand comprises a 2'-fluoro-modified nucleotide at position 12 counting from the 5' end. In other aspects, the sense strand comprises a 2'-fluoro-modified nucleotide at position 16 counting from the 5' end.

[0163] In some aspects, the sense strand and the antisense strand of the polynucleic acid molecule comprise any combination of two or more 2'-fluoro-modified nucleotides at the positions described in the above two paragraphs.

[0164] In some aspects, the antisense strand comprises 5'-nNfnnnNfnNfNfnnnnNfnNfnnnnnnn-3'. In some aspects, the antisense strand comprises 5'-nNfnnnNfnnnnnnnNfnNfnnnnnnn-3'. In some aspects, the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnnnnnnnnn-3'. In the above modification pattern, "Nf" represents a 2'-fluoro-modified nucleotide, and "n" represents a 2'-O-methyl-modified nucleotide.

[0165] In some aspects, the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3'. In some aspects, the sense strand comprises 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3'. In some aspects, the sense strand comprises 5'-nnnnnnnnNfNfNfnnnnnnnnnn-3'. In the above modification patterns, "Nf" represents a 2'-fluoro-modified nucleotide, and "n" represents a 2'-O-methyl-modified nucleotide.

[0166] In some aspects, a specific modification pattern of a polynucleic acid molecule is described herein, the polynucleic acid molecule being a double-stranded nucleic acid molecule comprising a sense strand and an antisense strand, wherein the sense strand comprises approximately twelve 2'-fluoro-modified nucleotides and approximately nine 2'-O-methyl-modified nucleotides, and wherein the antisense strand comprises approximately nine 2'-fluoro-modified nucleotides and approximately fourteen 2'-O-methyl-modified nucleotides.

[0167] In some aspects, a specific modification pattern is described herein, wherein the sense strand is fully modified and comprises twelve 2'-fluoro-modified nucleotides, nine 2'-O-methyl-modified nucleotides, and wherein the antisense strand is fully modified and comprises nine 2'-fluoro-modified nucleotides and fourteen 2'-O-methyl-modified nucleotides.

[0168] In some aspects, a specific modification pattern is described herein, wherein the sense strand comprises 5'-NfnNfnNfnNfnNfNfNfnNfnNfnNfnNfnNf-3', wherein the antisense strand comprises 5'-nNfnNfnNfnNfnNfnnnNfnNfnNfnNfnnn-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and "n" represents a 2'-O-methyl-modified nucleotide.

[0169] In some aspects, the present disclosure describes a specific modification pattern, wherein the sense strand comprises 5'-NfnNfnNfnNfnNfNfNfnNfnNfnNfnNfnNf-3', wherein the antisense strand comprises 5'-nNfnNfnNfnNfnNfnnnNfnNfnNfnNfnnn-3', wherein the sense strand and / or the antisense strand comprises one or more phosphorothioate bonds, wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide. In other aspects, the present disclosure describes a specific modification pattern, wherein the sense strand comprises 5'-NfnNfnNfnNfnNfNfNfnNfnNfnNfnNfnNf-3', wherein the antisense strand comprises 5'-nNfnNfnNfnNfnNfnnnNfnNfnNfnNfnnn-3', wherein the sense strand comprises two phosphorothioate bonds, wherein the antisense strand comprises four phosphorothioate bonds, wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0170] In some aspects, the present disclosure describes a specific modification pattern, wherein the sense strand and / or the antisense strand is modified to type I in Table 11.

[0171] Table 11. Nucleotide Modification Patterns

[0172]

[0173] Note: "Nf" represents a 2'-fluoro-modified nucleotide, "n" represents a 2'-O-methyl-modified nucleotide, "s" represents a 3'-phosphorothioate, and "invdN" represents an inverted deoxynucleotide.

[0174] In some aspects, the polynucleotide molecules provided herein comprise a sense strand comprising the nucleic acid sequences of SEQ ID NOs: 101-150 and 220, and an antisense strand comprising the nucleic acid sequences of SEQ ID NOs: 1-50 and 215-216. In other aspects, the polynucleotide molecules provided herein comprise a sense strand comprising the nucleic acid sequences of SEQ ID NOs: 101-150 and 220, and an antisense strand comprising the nucleic acid sequences of SEQ ID NOs: 1-50 and 215-216, and wherein the sense strand and / or the antisense strand are modified in a type I modification pattern as specified in Table 11. In some aspects, the polynucleotide molecules provided herein comprise a sense strand comprising the nucleic acid sequences of SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150 and 220, and an antisense strand comprising the nucleic acid sequences of SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50 and 215-216. In other aspects, the polynucleotide molecules provided herein comprise a sense strand comprising the nucleic acid sequences of SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150 and 220, an antisense strand comprising the nucleic acid sequences of SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50 and 215-216, and wherein the sense strand and / or the antisense strand are modified in a type I modification pattern as specified in Table 11.

[0175] In some aspects, the present disclosure describes a specific modification pattern, wherein the sense strand comprises approximately four 2'-fluoro-modified nucleotides and approximately seventeen 2'-O-methyl-modified nucleotides, and wherein the antisense strand comprises approximately six 2'-fluoro-modified nucleotides and approximately seventeen 2'-O-methyl-modified nucleotides.

[0176] In some aspects, the present disclosure describes a specific modification pattern, wherein the sense strand is fully modified and comprises four 2'-fluoro-modified nucleotides and seventeen 2'-O-methyl-modified nucleotides, and wherein the antisense strand is fully modified and comprises six 2'-fluoro-modified nucleotides and seventeen 2'-O-methyl-modified nucleotides.

[0177] In some aspects, the present disclosure describes a specific modification pattern, wherein the sense strand comprises 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnNfnNfNfnnnnNfnNfnnnnnnn–3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0178] In some aspects, the present disclosure describes a specific modification pattern, wherein the sense strand comprises 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnNfnNfNfnnnnNfnNfnnnnnnn–3', wherein the sense strand and / or the antisense strand comprises one or more phosphorothioate bonds, wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide. In other aspects, the present disclosure describes a specific modification pattern, wherein the sense strand comprises 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnNfnNfNfnnnnNfnNfnnnnnnn–3', wherein the sense strand comprises two phosphorothioate bonds, wherein the antisense strand comprises four phosphorothioate bonds, wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0179] In some aspects, the present disclosure describes a specific modification pattern, wherein the sense strand and / or the antisense strand is modified to Type II in Table 11.

[0180] In some aspects, the polynucleotide molecule provided herein comprises a sense strand comprising a nucleic acid sequence comprising SEQ ID NOs: 101-150 and 220 and / or an antisense strand comprising a nucleic acid sequence comprising SEQ ID NOs: 1-50 and 215-216, and wherein the sense strand and / or the antisense strand is modified in the Type II modification pattern specified in Table 11. In other aspects, the polynucleotide molecule provided herein comprises a sense strand comprising a nucleic acid sequence comprising SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150 and 220 and / or an antisense strand comprising a nucleic acid sequence comprising SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50 and 215-216, and wherein the sense strand and / or the antisense strand is modified in the Type II modification pattern specified in Table 11.

[0181] In some aspects, the present disclosure describes a specific modification pattern, wherein the sense strand comprises approximately two 2'-fluoro-modified nucleotides and approximately nineteen 2'-O-methyl-modified nucleotides, and wherein the antisense strand comprises approximately three 2'-fluoro-modified nucleotides and approximately twenty 2'-O-methyl-modified nucleotides.

[0182] In some aspects, the present disclosure describes a specific modification pattern, wherein the sense strand is fully modified and comprises two 2'-fluoro-modified nucleotides and nineteen 2'-O-methyl-modified nucleotides, and wherein the antisense strand is fully modified and comprises three 2'-fluoro-modified nucleotides and twenty 2'-O-methyl-modified nucleotides.

[0183] In some aspects, the present disclosure describes a specific modification pattern, wherein the sense strand comprises 5'-nnnnnnnnNfnNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnnnnnnnnn-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0184] In some aspects, the present disclosure describes a specific modification pattern, wherein the sense strand comprises 5'-nnnnnnnnNfnNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnnnnnnnnn-3', wherein the sense strand and / or the antisense strand comprises one or more phosphorothioate bonds, wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide. In other aspects, the present disclosure describes a specific modification pattern, wherein the sense strand comprises 5'-nnnnnnnnNfnNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnnnnnnnnn-3', wherein the sense strand comprises two phosphorothioate bonds and the antisense strand comprises four phosphorothioate bonds, wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0185] In some aspects, the present disclosure describes a specific modification pattern, wherein the sense strand and / or the antisense strand is modified to Type III in Table 11.

[0186] In some aspects, the polynucleotide molecule provided herein comprises a sense strand comprising a nucleic acid sequence of SEQ ID NO: 101-150 and 220 and / or an antisense strand comprising a nucleic acid sequence of SEQ ID NO: 1-50 and 215-216, and wherein the sense strand and / or the antisense strand is modified in the Type III modification pattern specified in Table 11. In other aspects, the polynucleotide molecule provided herein comprises a sense strand comprising a nucleic acid sequence of SEQ ID NO: 104, 106-107, 109-111, 113-114, 135, 150 and 220 and / or an antisense strand comprising a nucleic acid sequence of SEQ ID NO: 4, 6-7, 9-11, 13-14, 35, 50 and 215-216, and wherein the sense strand and / or the antisense strand is modified in the Type III modification pattern specified in Table 11.

[0187] In some aspects, the present disclosure describes a specific modification pattern, wherein the sense strand comprises approximately three 2'-fluoro-modified nucleotides and approximately eighteen 2'-O-methyl-modified nucleotides, and wherein the antisense strand comprises approximately four 2'-fluoro-modified nucleotides and approximately nineteen 2'-O-methyl-modified nucleotides.

[0188] In some aspects, the present disclosure describes a specific modification pattern, wherein the sense strand is fully modified and comprises three 2'-fluoro-modified nucleotides and eighteen 2'-O-methyl-modified nucleotides, and wherein the antisense strand is fully modified and comprises four 2'-fluoro-modified nucleotides and nineteen 2'-O-methyl-modified nucleotides.

[0189] In some aspects, the present disclosure describes a specific modification pattern, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnNfnnnnnnn-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0190] In some aspects, the present disclosure describes a specific modification pattern, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnNfnnnnnnn-3', wherein the sense strand and / or the antisense strand comprises one or more phosphorothioate bonds, wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide. In other aspects, the present disclosure describes a specific modification pattern, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnNfnnnnnnn-3', wherein the sense strand comprises two phosphorothioate bonds and the antisense strand comprises four phosphorothioate bonds, wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0191] In some aspects, the present disclosure describes a specific modification pattern, wherein the sense strand and / or the antisense strand is modified to type IV in Table 11.

[0192] In some aspects, the polynucleotide molecules provided herein comprise a sense strand comprising the nucleic acid sequences of SEQ ID NOs: 101 - 150 and 220 and / or an antisense strand comprising the nucleic acid sequences of SEQ ID NOs: 1 - 50 and 215 - 216, and wherein the sense strand and / or the antisense strand are modified in the type IV modification pattern specified in Table 11. In other aspects, the polynucleotide molecules provided herein comprise a sense strand comprising the nucleic acid sequences of SEQ ID NOs: 104, 106 - 107, 109 - 111, 113 - 114, 135, 150 and 220 and / or an antisense strand comprising the nucleic acid sequences of SEQ ID NOs: 4, 6 - 7, 9 - 11, 13 - 14, 35, 50 and 215 - 216, and wherein the sense strand and / or the antisense strand are modified in the type IV modification pattern specified in Table 11.

[0193] In some aspects, the present disclosure describes a specific modification pattern, wherein the sense strand comprises approximately three 2'-fluoro-modified nucleotides and approximately eighteen 2'-O-methyl-modified nucleotides, and wherein the antisense strand comprises approximately five 2'-fluoro-modified nucleotides and approximately eighteen 2'-O-methyl-modified nucleotides.

[0194] In some aspects, the present disclosure describes a specific modification pattern, wherein the sense strand is fully modified and comprises three 2'-fluoro-modified nucleotides and eighteen 2'-O-methyl-modified nucleotides, and wherein the antisense strand is fully modified and comprises five 2'-fluoro-modified nucleotides and eighteen 2'-O-methyl-modified nucleotides.

[0195] In some aspects, the present disclosure describes a specific modification pattern, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnnn-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0196] In some aspects, the present disclosure describes a specific modification pattern, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnnn-3', wherein the sense strand and / or the antisense strand comprises one or more phosphorothioate bonds, wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide. In other aspects, the present disclosure describes a specific modification pattern, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnnn-3', wherein the sense strand comprises two phosphorothioate bonds, wherein the antisense strand comprises four phosphorothioate bonds, wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0197] In some aspects, the present disclosure describes a specific modification pattern, wherein the sense strand and / or the antisense strand is modified to Type V in Table 11.

[0198] In some aspects, the polynucleotide molecule provided herein comprises a sense strand comprising a nucleic acid sequence comprising SEQ ID NOs: 101-150 and 220 and / or an antisense strand comprising a nucleic acid sequence comprising SEQ ID NOs: 1-50 and 215-216, and wherein the sense strand and / or the antisense strand is modified in the V-type modification pattern specified in Table 11. In other aspects, the polynucleotide molecule provided herein comprises a sense strand comprising a nucleic acid sequence comprising SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150 and 220 and / or an antisense strand comprising a nucleic acid sequence comprising SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50 and 215-216, and wherein the sense strand and / or the antisense strand is modified in the V-type modification pattern specified in Table 11.

[0199] In some aspects, the present disclosure describes a specific modification pattern, wherein the sense strand comprises approximately three 2'-fluoro-modified nucleotides and approximately eighteen 2'-O-methyl-modified nucleotides, and has one or more inverted deoxynucleotides as overhangs at the 3' end.

[0200] In some aspects, the present disclosure describes a specific modification pattern, wherein the sense strand is fully modified and comprises three 2'-fluoro-modified nucleotides and eighteen 2'-O-methyl-modified nucleotides, and has two inverted deoxynucleotides as overhangs at the 3' end.

[0201] In some aspects, the present disclosure describes a specific modification pattern, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-invdN-invdN-3', where "Nf" represents a 2'-fluoro-modified nucleotide, where "n" represents a 2'-O-methyl-modified nucleotide, and "invdN" represents an inverted deoxynucleotide. In some cases, invdN is an inverted deoxythymidine. In some aspects, a linker conjugated to one or more targeting moieties as shown in formula (IV") or (IV"') is added to the first nucleic acid at the 5'-end. In some aspects, a linker conjugated to one or more GalNAc as shown in formula (V") or (V"') is added to the first nucleic acid at the 5'-end. In some aspects, the modification pattern comprises one or more phosphorothioate linkages. In some aspects, the modification pattern is shown in formula (VII). In some aspects, 5'-end modifications known in the art are applied to one or more inverted nucleotides.

[0202] Wherein R is a moiety corresponding to the sugar modification described herein, in some cases, R is -O-methyl; wherein R' is thymine, abasic, etc.; wherein A is -O or -S; and wherein A' is -O or -S.

[0203] In some aspects, the polynucleotide molecules provided herein comprise a sense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 101 - 150 and 220 and / or an antisense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1 - 50 and 215 - 216, and wherein the sense strand is modified in accordance with the type VI modification pattern specified in Table 11 or as described in the previous paragraph. In other aspects, the polynucleotide molecules provided herein comprise a sense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 104, 106 - 107, 109 - 111, 113 - 114, 135, 150 and 220 and / or an antisense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 4, 6 - 7, 9 - 11, 13 - 14, 35, 50 and 215 - 216, and wherein the sense strand is modified in accordance with the type VI modification pattern specified in Table 11 or as described in the previous paragraph.

[0204] This document describes a polynucleotide molecule, whose sense strand contains a nucleic acid sequence that is at least 80% identical to a nucleic acid sequence selected from the nucleic acid sequences of SEQ ID NOs: 151 - 200, 214, and 221. This document describes a polynucleotide molecule, whose sense strand contains a nucleic acid sequence that is at least 85% identical to a nucleic acid sequence selected from the nucleic acid sequences of SEQ ID NOs: 151 - 200, 214, and 221. This document describes a polynucleotide molecule, whose sense strand contains a nucleic acid sequence that is at least 90% identical to a nucleic acid sequence selected from SEQ ID NOs: 151 - 200, 214, and 221. This document describes a polynucleotide molecule, whose sense strand contains a nucleic acid sequence that is at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 151 - 200, 214, and 221.

[0205] This document describes a polynucleotide molecule, whose antisense strand contains a nucleic acid sequence that is at least 80% identical to a nucleic acid sequence selected from the nucleic acid sequences of SEQ ID NOs: 51 - 100, 201 - 213, and 217 - 219. This document describes a polynucleotide molecule, whose antisense strand contains a nucleic acid sequence that is at least 85% identical to a nucleic acid sequence selected from the nucleic acid sequences of SEQ ID NOs: 51 - 100, 201 - 213, and 217 - 219. This document describes a polynucleotide molecule, whose antisense strand contains a nucleic acid sequence that is at least 90% identical to a nucleic acid sequence selected from the nucleic acid sequences of SEQ ID NOs: 51 - 100, 201 - 213, and 217 - 219. This document describes a polynucleotide molecule, whose antisense strand contains a nucleic acid sequence that is at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 51 - 100, 201 - 213, and 217 - 219.

[0206] A polynucleotide molecule for regulating the expression of the FXI gene, wherein the polynucleotide molecule contains an antisense strand comprising a nucleotide sequence selected from SEQ ID NOs: 4, 6 - 7, 9 - 11, 13 - 14, 35, 50, and 215 - 216 and a sense strand comprising a nucleotide sequence selected from SEQ ID NOs: 104, 106 - 107, 109 - 111, 113 - 114, 135, 150, and 220.

[0207] A polynucleotide molecule for regulating the expression of the FXI gene, wherein the polynucleotide molecule contains an antisense strand comprising the nucleotide sequence of SEQ ID NO: 11 and a sense strand comprising the nucleotide sequence of SEQ ID NO: 111.

[0208] A polynucleic acid molecule for regulating the expression of the FXI gene, wherein the polynucleic acid molecule comprises an antisense strand comprising a nucleotide sequence selected from SEQ ID NO: 54, 56-57, 59-61, 63-64, 85, 100, 201-213 and 217-219 and a sense strand comprising a nucleotide sequence selected from SEQ ID NO: 154, 156-157, 159-161, 163-164, 185, 200, 214 and 221.

[0209] A polynucleic acid molecule for regulating the expression of the FXI gene, wherein the polynucleic acid molecule comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO: 61 and a sense strand comprising the nucleotide sequence of SEQ ID NO: 161.

[0210] The present invention further provides a polynucleic acid molecule for regulating the expression of the FXI gene, wherein the polynucleic acid molecule comprises an antisense strand comprising the nucleotide sequence of asUfsaaaugucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 61) and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "dU" refers to 2'-deoxyuridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiophosphate, "invdT" refers to 3' inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0211] The present invention further provides a polynucleotide molecule for regulating the expression of the FXI gene, wherein the polynucleotide molecule comprises an antisense strand containing a nucleotide sequence comprising asUfsaaaugucuuUfgUfuGfcsaagcsgsc (SEQ ID NO: 211) and a sense strand containing a nucleotide sequence comprising gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "dU" refers to 2'-deoxyuridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiophosphate, "invdT" refers to 3' inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0212] The present invention further provides a polynucleotide molecule for regulating the expression of the FXI gene, wherein the polynucleotide molecule comprises an antisense strand containing a nucleotide sequence of asUfsaaaugucuuUfgUfsuGfcaagcsgsc (SEQ ID NO: 212) and a sense strand containing a nucleotide sequence of gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "dU" refers to 2'-deoxyuridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiophosphate, "invdT" refers to 3'-inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0213] The present invention further provides a polynucleotide molecule for regulating the expression of the FXI gene, wherein the polynucleotide molecule comprises an antisense strand containing a nucleotide sequence comprising asUfsaaaugucuuUfgUfuGfcaasgcsgsc (SEQ ID NO: 213) and a sense strand containing a nucleotide sequence comprising gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "dU" refers to 2'-deoxyuridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiolphosphate, "invdT" refers to 3'-inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0214] The present invention further provides a polynucleotide molecule for regulating the expression of the FXI gene, wherein the polynucleotide molecule comprises an antisense strand containing a nucleotide sequence comprising asUfsaaaugucuuUfgUfuGfcaagcsgsc (SEQ ID NO:61) and a sense strand containing a nucleotide sequence comprising gscsuugcAfaCfaAfagacauuuau(invdT)(invdT)(SEQ ID NO:214), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "dU" refers to 2'-deoxyuridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiophosphate, "invdT" refers to 3'-inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0215] The present invention further provides a polynucleotide molecule for regulating the expression of the FXI gene, wherein the polynucleotide molecule comprises an antisense strand containing a nucleotide sequence of asUfsgucuUfuguuGfcAfaGfcgcuusasu (SEQ ID NO: 204) and a sense strand containing a nucleotide sequence of asasgcgcUfuGfcAfacaaagacau (SEQ ID NO: 159), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "dU" refers to 2'-deoxyuridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiol phosphate, "invdT" refers to 3'-inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0216] The present invention further provides a polynucleotide molecule for regulating the expression of the FXI gene, wherein the polynucleotide molecule comprises an antisense strand containing a nucleotide sequence comprising asAfsugucUfuuguUfgCfaAfgcgcususa (SEQ ID NO: 205) and a sense strand containing a nucleotide sequence comprising asgscgcuUfgCfaAfcaaagacauu (SEQ ID NO: 160), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "dU" refers to 2'-deoxyuridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thio-phosphate, "invdT" refers to 3'-inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0217] The present invention further provides a polynucleotide molecule for regulating the expression of the FXI gene, wherein the polynucleotide molecule comprises an antisense strand containing a nucleotide sequence comprising asUfsaaauGfucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 206) and a sense strand containing a nucleotide sequence comprising gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "dU" refers to 2'-deoxyuridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiophosphate, "invdT" refers to 3' inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0218] The present invention further provides a polynucleotide molecule for regulating the expression of the FXI gene, wherein the polynucleotide molecule comprises an antisense strand comprising a nucleotide sequence of usUfsauagUfuuauGfcCfcUfucaugsusc (SEQ ID NO: 207) and a sense strand comprising a nucleotide sequence of csasugaaGfgGfcAfuaaacuauaa (SEQ ID NO: 163), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "dU" refers to 2'-deoxyuridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thio-phosphate, "invdT" refers to 3'-inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0219] The present invention further provides a polynucleic acid molecule for regulating the expression of the FXI gene, wherein the polynucleic acid molecule comprises an antisense strand containing a nucleotide sequence comprising asUfsagguAfaaaaAfcUfgGfcagcgsgsa (SEQ ID NO: 209) and a sense strand containing a nucleotide sequence comprising csgscugcCfaGfuUfuuuuaccuau (SEQ ID NO: 185), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "dU" refers to 2'-deoxyuridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiolphosphate, "invdT" refers to 3' inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0220] The present invention further provides a polynucleotide molecule for regulating the expression of the FXI gene, wherein the polynucleotide molecule comprises an antisense strand containing a nucleotide sequence comprising isUfsaaaugucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 217) and a sense strand containing a nucleotide sequence comprising gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "dU" refers to 2'-deoxyuridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiol phosphate, "invdT" refers to 3' inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0221] The present invention further provides a polynucleotide molecule for regulating the expression of the FXI gene, wherein the polynucleotide molecule comprises an antisense strand containing a nucleotide sequence comprising usUfsaaauGfucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 218) and a sense strand containing a nucleotide sequence comprising gscsuugcAfaCfaAfagacauuuaa (SEQ ID NO: 222), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "dU" refers to 2'-deoxyuridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiophosphate, "invdT" refers to 3'-inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0222] The present invention further provides a polynucleotide molecule for regulating the expression of the FXI gene, wherein the polynucleotide molecule comprises an antisense strand comprising a nucleotide sequence of a4sUfsaaauGfucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 219) and a sense strand comprising a nucleotide sequence of gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161), wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "dU" refers to 2'-deoxyuridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thio-phosphate, "invdT" refers to 3' inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0223] Conjugation

[0224] Targeting moiety

[0225] In certain aspects, the polynucleotide molecules described herein are conjugated or coupled with one or more targeting moieties to form polynucleotide-targeting moiety conjugate molecules. In some cases, the targeting moiety is selected based on its ability to selectively or preferably target the conjugate molecules described herein to a desired cell population, tissue, or organ. In some cases, the targeting moiety targets cells, tissues, or organs that express the corresponding binding partner (e.g., the corresponding receptor or ligand) of the targeting moiety. For example, a polynucleotide molecule conjugated with N-acetylgalactosamine (GalNAc) can target hepatocytes that express asialoglycoprotein (ASGP-R). Any suitable GalNAc molecule known in the art for use as a targeting moiety is contemplated. Exemplary GalNAc molecules include tris-branched GalNAc (e.g., L96). Further examples of targeting moieties are galactose. The targeting moiety can also be a lipid, a peptide, or a small molecule.

[0226] The hybrid polynucleotide constructs disclosed herein can include targeting moieties (i.e., intracellular targeting moieties) that target desired intracellular sites (e.g., endoplasmic reticulum, Golgi apparatus, nucleus, or mitochondria). Non-limiting examples of intracellular targeting moieties are provided in WO 2015 / 069932 and WO 2015 / 188197; the disclosures of the intracellular targeting moieties in WO 2015 / 069932 and WO 2015 / 188197 are incorporated herein by reference.

[0227] Thus, the polynucleotide molecules described herein can include one or more targeting moieties selected from intracellular targeting moieties, extracellular targeting moieties, and combinations thereof. Thus, including one or more targeting moieties (e.g., an extracellular targeting moiety including targeting moieties independently selected from folic acid, mannose, N-acetylgalactosamine, and prostate-specific membrane antigen) and one or more intracellular targeting moieties (e.g., moieties targeting the endoplasmic reticulum, Golgi apparatus, nucleus, or mitochondria) in the polynucleotide molecules described herein can facilitate delivery of the polynucleotide to specific sites within a particular cell population. In some aspects, the targeting moiety contains one or more mannose carbohydrates. Mannose targets the mannose receptor, a 175 KDa membrane-associated receptor that is expressed on sinusoidal liver cells and antigen-presenting cells (e.g., macrophages and dendritic cells). It is an efficient endocytic / recycling receptor that binds and internalizes mannosylated pathogens and proteins (Lennartz et al., J. Biol. Chem. 262:9942-9944, 1987; Taylor et al., J. Biol. Chem. 265:12156-62, 1990).

[0228] This text describes some targeting moieties. In some aspects, the targeting moiety comprises or specifically binds to a protein selected from the following: insulin, insulin-like growth factor receptor 1 (IGF1R), IGF2R, insulin-like growth factor (IGF; e.g., IGF 1 or 2), mesenchymal-epithelial transition factor receptor (c-met; also known as hepatocyte growth factor receptor (HGFR)), hepatocyte growth factor (HGF), epidermal growth factor receptor (EGFR), epidermal growth factor (EGF), amphiregulin, fibroblast growth factor receptor (FGFR), platelet-derived growth factor receptor (PDGFR), platelet-derived growth factor (PDGF), vascular endothelial growth factor receptor (VEGFR), vascular endothelial growth factor (VEGF), tumor necrosis factor receptor (TNFR), tumor necrosis factor α (TNF-α), TNF-β, folate receptor (FOLR), folic acid, transferrin, transferrin receptor (TfR), mesothelin, Fc receptor, c-kit receptor, c-kit, integrin (e.g., α4 integrin or β-1 integrin), P-selectin, sphingosine-1-phosphate receptor-1 (S1PR), hyaluronate receptor, leukocyte function antigen-1 (LFA-1), CD4, CD11, CD18, CD20, CD25, CD27, CD52, CD70, CD80, CD85, CD95 (Fas receptor), CD106 (vascular cell adhesion molecule 1 (VCAM1)), CD166 (activated leukocyte cell adhesion molecule (ALCAM)), CD178 (Fas ligand), CD253 (TNF-related apoptosis-inducing ligand (TRAIL)), ICOS ligand, CCR2, CXCR3, CCR5, CXCL12 (stromal cell-derived factor 1 (SDF-1)), interleukin 1 (IL-1), IL-1ra, IL-2, IL-3, IL-4, IL-6, IL-7, IL-8, CTLA-4, MART-1, gp100, MAGE-1, ephrin (Eph) receptor, mucosal addressin cell adhesion molecule 1 (MAdCAM-1), carcinoembryonic antigen (CEA), LewisY, MUC-1, epithelial cell adhesion molecule (EpCAM), cancer antigen 125 (CA125), prostate-specific membrane antigen (PSMA), TAG-72 antigen, and fragments thereof. In further aspects, the targeting moiety comprises the erythroblastic leukemia viral oncogene homolog (ErbB) receptor (e.g., ErbB1 receptor; ErbB2 receptor; ErbB3 receptor; and ErbB4 receptor). In some aspects, the targeting moiety comprises one or more (e.g., 1 to 6) N-acetylgalactosamine (GalNAc). In certain aspects, the targeting moiety comprises one or more (e.g., 1 to 6) galactose. In certain aspects, the targeting moiety comprises one or more (e.g., 1 to 6) mannose.In other aspects, the targeting moiety contains a folic acid ligand. The folic acid ligand has the following structure:.

[0229]

[0230] Certain targeting moieties can include bombesin, gastrin, gastrin-releasing peptide, tumor growth factor (TGF) (e.g., TGF-α or TGF-β), or vaccinia virus growth factor (VVGF). Non-peptidyl targeting moieties can also be used for the targeting moiety and can include, for example, steroids, carbohydrates, vitamins, and lectins. Some targeting moieties can include polypeptides, such as somatostatin or somatostatin analogs (e.g., octreotide or lanreotide), bombesin, or an antibody or an antigen-binding fragment thereof. The antibody can be any known class or subclass, e.g., IgG, IgA, IgM, IgD, or IgE. Typically, those antibodies belonging to the IgG class are used. According to techniques known in the art, the antibody can be from any species. However, generally, the antibody is of human, murine, or rabbit origin. In addition, the antibody can be polyclonal or monoclonal, but is typically monoclonal. Human or chimeric (e.g., humanized) antibodies can be used for the targeting moiety. The targeting moiety can include an antigen-binding fragment of an antibody. Such antibody fragments can include, for example, Fab’, F(ab’)2, Fv, or Fab fragments, single domain antibodies, ScFv, or other antigen-binding fragments. The Fc fragment can also be used for the targeting moiety. Such antibody fragments can be prepared, for example, by proteolytic enzyme digestion, such as by pepsin or papain digestion, reductive alkylation, or recombinant techniques. The materials and methods for preparing antibody fragments are well known to those skilled in the art. See, for example, Parham, J. Immunology, 131:2895, 1983; Lamoyi et al., J. Immunological Methods, 56:235, 1983.

[0231] Other peptides that serve as targeting moieties in the polynucleotide molecules described herein can be selected from Kisspeptides and analogs, teleost urotensin II peptides and analogs, GnRH I and II peptides and analogs, depreotide, vapreotide, vasoactive intestinal peptide (VIP), cholecystokinin (CCK), RGD-containing peptides, melanocyte-stimulating hormone (MSH) peptides, neurotensin, calcitonin, glutathione, YIGSR (leukophilic peptide, e.g., P483H, which contains the heparin-binding region of platelet factor-4 (PF-4) and a lysine-rich sequence), atrial natriuretic peptide (ANP), β-amyloid peptide, δ-opioid antagonists (such as ITIPP (psi)), annexin-V, endothelin, leukotriene B4 (LTB4), chemotactic peptides (e.g., N-formyl-methionyl-leucyl-phenylalanine-lysine (fMLFK)), GP IIb / IIIa receptor antagonists (e.g., DMP444), human neutrophil elastase inhibitors (EPI-HNE-2 and EPI-HNE-4), plasmin inhibitors, antimicrobial peptides, apticide (P280 and P274), thrombospondin receptors (including analogs such as TP-1300), bitistatin, pituitary adenylate cyclase type I receptor (PAC1), fibrin alpha-chain, peptides derived from phage display libraries, and their conservative substitutions.

[0232] One or more (e.g., 1 to 6) targeting moieties can be linked to the MOIETY or X2 in formulas (V’, V”, V”’, V””, V””’, V”””) via -LinkA-.

[0233] In some aspects, the targeting moiety includes one or more (e.g., 1 to 6 or 1 to 3) asialoglycoprotein receptor ligands (e.g., GalNAc). In some aspects, the asialoglycoprotein receptor ligand (e.g., GalNAc) is attached to -LinkA- via the anomeric carbon (e.g., where the anomeric carbon is the carbon atom in an acetal or hemiaminal acetal). In some aspects, the asialoglycoprotein receptor ligand (e.g., GalNAc) contains an anomeric carbon bonded to a trivalent, tetravalent, pentavalent, or hexavalent linker, where the anomeric carbon is part of a hemiaminal acetal group. Compared to a hybrid polynucleotide construct having an asialoglycoprotein receptor ligand (e.g., GalNAc) attached to the linker via an acetal, an asialoglycoprotein receptor ligand (e.g., GalNAc) attached to the linker via a hemiaminal acetal can produce a hybrid polynucleotide construct with better efficacy in gene silencing.

[0234] In some aspects, the linker and three asialoglycoprotein receptor targeting moieties, each containing GalNAc, are shown in formula (V). In some cases, the conjugates described herein contain only one asialoglycoprotein receptor targeting moiety, and thus the conjugate contains the structure of formula (V) with any two targeting moieties removed. In some cases, the conjugates described herein contain only two asialoglycoprotein receptor targeting moieties, and thus the conjugates described herein contain the structure of formula (V) with any one targeting moiety removed.

[0235]

[0236] Wherein one of Y1 and Y2 is a nucleotide, or wherein both Y1 and Y2 are nucleotides, and Y1 and Y2 are consecutive or adjacent nucleotides from the polynucleic acid molecules described herein.

[0237] In some aspects, the linker and targeting moieties described herein are conjugated to the 3'-end of the sense strand (e.g., as shown in formulas (V', V'', V''', V'''')). In some aspects, the linker and targeting moieties described herein are conjugated to the 5'-end of the sense strand (e.g., as shown in formula (V'') or (V''')). In some aspects, the linker and targeting moieties described herein are conjugated to the 3'-end of the antisense strand (e.g., as shown in formulas (V'), (V''), (V'''), (V'''')). In some aspects, the linker and targeting moieties described herein are conjugated to the 5'-end of the antisense strand (e.g., as shown in formula (V'') or (V''')).

[0238]

[0239] Wherein Z in formula (V') corresponds to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V') is adenine, uracil, guanine, cytosine, thymine, abasic, etc.

[0240]

[0241] Wherein Z in formula (V'') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V'') is adenine, uracil, guanine, cytosine, thymine, abasic, etc.

[0242]

[0243] wherein Z in formula (V”’) is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V”’) is adenine, uracil, guanine, cytosine, thymine, abasic, etc.

[0244]

[0245] wherein Z in formula (V””) is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V””) is adenine, uracil, guanine, cytosine, thymine, abasic, etc.

[0246]

[0247] wherein Z in formula (V””’) is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V””’) is adenine, uracil, guanine, cytosine, thymine, abasic, etc.

[0248]

[0249] wherein Z in formula (V”””) is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V”””) is adenine, uracil, guanine, cytosine, thymine, abasic, etc.

[0250] In some cases, the 3'-end of the passenger / sense strand of the polynucleic acid molecules in Tables 1-2 and Tables 7-9 is conjugated with X2-GalNAc (see formulas (V), (V'), (V''), (V'''), (V'''')). In some cases, the 5'-end of the passenger / sense strand of the polynucleic acid molecules in Tables 1-2 and Tables 7-9 is conjugated with X2-GalNAc (see formulas (V), (V'') or (V''')). In some cases, the nucleic acid within (not at the 5'- or 3'-end) the passenger / sense strand in Table 1 or Table 2 is conjugated with X2-GalNAc (see formula (V)). In some cases, the 3'-end of the guide / antisense strand of the polynucleic acid molecules in Tables 1-2 and Tables 7-9 is conjugated with X2-GalNAc (see formulas (V), (V'), (V''), (V'''), (V'''')). In some cases, the 5'-end of the guide / antisense strand of the polynucleic acid molecules in Tables 1-2 and Tables 7-9 is conjugated with X2-GalNAc (see formulas (V), (V'') or (V''')). In some cases, the nucleic acid within (not at the 5'- or 3'-end) the guide / antisense strand of the polynucleic acid molecules in Tables 1-2 and Tables 7-9 is conjugated with X2-GalNAc (see formula (V)).

[0251] In some cases, one or more endosomal escape moieties (e.g., 1 to 6 or 1 to 3) can be attached as auxiliary moieties to the polynucleotide constructs or hybrid polynucleotide constructs disclosed herein. Exemplary endosomal escape moieties include the chemotherapeutic agents described herein (e.g., quinolones such as chloroquine); fusogenic lipids (e.g., dioleoylphosphatidylethanolamine (DOPE)); and polymers such as polyethylenimine (PEI); poly(β-amino esters); polypeptides such as polyarginine (e.g., octaarginine) and polylysine (e.g., octalysine); proton sponges, viral capsids, and peptide transduction domains. For example, fusogenic peptides can be derived from the M2 protein of influenza A virus; peptide analogs of influenza virus hemagglutinin; the HEF protein of influenza C virus; the transmembrane glycoprotein of filoviruses; the transmembrane glycoprotein of rabies virus; the transmembrane glycoprotein (G) of vesicular stomatitis virus; the fusion protein of Sendai virus; the transmembrane glycoprotein of Semliki forest virus; the fusion protein of human respiratory syncytial virus (RSV); the fusion protein of measles virus; the fusion protein of Newcastle disease virus; the fusion protein of ovine progressive pneumonia virus; the fusion protein of murine leukemia virus; the fusion protein of HTL virus; and the fusion protein of simian immunodeficiency virus (SIV). Other moieties that can be used to promote endosomal escape are described in Dominska et al., Journal of Cell Science, 123(8):1183-1189, 2010. For example, WO 2015 / 188197 provides specific examples of endosomal escape moieties, including moieties suitable for conjugation to the hybrid polynucleotide constructs disclosed herein; the disclosure of these endosomal escape moieties is incorporated herein by reference.

[0252] As described herein, one or more endosomal escape moieties (e.g., 1 to 6 or 1 to 3) can be attached via -LinkA- to the MOIETY or X2 in formula (V’, V”, V”’, V””, V””’ or V””).

[0253] One or more cell-penetrating peptides (CPPs) (e.g., 1 to 6 or 1 to 3) can be attached as auxiliary moieties to the polynucleotide constructs or hybrid polynucleotide constructs disclosed herein. As disclosed herein, the CPP can be bioreversibly linked to the hybrid polynucleotide via a disulfide bond. Thus, after delivery to the cell, the CPP can be cleaved intracellularly, e.g., by intracellular enzymes (e.g., protein disulfide isomerase, thioredoxin, or thioesterase), thereby releasing the polynucleotide.

[0254] CPPs are known in the art (e.g., TAT or Arg8) (Snyder and Dowdy, 2005, Expert Opin. Drug Deliv. 2, 43-51). For example, specific examples of CPPs comprising moieties adapted to conjugate with polynucleotide constructs hybridizable as disclosed herein are provided in WO 2015 / 188197; the disclosure of these CPPs is incorporated herein by reference.

[0255] CPPs are positively charged peptides that are capable of facilitating the delivery of biological cargo to cells. It is believed that the cationic charge of CPPs is crucial for their function. In addition, the transduction of these proteins does not appear to be affected by cell type, and these proteins can efficiently transduce almost all cells in culture without significant toxicity (Nagahara et al., Nat. Med. 4:1449-52, 1998). In addition to full-length proteins, CPPs have also been successfully used to induce intracellular uptake of DNA (Abu-Amer, ibid.), antisense polynucleotides (Astriab-Fisher et al., Pharm. Res, 19:744-54, 2002), small molecules (Polyakov et al., Bioconjug. Chem. 11:762-71, 2000), and even inorganic 40 nm iron particles (Dodd et al., J. Immunol. Methods 256:89-105, 2001; Wunderbaldinger et al., Bioconjug. Chem. 13:264-8, 2002; Lewin et al., Nat. Biotechnol. 18:410-4, 2000; Josephson et al., Bioconjug. Chem. 10:186-91, 1999), indicating considerable flexibility in particle size during this process.

[0256] In one instance, CPPs useful in the methods and compositions as described herein include peptides characterized by significant α-helicity. It has been found that transfection is optimized when the CPP exhibits significant α-helicity. In another instance, CPPs include sequences containing basic amino acid residues that are substantially aligned along at least one face of the peptide. The CPPs described herein can be natural or synthetic peptides.

[0257] As described herein, one or more cell-penetrating peptides (e.g., 1 to 6 or 1 to 3) can be attached via -LinkA- to the MOIETY or X2 in formula (V’, V”, V”’, V””, V””’, V””).

[0258] The polynucleotide constructs and hybridizing polynucleotide constructs disclosed herein may also include a covalently attached neutral polymer-based auxiliary moiety. Neutral polymers include poly(C1-6 alkylene oxide), e.g., poly(ethylene glycol) and poly(propylene glycol) and their copolymers, e.g., diblock and triblock copolymers. Other examples of polymers include esterified poly(acrylic acid), esterified poly(glutamic acid), esterified poly(aspartic acid), poly(vinyl alcohol), poly(ethylene-co-vinyl alcohol), poly(N-vinylpyrrolidone), poly(ethyl oxazoline), poly(alkyl acrylate), poly(acrylamide), poly(N-alkyl acrylamide), poly(N-acryloylmorpholine), poly(lactic acid), poly(glycolic acid), poly(dioxanone), poly(caprolactone), styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyurethane, N-isopropylacrylamide polymer, and poly(N,N-dialkylacrylamide). Exemplary polymer auxiliary moieties may have a molecular weight of less than 100, 300, 500, 1000, or 5000 Da (e.g., greater than 100 Da). Other polymers are known in the art.

[0259] As described herein, one or more polymers (e.g., 1 to 6 or 1 to 3) may be attached via -LinkA- to the MOIETY or X2 in Formulas (V’, V”, V”’, V””, V””’, V””).

[0260] Conjugation linker

[0261] In some aspects, the polynucleic acid molecules described herein comprise a sense or antisense strand bonded to at least one group of Formula (I)

[0262]

[0263] or a salt thereof, or a stereoisomer thereof,

[0264] wherein

[0265] each X 1 is independently O or S;

[0266] each X 2 is independently O, S, NH, or a bond;

[0267] MOIETY is an optionally substituted C 2-10 alkane-tetrayl or -M 1 -M 2 -M 3 -group, wherein each M 1 and each M 3 is independently absent or is an optionally substituted C 1-6an alkylene group, and M 2 is an optionally substituted C 3-9 heterocyclic-tetrayl, an optionally substituted C 6-10 arylene-tetrayl or an optionally substituted C 3-8 cycloalkane-tetrayl;

[0268] Each R 1 and each R 2 is independently H, an optionally substituted C 1-16 alkyl group, an optionally substituted C 2-16 heteroalkyl group, a conjugating moiety or -LinkA(-T) p , provided that at least one R 1 or at least one R 2 is a conjugating moiety or -LinkA(-T) p is sufficient;

[0269] Each R 3 is independently H, an optionally substituted C 1-16 alkyl group, an optionally substituted C 2-16 heteroalkyl group, an optionally substituted C 2-16 alkenyl group, an optionally substituted C 2-16 alkynyl group, an optionally substituted (C 1-9 heterocyclic group)-C 1-6 -alkyl group, an optionally substituted (C 6-10 aryl group)-C 1-6 -alkyl group, an optionally substituted (C 3-8 cycloalkyl group)-C 1-6 -alkyl group, a conjugating moiety or -LinkA(-T) p ;

[0270] R 4 is H, an optionally substituted C 1-6 alkyl group, -LinkA(-T) p or -Sol;

[0271] Each LinkA is independently a polyvalent linker (e.g., including -C(O)-N(H)- (e.g., at least one polyvalent linker including -C(O)-N(H)- bonded to T));

[0272] Each T is independently a support moiety;

[0273] Sol is a solid support;

[0274] m is an integer from 1 to 6;

[0275] Each n is independently 0 or 1;

[0276] Each p is independently an integer from 1 to 6; and

[0277] q is an integer from 0 to 3.

[0278] At least one group of formula (I) can be bonded to the 5'-end, 3'-end, internucleoside phosphate, internucleoside phosphorothioate or internucleoside dithioate of the polynucleotide. When at least one group of formula (I) is bonded to an internucleoside phosphate, internucleoside phosphorothioate or internucleoside dithioate, q is 0. The polynucleotide construct contains no more than one Sol.

[0279] The -LinkA- group can include from 0 to 3 polyvalent monomers (e.g., an optionally substituted C1-6 alkane-triyl, an optionally substituted C1-6 alkane-tetrayl or a trivalent nitrogen atom) and one or more divalent monomers (e.g., from 1 to 40), where each divalent monomer is independently an optionally substituted C1-6 alkylene; an optionally substituted C2-6 alkenylene; an optionally substituted C2-6 alkynylene; an optionally substituted C3-8 cycloalkylene; an optionally substituted C3-8 cycloalkenylene; an optionally substituted C6-14 arylene; an optionally substituted C1-9 heteroarylene having 1 to 4 heteroatoms selected from N, O and S; an optionally substituted C1-9 heterocyclylene having 1 to 4 heteroatoms selected from N, O and S; an imino group; an optionally substituted N; O; or S(O)m, where m is 0, 1 or 2. In some aspects, each monomer is independently an optionally substituted C1-6 alkylene; an optionally substituted C3-8 cycloalkylene; an optionally substituted C3-8 cycloalkenylene; an optionally substituted C6-14 arylene; an optionally substituted C1-9 heteroarylene having 1 to 4 heteroatoms selected from N, O and S; an optionally substituted C1-9 heterocyclylene having 1 to 4 heteroatoms selected from N, O and S; an imino group; an optionally substituted N; O; or S(O)m, where m is 0, 1 or 2 (e.g., m is 2). In certain aspects, each monomer is independently an optionally substituted C1-6 alkylene; an optionally substituted C3-8 cycloalkylene; an optionally substituted C3-8 cycloalkenylene; an optionally substituted C6-14 arylene; an optionally substituted C1-9 heteroarylene having 1 to 4 heteroatoms selected from N, O and S; an optionally substituted C1-9 heterocyclylene having 1 to 4 heteroatoms selected from N, O and S; an optionally substituted N; O; or S(O)m, where m is 0, 1 or 2 (e.g., m is 2). A non-bio-reversible linker that attaches the auxiliary moiety to the conjugate moiety or its reaction product can include from 2 to 500 (e.g., from 2 to 300 or from 2 to 200) such monomers. The -LinkA- group can include a poly(alkylene oxide) (e.g., polyethylene oxide, polypropylene oxide, poly(triethylene oxide), polybutylene oxide, poly(tetramethylene oxide) and their diblock or triblock copolymers). In some aspects, the non-bio-reversible linker includes polyethylene oxide (e.g., poly(ethylene oxide) having a molecular weight of less than 1 kDa).

[0280] The –LinkA(–T)p group in formula (I) can be prepared by the processes described in the following sections. In some cases, –LinkA(–T)p is of formula (II):

[0281] –Q 1 –Q 2 ([–Q 3 –Q 4 –Q 5 s –Q 6 –T) p ,

[0282] (II)

[0283] where

[0284] each s is independently an integer from 0 to 20 (e.g., 0 to 10), where the repeating units are the same or different;

[0285] Q 1 is a conjugation linker (e.g., [–Q 3 –Q 4 –Q 5 s –Q C –, where Q C is an optionally substituted C 2-12 heteroalkylene (e.g., a heteroalkylene containing –C(O)–N(H)–, –N(H)–C(O)–, –S(O)2–N(H)– or –N(H)–S(O)2–), an optionally substituted C 1-12 thioheterocyclic group (e.g., ), an optionally substituted C 1-12 heterocyclic group (e.g., 1,2,3-triazole-1,4-diyl or ), cyclobut-3-ene-1,2-dione-3,4-diyl or pyridine-2-ylhydrazone);

[0286] If p is 1, then Q 2 is a linear group (e.g., [–Q 3 –Q 4 –Q 5 s –), or if p is an integer from 2 to 6, then Q 2 is a branched group (e.g., [–Q 3 –Q 4 –Q 5 s –Q 7 ([–Q 3 –Q 4 –Q 5 s –(Q 7 )​​​​​p1 ) p2 , where p1 is 0 or 1, and p2 is 0, 1, 2, or 3);

[0287] Each Q 3 and each Q 6 is independently absent, –CO–, –NH–, –O–, –S–, –SO2–, –OC(O)–, –COO–, –NHC(O)–, –C(O)NH–, –CH2–, –CH2NH–, –NHCH2–, –CH2O–, or –OCH2–;

[0288] Each Q 4 is independently absent, optionally substituted C 1-12 alkylene, optionally substituted C 2-12 alkenylene, optionally substituted C 2-12 alkynylene, optionally substituted C 2-12 heteroalkylene, optionally substituted C 6-10 arylene, optionally substituted C 1-9 heteroarylene, or optionally substituted C 1-9 heterocyclylene;

[0289] Each Q 5 is independently absent, –CO–, –NH–, –O–, –S–, –SO2–, –CH2–, –C(O)O–, –OC(O)–,

[0290] –C(O)NH–, –NH–C(O)–, –NH–CH(R a )–C(O)–, or –C(O)–CH(R a )–NH–;

[0291] Each Q 7 is independently an optionally substituted C 1-6 alkane - triyl, optionally substituted C 1-6 alkane - tetrayl, optionally substituted C 2-6 heteroalkane - triyl, or optionally substituted C 2-6 heteroalkane - tetrayl; and

[0292] Each R a is independently H or an amino acid side chain;

[0293] Provided that at least one of Q 3 , Q 4 and Q 5 is present.

[0294] In some aspects, each Q 4 is independently absent, optionally substituted C 1-12 alkylene, optionally substituted C2-12 Alkenylene, optionally substituted C 2-12 Alkynylene, optionally substituted C 2-12 Heteroalkylene or optionally substituted C 1-9 Heterocyclylene. In some aspects, s is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20.

[0295] Thus, in formula (II), if each p1 is 0, LinkA can include a single branch point, or if at least one p1 is 1, LinkA can include multiple branch points.

[0296] In formula (II), Q 1 can be –O–Q L –Q C –, where Q L is optionally substituted C 2-12 Heteroalkylene, optionally substituted C 1-12 Alkylene or –(optionally substituted C 1-6 Alkylene)–(optionally substituted C 6-10 Arylene)–. In some aspects, Q L is optionally substituted C 2-12 Heteroalkylene or optionally substituted C 1-12 Alkylene. In formula (II), Q C can be:

[0297]

[0298] In formula (II), Q 2 can be a linear group of the formula [–Q 3 –Q 4 –Q 5 s –, where Q 3 , Q 4 and Q 5 are as defined in formula (II). Optionally, Q 2 can be a branched group [–Q 3 –Q 4 –Q 5 s –Q 7 ([–Q 3 –Q 4 –Q 5 s –(Q 7 ) p1 ) p2 , where each Q 7 is independently optionally substituted C 1-6 ​​​Alkane - triyl, optionally substituted C 1-6 Alkane - tetrayl, optionally substituted C 2-6 Heteroalkane - triyl or optionally substituted C 2-6 Heteroalkane - tetrayl;

[0299] wherein

[0300] p1 is 0 or 1;

[0301] p2 is 0, 1, 2 or 3;

[0302] wherein,

[0303] when p1 is 0, LinkA is a trivalent or tetravalent linker, and,

[0304] when p1 is 1, LinkA is a tetravalent, pentavalent or hexavalent linker.

[0305] In some aspects, p1 is 0.

[0306] In some aspects, Q 7 is:

[0307]

[0308] Compounds that can be used to prepare the group –LinkA(–T)p in formula (I) are described in this text and in WO 2015 / 188197. Non - limiting examples of –LinkA include:

[0309]

[0310]

[0311]

[0312] wherein

[0313] R 18 is a bond to MOIETY,

[0314] each R 19 is independently a bond to an auxiliary moiety,

[0315] each m5 is independently an integer from 1 to 20,

[0316] each m6 is independently an integer from 1 to 10,

[0317] m7 is an integer from 1 to 6; and

[0318] each X 6 is independently O or S.

[0319] In formula (II), when the conjugation linker is of the formula [–Q3 –Q 4 –Q 5 s –Q C – when, –Q 2 ([–Q 3 –Q 4 –Q 5 s –Q 6 –T) p may be:

[0320]

[0321]

[0322] wherein

[0323] R 20 is a key to Q 1 in Q C each R 19 is independently a key to the auxiliary part, each m5 is independently an integer from 1 to 20,

[0324] each m6 is independently an integer from 1 to 10,

[0325] m7 is an integer from 1 to 6; and

[0326] each X 6 is independently O or S.

[0327] In some aspects, the connectors described herein are cuttable. In some aspects, the connectors described herein are non - cuttable.

[0328] In some aspects, the polynucleotide molecules described herein comprise a sense or antisense strand bonded to at least one group of formula (IV),

[0329]

[0330] wherein at least one of Y1 or Y2 is a nucleotide in the polynucleotide molecule.

[0331] ​​In some cases, Y1 is the last nucleotide at the 3'-end or the first nucleotide at the 5'-end of a strand of a polynucleic acid molecule. In some cases, Y1 is the last nucleotide at the 3'-end or the first nucleotide at the 5'-end of the sense strand of a polynucleic acid molecule. In some cases, Y1 is the last nucleotide at the 3'-end or the first nucleotide at the 5'-end of the sense strand of a polynucleic acid molecule, and Y2 is a 3-hydroxy-propoxy group. In some cases, Y2 is the first nucleotide at the 5'-end or the last nucleotide at the 3'-end of a strand of a polynucleic acid molecule. In some cases, Y2 is the first nucleotide at the 5'-end or the last nucleotide at the 3'-end of the sense strand of a polynucleic acid molecule. In some cases, Y2 is the first nucleotide at the 5'-end or the last nucleotide at the 3'-end of the sense strand of a polynucleic acid molecule, and Y1 is a 3-hydroxy-propoxy group. In other cases, Y1 and Y2 are two consecutive nucleotides in a strand of a polynucleic acid molecule.

[0332] In some aspects, the targeting moiety described herein is conjugated to the 3'-end of the sense strand (e.g., formula (IV') or (IV"")). In some aspects, the targeting moiety described herein is conjugated to the 5'-end of the sense strand (e.g., formula (IV") or (IV"')). In some aspects, the targeting moiety described herein is conjugated to the 3'-end of the antisense strand (e.g., formula (IV') or (IV"")). In some aspects, the targeting moiety described herein is conjugated to the 5'-end of the antisense strand (e.g., formula (IV") or (IV"')).

[0333]

[0334] Wherein Z in formula (IV') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F or -O-methoxyethyl), and R in formula (IV') is adenine, uracil, guanine, cytosine, thymine, abasic, etc.

[0335]

[0336] Wherein Z in formula (IV") is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F or -O-methoxyethyl), and R in formula (IV") is adenine, uracil, guanine, cytosine, thymine, abasic, etc.

[0337]

[0338] Wherein Z in formula (IV”’) is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (IV”’) is adenine, uracil, guanine, cytosine, thymine, abasic, etc.

[0339]

[0340] Wherein Z in formula (IV””) is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (IV””) is adenine, uracil, guanine, cytosine, thymine, abasic, etc.

[0341] Drug composition

[0342] Delivery of the polynucleotide molecules described herein can be achieved by contacting the cells with the polynucleotide molecules using a variety of methods. In certain aspects, the polynucleotide molecules described herein are formulated with various excipients, vehicles, and carriers, as more fully described elsewhere herein.

[0343] The drug compositions described herein can be prepared using carriers, excipients, and vehicles into a form suitable for administration to a subject that includes the hybrid polynucleotide constructs disclosed herein. Commonly used excipients include magnesium carbonate, titanium dioxide, lactose, mannitol and other sugars, talc, milk proteins, gelatin, starch, vitamins, cellulose and its derivatives, animal and vegetable oils, polyethylene glycol, and solvents such as sterile water, alcohols, glycerol, and polyols. Intravenous vehicles include fluids and nutritional supplements. Preservatives include antimicrobial agents, antioxidants, chelating agents, and inert gases. Other pharmaceutically acceptable vehicles include aqueous solutions, non-toxic excipients including salts, preservatives, buffers, etc., for example, as described in Remington: The Science and Practice of Pharmacy, 21st Edition, Gennaro, Editor, Lippencott Williams & Wilkins (2005) and The United States Pharmacopeia: The National Formulary (USP 36NF31) published in 2013. Adjust the pH and precise concentration of the various components in the drug composition according to conventional techniques in the art. See Goodman and Gilman's The Pharmacological Basis for Therapeutics.

[0344] The pharmaceutical compositions described herein can be administered locally or systemically. The therapeutically effective amount will vary according to various factors such as the degree of infection in the subject, the age, sex, and weight of the individual. The dosage regimen can be adjusted to provide the optimum therapeutic response. For example, several divided doses can be administered daily, or the dose can be proportionally reduced as indicated by the exigencies of the therapeutic situation.

[0345] The pharmaceutical compositions can be administered in a convenient manner, such as by injection (e.g., subcutaneous, intravenous, intraorbital, etc.), oral administration, ocular application, inhalation, topical application, or rectal administration. Depending on the route of administration, the pharmaceutical compositions can be coated with materials to protect the pharmaceutical compositions from the action of enzymes, acids, and other natural conditions that may inactivate the pharmaceutical compositions. The pharmaceutical compositions can also be administered parenterally or intraperitoneally. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and their mixtures, and in oils. Under ordinary storage and use conditions, these preparations can contain preservatives to prevent the growth of microorganisms.

[0346] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water-soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. The compositions will generally be sterile and fluid to the extent that easy syringability exists. The compositions will generally be stable under the conditions of manufacture and storage and will be preserved against the contaminating action of microorganisms such as bacteria and fungi. The vehicle can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), suitable mixtures thereof, and vegetable oils. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size (in the case of dispersions), and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. In many cases, isotonic agents such as sugars, polyols such as mannitol and sorbitol, or sodium chloride are used in the compositions. Prolonged absorption of the injectable compositions can be achieved by including agents that delay absorption (e.g., aluminum monostearate and gelatin) in the compositions.

[0347] Sterile injectable solutions can be prepared by incorporating the required amount of the pharmaceutical composition into a suitable solvent with one or a combination of the ingredients enumerated above as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the pharmaceutical composition into a sterile vehicle that contains a basic dispersion medium and the required other ingredients enumerated above.

[0348] For convenience of administration and uniformity of dosage, it is particularly advantageous to formulate parenteral compositions in unit dosage form. As used herein, unit dosage form means a physically discrete unit suitable as a unit dose for the subject to be treated; each unit containing a predetermined quantity of the pharmaceutical composition is calculated to produce the desired therapeutic effect in association with the required pharmaceutical vehicle. The specification of the unit dosage form is related to the characteristics of the pharmaceutical composition and the particular therapeutic effect to be achieved. For convenient and effective administration, an effective amount of the principal pharmaceutical composition is combined with a suitable pharmaceutically acceptable vehicle in an acceptable unit dosage. In the case of compositions containing supplementary active ingredients, the dosage is determined by reference to the usual dosage and manner of administration of the ingredients.

[0349] The pharmaceutical composition can be administered orally, for example, in enteric-coated unit dosage forms, such as in a carrier. The pharmaceutical composition and other ingredients can also be encapsulated in hard or soft gelatin capsules or compressed into tablets. For oral therapeutic administration, the pharmaceutical composition can be mixed with excipients and used in ingestible tablets, lozenges, capsules, pills, wafers, etc. Such compositions and preparations should contain at least 1% by weight of the active compound. Of course, the percentage of the composition and preparation can vary and can conveniently be between about 5% and about 80% of the unit weight. Tablets, lozenges, pills, capsules, etc. can also contain the following: binders, such as acacia, tragacanth, corn starch or gelatin; excipients, such as dicalcium phosphate; disintegrating agents, such as corn starch, potato starch, alginic acid, etc.; lubricants, such as magnesium stearate; and sweetening agents, such as sucrose, lactose or saccharin, or flavoring agents, such as peppermint, wintergreen oil or cherry flavor. When the unit dosage form is a capsule, in addition to the above types of materials, it can also contain a liquid carrier. Various other materials can be present as coatings or for otherwise altering the physical form of the unit dosage. For example, tablets, pills or capsules can be coated with shellac, sugar or both. Syrups or elixirs can contain agents, sucrose as a sweetening agent, methyl paraben and propyl paraben as preservatives, dyes and flavoring agents, such as cherry flavor or orange flavor. Any material used in the preparation of any unit dosage form should be pharmaceutically acceptable in purity and substantially non-toxic at the amounts used. In addition, the pharmaceutical composition can be incorporated into sustained-release preparations and formulations.

[0350] The pharmaceutical compositions described herein may comprise one or more permeation enhancers that enhance the bioavailability of the polynucleotide molecules described herein. WO 2000 / 67798, Muranishi, 1990, Crit. Rev. Ther. Drug Carrier Systems, 7, 1, Lee et al., 1991, Crit. Rev. Ther. Drug Carrier Systems, 8, 91 are hereby incorporated by reference in their entireties. In some aspects, the permeation enhancer is intestinal. In some aspects, the permeation enhancer is transdermal. In some aspects, the permeation enhancer facilitates crossing of the blood-brain barrier. In some aspects, the permeation enhancer increases permeability in oral, nasal, buccal, pulmonary, vaginal, or corneal delivery models. In some aspects, the permeation enhancer is a fatty acid or a derivative thereof. In some aspects, the permeation enhancer is a surfactant or a derivative thereof. In some aspects, the permeation enhancer is a bile salt or a derivative thereof. In some aspects, the permeation enhancer is a chelating agent or a derivative thereof. In some aspects, the permeation enhancer is a non-chelating non-surfactant or a derivative thereof. In some aspects, the permeation enhancer is an ester or a derivative thereof. In some aspects, the permeation enhancer is an ether or a derivative thereof. In some aspects, the permeation enhancer is arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, glyceryl monooleate, dilaurin, 1-monocaprylin, 1-dodecylazacycloheptan-2-one, acyl carnitine, acyl choline, or a glycerol monoester, glycerol diester, or pharmaceutically acceptable salt thereof. In one specific aspect, the permeation enhancer is sodium decanoate (C10). In some aspects, the permeation enhancer is chenodeoxycholic acid (CDCA), ursodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycholic acid, glycochenodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-dihydrofusidate, or sodium glycodihydrofusidate. In some aspects, the permeation enhancer is polyoxyethylene-9-lauryl ether or polyoxyethylene-20-cetyl ether.

[0351] For the polynucleotide molecules described herein, suitable pharmaceutically acceptable salts include (i) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine; (ii) acid addition salts formed with inorganic acids such as, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid; and (iii) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid.

[0352] Although the hybrid polynucleotide constructs described herein may not require the use of excipients for delivery to target cells, the use of excipients can be advantageous in some aspects. Thus, for delivery to target cells, the hybrid polynucleotide molecules described herein can non-covalently associate with excipients to form complexes. Excipients can be used to alter biodistribution after delivery, enhance uptake, increase the half-life or stability of the strands in the hybrid polynucleotide constructs (e.g., improve nuclease resistance), and / or increase targeting to specific cell or tissue types.

[0353] Exemplary excipients include condensing agents (e.g., agents capable of attracting or binding nucleic acids through ionic or electrostatic interactions); fusogenic agents (e.g., agents capable of fusing cell membranes and / or transporting across cell membranes); proteins that target specific cell or tissue types (e.g., thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, or any other protein); lipids; lipopolysaccharides; lipid micelles or liposomes (e.g., formed from phospholipids such as phosphatidylcholine, fatty acids, glycolipids, ceramides, glycerides, cholesterol, or any combination thereof); nanoparticles (e.g., silica, lipid, carbohydrate, or other pharmaceutically acceptable polymeric nanoparticles); complexes (polyplexes) formed from cationic polymers and anionic agents (e.g., CRO), wherein exemplary cationic polymers include polyamines (e.g., polylysine, polyarginine, polyamidoamine, and polyethyleneimine); cholesterol; dendrimers (e.g., polyamidoamine (PAMAM) dendrimers); serum proteins (e.g., human serum albumin (HSA) or low density lipoprotein (LDL)); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid); lipids; synthetic polymers (e.g., polylysine (PLL), polyethyleneimine, poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, pseudopeptide-polyamine, peptidomimetic polyamine, or polyamine); cationic moieties (e.g., cationic lipids, cationic porphyrins, quaternary salts of polyamines, or α-helical peptides); multivalent sugars (e.g., multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, multivalent mannose, or multivalent fucose); vitamins (e.g., vitamin A, vitamin E, vitamin K, vitamin B, folic acid, vitamin B12, riboflavin, biotin, or pyridoxal); cofactors; or drugs that disrupt the cytoskeleton to increase uptake (e.g., paclitaxel, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, spongistatin A, phalloidin, swinholide A, indanocine, or myoservin).

[0354] Other therapeutic agents as described herein can be included in the pharmaceutical compositions described herein in combination with the polynucleotide molecules described herein.

[0355] Methods of treatment

[0356] In some aspects, described herein is a method of modulating the mRNA expression of the FXI gene in a subject, comprising: administering to the subject a polynucleic acid molecule described herein, a polynucleic acid molecule conjugate described herein, or a pharmaceutical composition described herein, thereby modulating the mRNA expression of the FXI gene in the subject.

[0357] In some aspects, compared to a negative control, the methods described herein reduce the expression of the FXI gene in the subject by about 10% or at least 10%. In some aspects, compared to a negative control, the methods described herein reduce the expression of the FXI gene in the subject by about 20% or at least 20%. In some aspects, compared to a negative control, the methods described herein reduce the expression of the FXI gene in the subject by about 30% or at least 30%. In some aspects, compared to a negative control, the methods described herein reduce the expression of the FXI gene in the subject by about 40% or at least 40%. In some aspects, compared to a negative control, the methods described herein reduce the expression of the FXI gene in the subject by about 50% or at least 50%. In some aspects, compared to a negative control, the methods described herein reduce the expression of the FXI gene in the subject by about 60% or at least 60%. In some aspects, compared to a negative control, the methods described herein reduce the expression of the FXI gene in the subject by about 70% or at least 70%. In some aspects, compared to a negative control, the methods described herein reduce the expression of the FXI gene in the subject by about 80% or at least 80%. In some aspects, compared to a negative control, the methods described herein reduce the expression of the FXI gene in the subject by about 90% or at least 90%. In some aspects, compared to a negative control, the methods described herein reduce the expression of the FXI gene in the subject by about 100%.

[0358] In some aspects, the methods described herein achieve an IC50 value of about 5 nM. In some aspects, the methods described herein achieve an IC50 value of about 10 nM. In some aspects, the methods described herein achieve an IC50 value of about 15 nM. In some aspects, the methods described herein achieve an IC50 value of about 20 nM. In some aspects, the methods described herein achieve an IC50 value of about 25 nM. In some aspects, the methods described herein achieve an IC50 value of about 30 nM. In some aspects, the methods described herein achieve an IC50 value of about 35 nM. In some aspects, the methods described herein achieve an IC50 value of about 40 nM. In some aspects, the methods described herein achieve an IC50 value of about 45 nM. In some aspects, the methods described herein achieve an IC50 value of about 50 nM. In some aspects, the methods described herein achieve an IC50 value of about 55 nM. In some aspects, the methods described herein achieve an IC50 value of about 60 nM. In some aspects, the methods described herein achieve an IC50 value of about 65 nM. In some aspects, the methods described herein achieve an IC50 value of about 70 nM. In some aspects, the methods described herein achieve an IC50 value of about 75 nM. In some aspects, the methods described herein achieve an IC50 value of about 80 nM. In some aspects, the methods described herein achieve an IC50 value of about 85 nM. In some aspects, the methods described herein achieve an IC50 value of about 90 nM. In some aspects, the methods described herein achieve an IC50 value of about 95 nM. In some aspects, the methods described herein achieve an IC50 value of about 100 nM.

[0359] In some aspects, the methods described herein achieve an IC50 value of about 1 μM. In some aspects, the methods described herein achieve an IC50 value of about 1.1 μM. In some aspects, the methods described herein achieve an IC50 value of about 1.2 μM. In some aspects, the methods described herein achieve an IC50 value of about 1.3 μM. In some aspects, the methods described herein achieve an IC50 value of about 1.4 μM. In some aspects, the methods described herein achieve an IC50 value of about 1.5 μM. In some aspects, the methods described herein achieve an IC50 value of about 2 μM. In some aspects, the methods described herein achieve an IC50 value of about 4 μM. In some aspects, the methods described herein achieve an IC50 value of about 6 μM. In some aspects, the methods described herein achieve an IC50 value of about 8 μM. In some aspects, the methods described herein achieve an IC50 value of about 10 μM. In some aspects, the methods described herein achieve an IC50 value of about 12 μM. In some aspects, the methods described herein achieve an IC50 value of about 13 μM. In some aspects, the methods described herein achieve an IC50 value of about 14 μM. In some aspects, the methods described herein achieve an IC50 value of about 15 μM. In some aspects, the methods described herein achieve an IC50 value of about 30 μM. In some aspects, the methods described herein achieve an IC50 value of about 35 μM. In some aspects, the methods described herein achieve an IC50 value of about 40 μM. In some aspects, the methods described herein achieve an IC50 value of about 50 μM. In some aspects, the methods described herein achieve an IC50 value of about 60 μM. In some aspects, the methods described herein achieve an IC50 value of about 80 μM. In some aspects, the methods described herein achieve an IC50 value of about 100 μM. In some aspects, the methods described herein achieve an IC50 value of about 120 μM. In some aspects, the methods described herein achieve an IC50 value of about 160 μM.

[0360] In some aspects, the present disclosure describes a method of modulating FXI or FXIa protein levels or FXI or FXIa activity in a subject in need thereof, comprising administering to the subject a polynucleotide molecule described herein, a polynucleotide conjugate described herein, or a pharmaceutical composition described herein, wherein the polynucleotide molecule described herein, the polynucleotide conjugate described herein, or the pharmaceutical composition described herein modulates FXI or FXIa protein levels or FXI or FXIa activity in the subject.

[0361] In other aspects, compared to a negative control, the methods described herein reduce the level of FXI or FXIa in a subject by about 10% or at least 10%. In some aspects, compared to a negative control, the methods described herein reduce the level of FXI or FXIa in a subject by about 20% or at least 20%. In some aspects, compared to a negative control, the methods described herein reduce the level of FXI or FXIa in a subject by about 30% or at least 30%. In some aspects, compared to a negative control, the methods described herein reduce the level of FXI or FXIa in a subject by about 40% or at least 40%. In some aspects, compared to a negative control, the methods described herein reduce the level of FXI or FXIa in a subject by about 50% or at least 50%. In some aspects, compared to a negative control, the methods described herein reduce the level of FXI or FXIa in a subject by about 60% or at least 60%. In some aspects, compared to a negative control, the methods described herein reduce the level of FXI or FXIa in a subject by about 70% or at least 70%. In some aspects, compared to a negative control, the methods described herein reduce the level of FXI or FXIa in a subject by about 80% or at least 80%. In some aspects, compared to a negative control, the methods described herein reduce the level of FXI or FXIa in a subject by about 90% or at least 90%. In some aspects, compared to a negative control, the methods described herein reduce the level of FXI or FXIa in a subject by about 100%.

[0362] In some aspects, a subject receiving the methods described herein has thrombosis. In some cases, a subject receiving the methods described herein has deep vein thrombosis (DVT). In other aspects, a subject receiving the methods described herein has an ischemic stroke. In other aspects, a subject receiving the methods described herein has atherosclerosis. In other aspects, a subject receiving the methods described herein has a myocardial infarction. In other aspects, a subject receiving the methods described herein has venous thromboembolism (VTE). In other aspects, a subject receiving the methods described herein has a cardiovascular disease. In other aspects, a subject receiving the methods described herein has ischemic heart disease (acute coronary syndrome). In other aspects, a subject receiving the methods described herein has a pulmonary embolism.

[0363] Exemplary embodiments

[0364] Embodiment 1. A polynucleotide molecule for regulating the expression of coagulation factor XI (FXI) gene, wherein the polynucleotide molecule comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90% identical to the nucleic acid sequences in Tables 1 - 2 and Tables 7 - 9.

[0365] Embodiment 2. The polynucleotide molecule according to Embodiment 1, wherein the polynucleotide molecule is a single-stranded nucleic acid molecule.

[0366] Embodiment 3. The polynucleic acid molecule according to Embodiment 2, wherein the single-stranded nucleic acid molecule comprises at least 14, 15, 16, 17, 18 consecutive nucleotides complementary to a nucleic acid sequence selected from SEQ ID NOs: 101-150 and 220 and having no more than 1, 2, 3, 4 mismatches.

[0367] Embodiment 4. The polynucleic acid molecule according to Embodiment 2, wherein the single-stranded nucleic acid molecule comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95% complementary to a nucleic acid sequence selected from SEQ ID NOs: 101-150 and 220.

[0368] Embodiment 5. The polynucleic acid molecule according to Embodiment 2, wherein the single-stranded nucleic acid molecule comprises at least 14, 15, 16, 17, 18 consecutive nucleotides identical to a nucleic acid sequence selected from SEQ ID NOs: 1-50 and 215-216 and having no more than 1, 2, 3, 4 mismatches.

[0369] Embodiment 6. The polynucleic acid molecule according to Embodiment 2, wherein the single-stranded nucleic acid molecule comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 1-50 and 215-216.

[0370] Embodiment 7. The polynucleic acid molecule according to Embodiment 1, wherein the polynucleic acid molecule is a double-stranded nucleic acid molecule comprising a sense strand (passenger strand) and an antisense strand (guide strand).

[0371] Embodiment 8. The polynucleic acid molecule according to Embodiment 7, wherein the sense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 101-150 and 220.

[0372] Embodiment 9. The polynucleic acid molecule according to any one of Embodiments 7-8, wherein the antisense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 1-50 and 215-216.

[0373] Embodiment 10. The polynucleic acid molecule according to any one of Embodiments 7-9, wherein the sense strand comprises a nucleic acid sequence comprising at least 14, 15, 16, 17, 18, 19 or 20 consecutive sequences of a nucleic acid sequence selected from SEQ ID NOs: 101-150 and 220 and having no more than 1, 2, 3 or 4 mismatches.

[0374] Embodiment 11. The polynucleic acid molecule according to any one of Embodiments 7-10, wherein the antisense strand comprises a nucleic acid sequence comprising at least 14, 15, 16, 17, 18, 19, 20, 21 or 22 consecutive sequences selected from SEQ ID NOs: 1-50 and 215-216 and having no more than 1, 2, 3 or 4 mismatches.

[0375] Embodiment 12. The polynucleic acid molecule according to any one of Embodiments 7-11, wherein the sense strand comprises a nucleic acid sequence selected from SEQ ID NOs: 101-150 and 220, and the antisense strand comprises a nucleic acid sequence selected from SEQ ID NOs: 1-50 and 215-216.

[0376] Embodiment 13. The polynucleic acid molecule according to any one of Embodiments 7-12, wherein the sense strand comprises a nucleic acid sequence that is at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150 and 220.

[0377] Embodiment 14. The polynucleic acid molecule according to any one of Embodiments 7-13, wherein the antisense strand comprises a nucleic acid sequence that is at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50 and 215-216.

[0378] Embodiment 15. The polynucleic acid molecule according to any one of Embodiments 7-14, wherein the sense strand comprises a nucleic acid sequence selected from SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150 and 220, and the antisense strand comprises a nucleic acid sequence selected from SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50 and 215-216.

[0379] Embodiment 16. The polynucleic acid molecule according to any one of Embodiments 5-15, wherein the antisense strand comprises 5'-nNfnnnNfnNfNfnnnnNfnNfnnnnnnn-3', 5'-nNfnnnNfnnnnnnnNfnNfnnnnnnn-3', 5'-nNfnnnnNfnnnnNfnNfnnnnnnnnn-3', 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnnn-3' or 5'-nNfnnnnnnnnnNfnNfnNfnnnnnnn-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0380] Embodiment 17. The polynucleic acid molecule according to any one of Embodiments 1-16, wherein the polynucleic acid molecule comprises (1) a 2'-fluoro-modified nucleotide; (2) a 2'-O-methyl-modified nucleotide; (3) a 2'-deoxy-modified nucleotide; or (4) a modified internucleotide linkage.

[0381] Embodiment 18. The polynucleic acid molecule according to any one of Embodiments 1-17, wherein the polynucleic acid molecule comprises at least two consecutive modified internucleotide linkages at the 5'-end and / or 3'-end.

[0382] Embodiment 19. The polynucleic acid molecule according to any one of Embodiments 7-18, wherein at least two of the three internucleotide linkages at the 3'-end of the antisense strand are replaced by modified internucleotide linkages.

[0383] Embodiment 20. The polynucleic acid molecule according to any one of Embodiments 7-19, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3', 5'-nnnnnnnnNfNfNfnnnnnnnnnn-3' or 5'-nnnnnnNfnNfnNfnnnnnnnnnn-invdN-invdN-3', where "Nf" represents a 2'-fluoro-modified nucleotide, and where "n" represents a 2'-O-methyl-modified nucleotide, and where "invdN" represents an inverted deoxynucleotide.

[0384] Embodiment 21. The polynucleic acid molecule according to any one of Embodiments 7-19, wherein the sense strand comprises 5'-NfnNfnNfnNfnNfNfNfnNfnNfnNfnNfnNf-3', and wherein the antisense strand comprises 5'-nNfnNfnNfnNfnNfnnnNfnNfnNfnNfnnn-3', where "Nf" represents a 2'-fluoro-modified nucleotide, and where "n" represents a 2'-O-methyl-modified nucleotide.

[0385] Embodiment 22. The polynucleic acid molecule according to any one of Embodiments 7-19, wherein the sense strand comprises 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3', and wherein the antisense strand comprises 5'-nNfnnnNfnNfNfnnnnNfnNfnnnnnnn-3', where "Nf" represents a 2'-fluoro-modified nucleotide, and where "n" represents a 2'-O-methyl-modified nucleotide.

[0386] Embodiment 23. The polynucleic acid molecule according to any one of Embodiments 7-19, wherein the sense strand comprises 5'-nnnnnnnnNfnNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnnnnnnnnn-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0387] Embodiment 24. The polynucleic acid molecule according to any one of Embodiments 7-19, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnNfnnnnnnn-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0388] Embodiment 25. The polynucleic acid molecule according to any one of Embodiments 7-19, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', wherein the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnnn-3', wherein "Nf" represents a 2'-fluoro-modified nucleotide, and wherein "n" represents a 2'-O-methyl-modified nucleotide.

[0389] Embodiment 26. The polynucleic acid molecule according to any one of Embodiments 17-25, wherein the modified internucleotide bond is a phosphorothioate internucleotide bond.

[0390] Embodiment 27. The polynucleic acid molecule according to Embodiment 26, wherein the modified internucleotide bond comprises a stereochemically enriched phosphorothioate internucleotide bond.

[0391] Embodiment 28. The polynucleic acid molecule according to any one of Embodiments 17-27, wherein the modified internucleotide bond is an SP chiral phosphorothioate bond between nucleotides.

[0392] Embodiment 29. The polynucleic acid molecule according to any one of Embodiments 17-28, wherein the polynucleic acid comprises a plurality of modified internucleotide bonds, and at least 1, 2, 3, or 4 of the plurality of modified internucleotide bonds are stereochemically enriched phosphorothioate internucleotide bonds.

[0393] Embodiment 30. The polynucleic acid molecule according to Embodiment 29, wherein the stereochemically enriched phosphorothioate internucleotide bond comprises both R-isomers and S-isomers.

[0394] Embodiment 31. The polynucleic acid molecule as described in one of Embodiments 29-30, wherein the stereochemically enriched phosphorothioate is located between two consecutive nucleosides, and the two nucleosides are two of the six 5' or 3' terminal nucleosides of the sense strand or the antisense strand.

[0395] Embodiment 32. The polynucleic acid molecule as described in any one of Embodiments 1-31, wherein the polynucleic acid molecule comprises a nucleoside substitution containing a hypoxanthine nucleobase.

[0396] Embodiment 33. The polynucleic acid molecule as described in Embodiment 32, wherein the nucleoside substitution containing a hypoxanthine nucleobase is an inosine substitution.

[0397] Embodiment 34. The polynucleic acid molecule as described in Embodiment 33, wherein the inosine substitution is within the seed region of the antisense strand.

[0398] Embodiment 35. The polynucleic acid molecule as described in any one of Embodiments 33-34, wherein the inosine substitution is within 7 nucleotides from the 5' end of the antisense strand.

[0399] Embodiment 36. The polynucleic acid molecule as described in any one of Embodiments 33-35, wherein the inosine substitution is in the first nucleotide from the 5' end of the antisense strand.

[0400] Embodiment 37. The polynucleic acid molecule as described in Embodiment 33, wherein the inosine substitution comprises 2'-O-methylinosine-3'-phosphate.

[0401] Embodiment 38. The polynucleic acid molecule as described in any one of Embodiments 1-37, wherein the first nucleotide from the 5' end of the antisense strand is substituted with uridine or adenosine.

[0402] Embodiment 39. The polynucleic acid molecule as described in Embodiment 38, wherein the uridine comprises 2'-O-methyluridine-3'-phosphate, or wherein the adenosine comprises 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0403] Embodiment 40. The polynucleic acid molecule as described in any one of Embodiments 1-39, wherein the polynucleic acid molecule comprises an abasic substitution.

[0404] Embodiment 41. The polynucleic acid molecule as described in Embodiment 40, wherein the abasic substitution is located at the 5th or 7th nucleotide from the 5' end.

[0405] Embodiment 42. The polynucleic acid molecule as described in one of Embodiments 1-41, wherein the cytotoxicity of the polynucleic acid molecule is reduced compared to the unmodified polynucleic acid.

[0406] Embodiment 43. The polynucleic acid molecule according to any one of Embodiments 7-42, wherein the sense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 151-200, 214, and 221.

[0407] Embodiment 44. The polynucleic acid molecule according to any one of Embodiments 7-43, wherein the antisense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 51-100, 201-213, and 217-219.

[0408] Embodiment 45. The polynucleic acid molecule according to any one of Embodiments 7-44, wherein the sense strand comprises a nucleic acid sequence selected from the nucleic acid sequences of SEQ ID NOs: 151-200, 214, and 221, and the antisense strand comprises a nucleic acid sequence selected from the nucleic acid sequences of SEQ ID NOs: 51-100, 201-213, and 217-219.

[0409] Embodiment 46. The polynucleic acid molecule according to any one of Embodiments 1-45, wherein the polynucleic acid molecule is 19-25 base pairs in length.

[0410] Embodiment 47. The polynucleic acid molecule according to any one of Embodiments 1-46, wherein the polynucleic acid molecule is 21-23 base pairs in length.

[0411] Embodiment 48. A polynucleic acid molecule for regulating the expression of the coagulation factor XI (FXI) gene, wherein the polynucleic acid molecule comprises:

[0412] (a) an antisense strand comprising a nucleotide sequence selected from SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216 and a sense strand comprising a nucleotide sequence selected from SEQ ID NOs: 104, 106-107,

[0413] 109-111, 113-114, 135, 150, or 220; or

[0414] (b) an antisense strand comprising a nucleotide sequence selected from SEQ ID NOs: 54, 56-57, 59-61, 63-64, 85, 100,

[0415] 201-213, and 217-219 and a sense strand comprising a nucleotide sequence selected from SEQ ID NOs:

[0416] The sense strand of the nucleotide sequences of 154, 156-157, 159-161, 163-164, 185, 200, 214 and 221.

[0417] Embodiment 49. The polynucleotide molecule according to embodiment 48, wherein the polynucleotide molecule comprises:

[0418] (a) an antisense strand comprising the nucleotide sequence AUAAAUGUCUUUGUUGCAAGCGC (SEQ ID NO:11) and a sense strand comprising the nucleotide sequence GCUUGCAACAAAGACAUUUAU (SEQ ID NO:111);

[0419] (b) an antisense strand comprising the nucleotide sequence AUGUCUUUGUUGCAAGCGCUUAU (SEQ ID NO:9) and a sense strand comprising the nucleotide sequence AAGCGCUUGCAACAAAGACAU (SEQ ID NO:109);

[0420] (c) an antisense strand comprising the nucleotide sequence AAUGUCUUUGUUGCAAGCGCUUA (SEQ ID NO:10) and a sense strand comprising the nucleotide sequence AGCGCUUGCAACAAAGACAUU (SEQ ID NO:110);

[0421] (d) an antisense strand comprising the nucleotide sequence UUAUAGUUUAUGCCCUUCAUGUC (SEQ ID NO:13) and a sense strand comprising the nucleotide sequence CAUGAAGGGCAUAAACUAUAA

[0422] (SEQ ID NO:113);

[0423] (e) an antisense strand comprising the nucleotide sequence AUAGGUAAAAAACUGGCAGCGGA (SEQ ID NO:35) and a sense strand comprising the nucleotide sequence CGCUGCCAGUUUUUUACCUAU

[0424] (SEQ ID NO:135);

[0425] (f) an antisense strand comprising the nucleotide sequence IUAAAUGUCUUUGUUGCAAGCGC (SEQ ID NO:215) and a sense strand comprising the nucleotide sequence GCUUGCAACAAAGACAUUUAU

[0426] (SEQ ID NO:111); or

[0427] (g) The antisense strand of the nucleotide sequence containing UUAAAUGUCUUUGUUGCAAGCGC (SEQ ID NO:216) and the sense strand of the nucleotide sequence containing GCUUGCAACAAAGACAUUUAA

[0428] (SEQ ID NO:220).

[0429] Embodiment 50. A polynucleotide molecule for regulating the expression of coagulation factor XI (FXI) gene, wherein the polynucleotide molecule comprises:

[0430] (a) The antisense strand of the nucleotide sequence containing asUfsaaaugucuuUfgUfuGfcaagcsgsc (SEQ ID NO:61) and the sense strand of the nucleotide sequence containing gscsuugcAfaCfaAfagacauuuau (SEQ ID NO:161);

[0431] (b) The antisense strand of the nucleotide sequence containing asUfsaaaugucuuUfgUfuGfcsaagcsgsc (SEQ ID NO:211) and the sense strand of the nucleotide sequence containing gscsuugcAfaCfaAfagacauuuau (SEQID NO:161);

[0432] (c) The antisense strand of the nucleotide sequence containing asUfsaaaugucuuUfgUfsuGfcaagcsgsc (SEQ ID NO:212) and the sense strand of the nucleotide sequence containing gscsuugcAfaCfaAfagacauuuau (SEQID NO:161);

[0433] (d) The antisense strand of the nucleotide sequence containing asUfsaaaugucuuUfgUfuGfcaasgcsgsc (SEQ ID NO:213) and the sense strand of the nucleotide sequence containing gscsuugcAfaCfaAfagacauuuau (SEQID NO:161);

[0434] (e) The antisense strand of the nucleotide sequence containing asUfsaaaugucuuUfgUfuGfcaagcsgsc (SEQ ID NO:61) and the sense strand of the nucleotide sequence containing gscsuugcAfaCfaAfagacauuuau (invdT)(invdT) (SEQ ID NO:214);

[0435] (f) The antisense strand of the nucleotide sequence containing asUfsgucuUfuguuGfcAfaGfcgcuusasu (SEQ ID NO:204) and the sense strand of the nucleotide sequence containing asasgcgcUfuGfcAfacaaagacau (SEQ ID NO:159);

[0436] (g) The antisense strand of the nucleotide sequence containing asAfsugucUfuuguUfgCfaAfgcgcususa (SEQ ID NO:205) and the sense strand of the nucleotide sequence containing asgscgcuUfgCfaAfcaaagacauu (SEQ ID NO:160);

[0437] (h) The antisense strand of the nucleotide sequence containing asUfsaaauGfucuuUfgUfuGfcaagcsgsc (SEQ ID NO:206) and the sense strand of the nucleotide sequence containing gscsuugcAfaCfaAfagacauuuau (SEQ ID NO:161);

[0438] (i) The antisense strand of the nucleotide sequence containing usUfsauagUfuuauGfcCfcUfucaugsusc (SEQ ID NO:207) and the sense strand of the nucleotide sequence containing csasugaaGfgGfcAfuaaacuauaa (SEQ ID NO:163);

[0439] (j) The antisense strand of the nucleotide sequence containing asUfsagguAfaaaaAfcUfgGfcagcgsgsa (SEQ ID NO:209) and the sense strand of the nucleotide sequence containing csgscugcCfaGfuUfuuuuaccuau (SEQ ID NO:185);

[0440] (k) The antisense strand of the nucleotide sequence containing isUfsaaaugucuuUfgUfuGfcaagcsgsc (SEQ ID NO:217) and the sense strand of the nucleotide sequence containing gscsuugcAfaCfaAfagacauuuau (SEQ ID NO:161);

[0441] (l) The antisense strand of the nucleotide sequence containing usUfsaaauGfucuuUfgUfuGfcaagcsgsc (SEQ ID NO:218) and the sense strand of the nucleotide sequence containing gscsuugcAfaCfaAfagacauuuaa (SEQ ID NO:222); or

[0442] (m) The antisense strand of the nucleotide sequence containing a4sUfsaaauGfucuuUfgUfuGfcaagcsgsc (SEQ ID NO:219) and the sense strand of the nucleotide sequence containing gscsuugcAfaCfaAfagacauuuau (SEQ ID NO:161);

[0443] wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u"

[0444] refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "dU"

[0445] refers to 2'-deoxyuridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate;

[0446] "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiophosphate, "invdT"

[0447] refers to 3'-inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, and "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0448] Embodiment 51. A polynucleic acid molecule conjugate for regulating the expression of the coagulation factor XI (FXI) gene, wherein the polynucleic acid molecule conjugate comprises a polynucleic acid molecule as described in any one of Embodiments 1-50 and an asialoglycoprotein receptor targeting moiety.

[0449] Embodiment 52. The polynucleic acid molecule conjugate as described in Embodiment 51, wherein the polynucleic acid molecule and the asialoglycoprotein receptor targeting moiety are coupled via a linker.

[0450] Embodiment 53. The polynucleic acid molecule conjugate as described in Embodiment 52, wherein the linker comprises the following formula (IV),

[0451] At least one of Y1 and Y2 is a nucleotide in the polynucleotide molecule.

[0452] Embodiment 54. The polynucleotide molecule conjugate according to Embodiment 51, wherein Y1 is the last nucleotide at the 3'-end of the sense strand of the polynucleotide molecule, or wherein Y2 is the first nucleotide at the 5'-end of the sense strand of the polynucleotide molecule.

[0453] Embodiment 55. The polynucleotide molecule conjugate according to Embodiment 54, wherein Y1 and Y2 are two consecutive nucleotides in the polynucleotide molecule.

[0454] Embodiment 56. The polynucleotide molecule conjugate according to any one of Embodiments 51-55, wherein the asialoglycoprotein receptor targeting moiety comprises N-acetylgalactosamine (GalNAc) or galactose.

[0455] Embodiment 57. The polynucleotide molecule conjugate according to any one of Embodiments 51-56, wherein the linker and the asialoglycoprotein receptor targeting moiety carrying the last nucleotide at the 3'-end of the sense strand of the polynucleotide molecule are as shown in the following formula:

[0456]

[0457]

[0458] wherein Z in formula (V'), (V''), (V''') or (V'''') is -H, -OH, -O-methyl, -F or -O-methoxyethyl, and R in formula (V') is adenine, uracil, guanine, cytosine, thymine, abasic, etc.

[0459] Embodiment 58. A pharmaceutical composition comprising the polynucleotide molecule according to any one of Embodiments 1-57 or the polynucleotide molecule conjugate according to any one of Embodiments 40-46, and a pharmaceutically acceptable excipient.

[0460] Embodiment 59. The pharmaceutical composition according to Embodiment 58, wherein the pharmaceutical composition is formulated as a nanoparticle preparation.

[0461] Embodiment 60. The pharmaceutical composition according to Embodiment 58 or 59, wherein the pharmaceutical composition is formulated for parenteral, oral, intranasal, buccal, rectal, transdermal, intravenous, subcutaneous or intrathecal administration.

[0462] Embodiment 61. A method for modulating the mRNA expression of coagulation factor XI (FXI) gene in a subject, comprising: administering to the subject a polynucleic acid molecule as described in any one of Embodiments 1-57 or a polynucleic acid molecule conjugate as described in any one of Embodiments 40-46, or a pharmaceutical composition as described in Embodiments 58-60, thereby modulating the mRNA expression of the FXI gene in the subject.

[0463] Embodiment 62. A method for modulating the level of FXI or FXIa protein or the activity of FXI or FXIa in a subject in need thereof, comprising: administering to the subject a polynucleic acid molecule as described in any one of Embodiments 1-57 or a polynucleic acid molecule conjugate as described in any one of Embodiments 40-46, or a pharmaceutical composition as described in Embodiments 58-60, thereby modulating the level of FXI or FXIa protein or the activity of FXI or FXIa in the subject.

[0464] Embodiment 63. The method according to Embodiment 62, wherein the subject in need thereof suffers from thrombosis or its symptoms.

[0465] Examples

[0466] These examples are provided for illustrative purposes only and do not limit the scope of the claims provided herein. For all sequences presented herein, oligonucleotide structures are written from left to right (5' to 3'). Unless otherwise specified, the monomer codes present in the oligonucleotide codes are linked by 5'-3' phosphodiester bonds (the 3' nucleotide bond is behind when written from left to right). The abbreviations of nucleotide monomers used in the representation of oligonucleotide structures are as follows. "A" represents adenosine-3'-phosphate; "a" represents 2'-O-methyladenosine-3'-phosphate; "Af" represents 2'-fluoroadenosine-3'-phosphate; "dA" represents 2'-deoxyadenosine-3'-phosphate; "C" represents cytidine-3'-phosphate; "c" represents 2'-O-methylcytidine-3'-phosphate; "Cf" represents 2'-fluorocytidine-3'-phosphate; "dC" represents 2'-deoxycytidine-3'-phosphate; "G" represents guanosine-3'-phosphate; "g" represents 2'-O-methylguanosine-3'-phosphate; "Gf" represents 2'-fluoroguanosine-3'-phosphate; "dG" represents 2'-deoxyguanosine-3'-phosphate; "U" represents uridine-3'-phosphate; "u" represents 2'-O-methyluridine-3'-phosphate; "Uf" represents 2'-fluorouridine-3'-phosphate; "dU" represents 2'-deoxyuridine-3'-phosphate; "T" represents 5-methyluridine-3'-phosphate; "t" represents 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" represents 2'-fluoro-5-methyluridine-3'-phosphate; "dT" represents thymidine-3'-phosphate; and "s" represents 3'-thiophosphate.

[0467] Example 1 - In Vitro Efficacy of FXI-Targeting siRNA

[0468] A set of siRNAs (shown in Table 1) was generated, and each passenger / sense strand was conjugated to a three-branched GalNAc moiety (GalNAc-L96). These siRNA-GalNAc conjugates were evaluated in vitro in primary human hepatocytes.

[0469] Frozen primary human hepatocytes were thawed and plated at a density of 5.4 x 10 4 cells per well on collagen-coated 96-well plates. Hepatocytes were treated by incubation for 48 hours with the siRNAs shown in Table 1 (each passenger / sense strand conjugated to a three-branched GalNAc moiety) in the absence of transfection reagent (free uptake). Cells were treated with siRNA at concentrations of 100 nM, 30 nM, or 10 nM. At the end of the incubation period, cells were lysed, mRNA was isolated, and the expression of the target gene was measured by qPCR and normalized to the housekeeping gene human GapDH using standard protocols. Three replicate experiments were performed for each siRNA at each dose level. The in vitro potency of the siRNAs is listed in Table 3. The results from Table 3 were graphed and are shown in Figure 1 and Figure 2 . Table 4 shows the results from the positive control.

[0470] Example 2 - Drug Response Curves of Selected FXI siRNAs

[0471] A selected set of FXI-targeting siRNAs shown in Table 2 was used, and each passenger / sense strand was conjugated to a three-branched GalNAc moiety via an X2 linker (see formula (V')). For dose-response curve determination, primary human hepatocytes were seeded at an appropriate density into 96-well plates. At the time of seeding the cells, siRNAs conjugated with the 3'-sense strand X2-GalNAc (via formula V') were added in triplicate at 6 concentrations for free uptake. Concentrations of 1000, 100, 10, 1, 0.1, 0.01 nM were evaluated. At 48 hours after incubation, cells were harvested to measure the FXI mRNA remaining by RT-PCR and normalized to the housekeeping gene (GAPDH). The IC50 values and maximum FXI mRNA silencing were determined, and the results are listed in Table 5.

[0472] Example 3 - In Vivo Efficacy of FXI-Targeting siRNA in Cynomolgus Monkeys

[0473] The siRNA SRS-000007 targeting FXI shown in Table 2 was used, and its passenger / sense strand (SEQ ID NO: 161) was conjugated to a triantennary GalNAc moiety via an X2 linker at the 3'-end (see formula (V')). Female cynomolgus monkeys (n = 4 per treatment group / siRNA) were administered saline or a single subcutaneous dose level of SRS-000007 at 1 mg / kg or 5 mg / kg. Plasma samples were collected before dosing (D7, D1) and at 4, 8, 11, 15, 22, 29, 36, 43, 50, 57, 64, 71, 78, and 85 days post-treatment. FXI circulating protein levels in all plasma samples were analyzed using an FXI ELISA assay (Affinity Biologicals, product code FXI-AG). The results are shown in Figure 3 . The results were plotted as the percentage change in circulating FXI protein levels relative to the pre-dose D1 time point.

[0474] Example 4 - In Vitro Dose Response in Human Primary Hepatocytes

[0475] The SRS-000007 targeting FXI shown in Table 2 was used, and the passenger / sense strand was conjugated to a triantennary GalNAc moiety via an X2 linker (see Formula (V’) ). For dose response curve determination, human primary hepatocytes from three different donor batches were seeded into 96-well plates at an appropriate density. At the same time as seeding the cells, SRS-000007 conjugated with the 3'-sense strand X2-GalNAc (via formula V') was added in triplicate at 6 concentrations for free uptake. Concentrations of 1000, 100, 10, 1, 0.1, 0.01 nM were evaluated. At 72 hours post-incubation, the cells were harvested to measure the FXI mRNA remaining by RT-PCR and normalized against a housekeeping gene (GAPDH). The IC50 value and maximum FXI mRNA silencing were determined, and the results are listed in Table 6. The dose response curves for each donor were plotted and depicted in Figure 4 .

[0476] Example 5 - In Vivo Efficacy of siRNA Targeting FXI in Cynomolgus Monkeys

[0477] Use the siRNAs targeting FXI shown in Table 7. For siRNAs SRS-000007, SRS-000236, SRS-000255, and SRS-000257, each passenger / sense strand is conjugated to a tribranched GalNAc moiety via an X2 linker at the 3'-end (see formula (V')). For siRNA SRS-000258, the passenger / sense strand is conjugated to a tribranched GalNAc moiety via an X2 linker at the 5'-end (see formula (V'')). Female cynomolgus monkeys (n = 3 per treatment group / siRNA) were dosed at a single subcutaneous dose level of 0.75 mg / kg. Plasma samples were collected before dosing (D-7, D1) and at 4, 8, 11, 15, 22, 29, 36, 43, 50, 57, 64, 71, 78, and 85 days after treatment. The FXI circulating protein levels in all plasma samples were analyzed using an FXI ELISA assay (Affinity Biologicals, product code FXI-AG). The results are shown in Figure 5 . The results were plotted as the percentage change in the circulating FXI protein level relative to the mean of the pre-dose time points.

[0478] Example 6 - In Vivo Efficacy of siRNAs Targeting FXI in Cynomolgus Monkeys

[0479] Use the siRNAs targeting FXI shown in Table 8. Each passenger / sense strand is conjugated to a tribranched GalNAc moiety via an X2 linker at the 3'-end (see formula (V')). Male cynomolgus monkeys (n = 3 per treatment group / siRNA) were dosed at a single subcutaneous dose level of 1.0 mg / kg. Plasma samples were collected before dosing (D-15, D-8, and D1) and at 8, 11, 15, 22, 29, 36, 43, 50, 57, 64, 71, 78, 85, and 113 days after treatment. The FXI circulating protein levels in all plasma samples were analyzed using an FXI ELISA assay (Affinity Biologicals, product code FXI-AG). The results are shown in Figure 6 . The results were plotted as the percentage change in the circulating FXI protein level relative to the mean of the pre-dose time points.

[0480] Example 7 - In Vitro Efficacy of siRNAs Targeting FXI

[0481] Using SRS-000007 and SRS-002331 from Table 9, and the passenger / sense strand was conjugated to the three-branched GalNAc moiety via the X2 linker (see formula (V’)). For determination of the dose-response curve, human primary hepatocytes from two different donor batches were seeded into 96-well plates at an appropriate density. At the same time as seeding the cells, siRNA was added in triplicate at 8 concentrations for free uptake. Concentrations of 10000, 1000, 100, 10, 1, 0.1, 0.01, and 0.001 nM were evaluated. At 72 hours after incubation, the cells were harvested to measure the remaining FXI mRNA by RT-PCR and normalized against the housekeeping gene (GAPDH). The IC50 value and the maximum FXI mRNA silencing were determined and the results are listed in Table 10. The dose-response curves for each donor were plotted and depicted in Figure 7 in.

[0482] Example 8 - In Vivo Efficacy of siRNA Targeting FXI in Cynomolgus Monkeys

[0483] The siRNA targeting FXI shown in Table 9 was used. Each passenger / sense strand was conjugated to the three-branched GalNAc moiety at the 3’ end via the X2 linker (see formula (V’)). Cynomolgus monkeys were dosed subcutaneously. Plasma samples were collected before dosing and at different time points after treatment. The FXI circulating protein levels in all plasma samples were analyzed using the FXI ELISA assay (Affinity Biologicals, product code FXI-AG) and compared to the pre-dose levels.

[0484] Although the preferred aspects of the present disclosure have been shown and described herein, it will be apparent to those skilled in the art that such aspects are provided by way of example only. Many variations, changes, and substitutions will now occur to those skilled in the art without departing from the present disclosure. It should be understood that various alternatives to the aspects of the present disclosure described herein may be employed in practicing the present disclosure. The appended claims are intended to define the scope of the present disclosure and thereby cover the methods and structures within the scope of these claims and their equivalents.

[0485]

[0486]

[0487]

[0488]

[0489] Table 3. Results of In Vitro Efficacy of siRNA Targeting FXI

[0490]

[0491]

[0492] Table 4. Positive control results for the in vitro efficacy of FXI-targeting siRNA

[0493]

[0494] Table 5. Results of free uptake dose response in human primary hepatocytes

[0495]

[0496]

[0497] Table 6. Results of free uptake dose response in three human primary hepatocyte donors

[0498]

[0499]

[0500]

[0501]

Claims

1. A polynucleic acid molecule for regulating the expression of coagulation factor XI (FXI) gene, wherein the polynucleic acid molecule comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90% identical to the nucleic acid sequences in Tables 1 - 2 and Tables 7 - 9.

2. The polynucleic acid molecule according to claim 1, wherein the polynucleic acid molecule is a double-stranded nucleic acid molecule comprising a sense strand (passenger strand) and an antisense strand (guide strand).

3. The polynucleic acid molecule according to claim 2, wherein the sense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to the nucleic acid sequences selected from SEQ ID NO: 101 - 150 and 220.

4. The polynucleic acid molecule according to any one of claims 2 - 3, wherein the antisense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to the nucleic acid sequences selected from SEQ ID NO: 1 - 50 and 215 - 216.

5. The polynucleic acid molecule according to any one of claims 2 - 4, wherein the sense strand comprises a nucleic acid sequence having at least 14, 15, 16, 17, 18, 19 or 20 consecutive sequences selected from SEQ ID NO: 101 - 150 and 220 and having no more than 1, 2, 3 or 4 mismatches.

6. The polynucleic acid molecule according to any one of claims 2 - 5, wherein the antisense strand comprises a nucleic acid sequence having at least 14, 15, 16, 17, 18, 19, 20, 21 or 22 consecutive sequences selected from SEQ ID NO: 1 - 50 and 215 - 216 and having no more than 1, 2, 3 or 4 mismatches.

7. The polynucleic acid molecule according to any one of claims 2 - 6, wherein the sense strand comprises the nucleic acid sequences of SEQ ID NO: 101 - 150 and 220, and the antisense strand comprises the nucleic acid sequences of SEQ ID NO: 1 - 50 and 215 - 216.

8. The polynucleic acid molecule according to any one of claims 2 - 7, wherein the sense strand comprises a nucleic acid sequence that is at least 90%, at least 95% identical to the nucleic acid sequences selected from SEQ ID NO: 104, 106 - 107, 109 - 111, 113 - 114, 135, 150 and 220.

9. The polynucleic acid molecule according to any one of claims 2 - 8, wherein the antisense strand comprises a nucleic acid sequence that is at least 90%, at least 95% identical to the nucleic acid sequences selected from SEQ ID NO: 4, 6 - 7, 9 - 11, 13 - 14, 35, 50 and 215 - 216.

10. The polynucleic acid molecule according to any one of claims 2 - 9, wherein the sense strand comprises the nucleic acid sequences selected from SEQ ID NO: 104, 106 - 107, 109 - 111, 113 - 114, 135, 150 and 220, and the antisense strand comprises the nucleic acid sequences selected from SEQ ID NO: 4, 6 - 7, 9 - 11, 13 - 14, 35, 50 and 215 - 216.

11. The polynucleic acid molecule according to any one of claims 2-10, wherein the antisense strand comprises 5'-nNfnnnNfnNfNfnnnnNfnNfnnnnnnn-3', 5'-nNfnnnNfnnnnnnnNfnNfnnnnnnn-3', 5'-nNfnnnnNfnnnnNfnNfnnnnnnnnn-3', 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnnn-3' or 5'-nNfnnnnnnnnnNfnNfnNfnnnnnnn-3', where "Nf" represents a 2'-fluoro-modified nucleotide, and where "n" represents a 2'-O-methyl-modified nucleotide.

12. The polynucleic acid molecule according to any one of claims 2-11, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3', 5'-nnnnnnnnNfNfNfnnnnnnnnnn-3' or 5'-nnnnnnNfnNfnNfnnnnnnnnnn-invdN-invdN-3', where "Nf" represents a 2'-fluoro-modified nucleotide, and where "n" represents a 2'-O-methyl-modified nucleotide, and where "invdN" represents an inverted deoxynucleotide.

13. The polynucleic acid molecule according to any one of claims 2-12, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', and the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnNfnnnnnnn-3', where "Nf" represents a 2'-fluoro-modified nucleotide, and where "n" represents a 2'-O-methyl-modified nucleotide.

14. The polynucleic acid molecule according to any one of claims 2-12, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', and the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnnn-3', where "Nf" represents a 2'-fluoro-modified nucleotide, and where "n" represents a 2'-O-methyl-modified nucleotide.

15. The polynucleic acid molecule according to any one of claims 1-14, wherein the polynucleic acid molecule comprises a modified internucleotide linkage, optionally, wherein the modified internucleotide linkage is a phosphorothioate internucleotide linkage.

16. The polynucleic acid molecule according to claim 15, wherein the modified internucleotide linkage comprises a stereochemically enriched phosphorothioate internucleotide linkage.

17. The polynucleic acid molecule according to any one of claims 15-16, wherein the modified internucleotide linkage is an SP chiral internucleotide phosphorothioate bond.

18. A polynucleic acid molecule according to any one of claims 15-17, wherein the polynucleic acid comprises a plurality of modified internucleotide linkages, and at least 1, 2, 3, or 4 of the plurality of modified internucleotide linkages are stereochemically enriched phosphorothioate internucleotide linkages.

19. The polynucleic acid molecule according to claim 18, wherein the stereochemically enriched phosphorothioate internucleotide linkages comprise both R-isomers and S-isomers.

20. The polynucleic acid molecule according to one of claims 18-19, wherein the stereochemically enriched phosphorothioate is located between two consecutive nucleosides, and the two nucleosides are two of the six 5' or 3' terminal nucleosides of the sense strand or the antisense strand.

21. The polynucleic acid molecule according to any one of claims 1-20, wherein the polynucleic acid molecule comprises a nucleoside substitution with a hypoxanthine nucleobase.

22. The polynucleic acid molecule according to claim 21, wherein the nucleoside substitution with a hypoxanthine nucleobase is an inosine substitution, optionally, wherein the inosine substitution comprises 2'-O-methylinosine-3'-phosphate.

23. The polynucleic acid molecule according to claim 22, wherein the inosine substitution is within the seed region of the antisense strand.

24. The polynucleic acid molecule according to claim 22, wherein the inosine substitution is within 7 nucleotides from the 5' end of the antisense strand, optionally, wherein the inosine substitution is in the first nucleotide from the 5' end of the antisense strand.

25. The polynucleic acid molecule according to any one of claims 1-24, wherein the first nucleotide from the 5' end of the antisense strand is substituted with uridine or adenosine, optionally, wherein the uridine comprises 2'-O-methyluridine-3'-phosphate, or optionally, wherein the adenosine comprises 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

26. The polynucleic acid molecule according to any one of claims 1-25, wherein the sense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 151-200, 214, and 221.

27. The polynucleic acid molecule according to any one of claims 1-26, wherein the antisense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 51-100, 201-213, and 217-219.

28. The polynucleic acid molecule according to any one of claims 1-27, wherein the sense strand comprises a nucleic acid sequence selected from the nucleic acid sequences of SEQ ID NOs: 151-200, 214, and 221, and the antisense strand comprises a nucleic acid sequence selected from the nucleic acid sequences of SEQ ID NOs: 51-100, 201-213, and 217-219.

29. A polynucleic acid molecule for regulating the expression of coagulation factor XI (FXI) gene, wherein the polynucleic acid molecule comprises: (a) The antisense strand of the nucleotide sequence comprising SEQ ID NO: 4, 6 - 7, 9 - 11, 13 - 14, 35, 50 and 215 - 216 and the sense strand of the nucleotide sequence comprising SEQ ID NO: 104, 106 - 107, 109 - 111, 113 - 114, 135, 150 and 220; or (b) The antisense strand of the nucleotide sequence comprising SEQ ID NO: 54, 56 - 57, 59 - 61, 63 - 64, 85, 100, 201 - 213 and 217 - 219 and the sense strand of the nucleotide sequence comprising SEQ ID NO: 154, 156 - 157, 159 - 161, 163 - 164, 185, 200, 214 and 221.

30. The polynucleotide molecule according to claim 29, wherein the polynucleotide molecule comprises: (a) The antisense strand of the nucleotide sequence comprising AUAAAUGUCUUUGUUGCAAGCGC (SEQ ID NO: 11) and the sense strand of the nucleotide sequence comprising GCUUGCAACAAAGACAUUUAU (SEQ ID NO: 111); (b) The antisense strand of the nucleotide sequence comprising AUGUCUUUGUUGCAAGCGCUUAU (SEQ ID NO: 9) and the sense strand of the nucleotide sequence comprising AAGCGCUUGCAACAAAGACAU (SEQ ID NO: 109); (c) The antisense strand of the nucleotide sequence comprising AAUGUCUUUGUUGCAAGCGCUUA (SEQ ID NO: 10) and the sense strand of the nucleotide sequence comprising AGCGCUUGCAACAAAGACAUU (SEQ ID NO: 110); (d) The antisense strand of the nucleotide sequence comprising UUAUAGUUUAUGCCCUUCAUGUC (SEQ ID NO: 13) and the sense strand of the nucleotide sequence comprising CAUGAAGGGCAUAAACUAUAA (SEQ ID NO: 113); (e) The antisense strand of the nucleotide sequence comprising AUAGGUAAAAAACUGGCAGCGGA (SEQ ID NO: 35) and the sense strand of the nucleotide sequence comprising CGCUGCCAGUUUUUUACCUAU (SEQ ID NO: 135); (f) The antisense strand of the nucleotide sequence comprising IUAAAUGUCUUUGUUGCAAGCGC (SEQ ID NO: 215) and the sense strand of the nucleotide sequence comprising GCUUGCAACAAAGACAUUUAU (SEQ ID NO: 111); or (g) The antisense strand with the nucleotide sequence UUAAAUGUCUUUGUUGCAAGCGC (SEQ ID NO:216) and the sense strand with the nucleotide sequence GCUUGCAACAAAGACAUUUAA (SEQ ID NO:220).

31. A polynucleotide molecule for regulating the expression of coagulation factor XI (FXI) gene, wherein the polynucleotide molecule comprises: (a) The antisense strand with the nucleotide sequence asUfsaaaugucuuUfgUfuGfcaagcsgsc (SEQ ID NO:61) and the sense strand with the nucleotide sequence gscsuugcAfaCfaAfagacauuuau (SEQ ID NO:161); (b) The antisense strand with the nucleotide sequence asUfsaaaugucuuUfgUfuGfcsaagcsgsc (SEQ ID NO:211) and the sense strand with the nucleotide sequence gscsuugcAfaCfaAfagacauuuau (SEQ ID NO:161); (c) The antisense strand with the nucleotide sequence asUfsaaaugucuuUfgUfsuGfcaagcsgsc (SEQ ID NO:212) and the sense strand with the nucleotide sequence gscsuugcAfaCfaAfagacauuuau (SEQ ID NO:161); (d) The antisense strand with the nucleotide sequence asUfsaaaugucuuUfgUfuGfcaasgcsgsc (SEQ ID NO:213) and the sense strand with the nucleotide sequence gscsuugcAfaCfaAfagacauuuau (SEQ ID NO:161); (e) The antisense strand with the nucleotide sequence asUfsaaaugucuuUfgUfuGfcaagcsgsc (SEQ ID NO:61) and the sense strand with the nucleotide sequence gscsuugcAfaCfaAfagacauuuau(invdT)(invdT) (SEQ ID NO:214); (f) The antisense strand with the nucleotide sequence asUfsgucuUfuguuGfcAfaGfcgcuusasu (SEQ ID NO:204) and the sense strand with the nucleotide sequence asasgcgcUfuGfcAfacaaagacau (SEQ ID NO:159); (g) The antisense strand with the nucleotide sequence asAfsugucUfuuguUfgCfaAfgcgcususa (SEQ ID NO:205) and the sense strand with the nucleotide sequence asgscgcuUfgCfaAfcaaagacauu (SEQ ID NO:160); (h) The antisense strand of the nucleotide sequence containing asUfsaaauGfucuuUfgUfuGfcaagcsgsc (SEQ ID NO:206) and the sense strand of the nucleotide sequence containing gscsuugcAfaCfaAfagacauuuau (SEQ ID NO:161); (i) The antisense strand of the nucleotide sequence containing usUfsauagUfuuauGfcCfcUfucaugsusc (SEQ ID NO:207) and the sense strand of the nucleotide sequence containing csasugaaGfgGfcAfuaaacuauaa (SEQ ID NO:163); (j) The antisense strand of the nucleotide sequence containing asUfsagguAfaaaaAfcUfgGfcagcgsgsa (SEQ ID NO:209) and the sense strand of the nucleotide sequence containing csgscugcCfaGfuUfuuuuaccuau (SEQ ID NO:185); (k) The antisense strand of the nucleotide sequence containing isUfsaaaugucuuUfgUfuGfcaagcsgsc (SEQ ID NO:217) and the sense strand of the nucleotide sequence containing gscsuugcAfaCfaAfagacauuuau (SEQ ID NO:161); (l) The antisense strand of the nucleotide sequence containing usUfsaaauGfucuuUfgUfuGfcaagcsgsc (SEQ ID NO:218) and the sense strand of the nucleotide sequence containing gscsuugcAfaCfaAfagacauuuaa (SEQ ID NO:222); or (m) The antisense strand of the nucleotide sequence containing a4sUfsaaauGfucuuUfgUfuGfcaagcsgsc (SEQ ID NO:219) and the sense strand of the nucleotide sequence containing gscsuugcAfaCfaAfagacauuuau (SEQ ID NO:161); Wherein "A" refers to adenosine-3'-phosphate; "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate; "dA" refers to 2'-deoxyadenosine-3-phosphate; "C" refers to cytidine-3'-phosphate; "c" refers to 2'-O-methylcytidine-3'-phosphate; "Cf" refers to 2'-fluorocytidine-3'-phosphate; "dC" refers to 2'-deoxycytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "dG" refers to 2'-deoxyguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; "u" refers to 2'-O-methyluridine-3'-phosphate; "Uf" refers to 2'-fluorouridine-3'-phosphate; "dU" refers to 2'-deoxyuridine-3'-phosphate; "T" refers to 5-methyluridine-3'-phosphate; "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate; "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-thiophosphate, "invdT" refers to 3'-inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, and "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

32. A polynucleotide molecule conjugate for regulating the expression of coagulation factor XI (FXI) gene, wherein the polynucleotide molecule conjugate comprises a polynucleotide molecule as described in any one of claims 1-31 and an asialoglycoprotein receptor targeting moiety.

33. The polynucleotide molecule conjugate according to claim 32, wherein the polynucleotide molecule and the asialoglycoprotein receptor targeting moiety are coupled via a linker.

34. The polynucleotide molecule conjugate according to claim 33, wherein the linker comprises the following formula (IV), At least one of Y1 and Y2 is a nucleotide in the polynucleotide molecule.

35. The polynucleotide molecule conjugate according to claim 34, wherein Y1 is the last nucleotide at the 3'-end of the sense strand of the polynucleotide molecule, or wherein Y2 is the first nucleotide at the 5'-end of the sense strand of the polynucleotide molecule.

36. The polynucleotide molecule conjugate according to claim 34, wherein Y1 and Y2 are two consecutive nucleotides in the polynucleotide molecule.

37. The polynucleotide molecule conjugate according to any one of claims 32-36, wherein the asialoglycoprotein receptor targeting moiety comprises N-acetylgalactosamine (GalNAc) or galactose.

38. The polynucleotide molecule conjugate according to any one of claims 33-36, wherein the linker bearing the last nucleotide at the 3'-end of the sense strand of the polynucleotide molecule and the asialoglycoprotein receptor targeting moiety are as shown in the following formula: In formula (V'), (V''), (V'''), or (V'''') herein, Z is -H, -OH, -O-methyl, -F, or -O-methoxyethyl, and in formula (V'), R is adenine, uracil, guanine, cytosine, thymine, abasic, etc.

39. A pharmaceutical composition comprising a polynucleic acid molecule as described in any one of claims 1-31 or a polynucleic acid molecule conjugate as described in any one of claims 32-38, and a pharmaceutically acceptable excipient.

40. A method for regulating the mRNA expression of the coagulation factor XI (FXI) gene in a subject, comprising: Administering to the subject a polynucleic acid molecule as described in any one of claims 1-31 or a polynucleic acid molecule conjugate as described in any one of claims 32-38, or a pharmaceutical composition as described in claim 39, so as to regulate the mRNA expression of the FXI gene in the subject.

41. A method of modulating the level of FXI or FXIa protein or the activity of FXI or FXIa in a subject in need thereof, comprising: Administering to the subject a polynucleic acid molecule as described in any one of claims 1-31 or a polynucleic acid molecule conjugate as described in any one of claims 32-38, or a pharmaceutical composition as described in claim 39, so as to regulate the FXI or FXIa protein level or FXI or FXIa activity in the subject.

42. The method as described in claim 41, wherein the subject in need thereof has thrombosis or its symptoms.

Images