Application of Ganoderma lucidum strain SS30 in the preparation of drugs for treating cancer
By using the mycelial polysaccharide of Ganoderma lucidum strain SS30 obtained through space-induced mutagenesis, the problems of high toxicity and drug resistance in the treatment of pancreatic cancer and colorectal cancer have been solved, achieving a highly effective and low-toxicity cancer treatment effect.
Patent Information
- Application Number
- CN202510484286.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-17
- Publication Date
- 2025-10-31
- Estimated Expiration
- 2045-04-17
AI Technical Summary
Current treatments for pancreatic and colorectal cancer suffer from problems such as difficult surgical resection, significant toxic side effects of chemotherapy, numerous adverse reactions to targeted drugs, and long-term drug resistance. There is a lack of highly effective and low-toxicity anticancer drugs.
Drugs for treating pancreatic and colorectal cancer were prepared by using polysaccharides from the mycelium of Ganoderma lucidum strain SS30, which underwent space-induced mutagenesis, to enhance immune function and reduce the production of oxidative products.
The mycelial polysaccharides of Ganoderma lucidum strain SS30 significantly inhibited cancer cell proliferation, reduced tumor volume, regulated immune factor levels, improved immune function, and reduced oxidative products, providing a new anti-cancer treatment approach.
Smart Images

Figure CN120271728B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to the application of Ganoderma lucidum strain SS30 in the preparation of drugs for treating cancer. Background Technology
[0002] Pancreatic cancer is one of the most malignant tumors of the digestive system. Its insidious onset and lack of specific symptoms make early diagnosis difficult, leading to a very poor prognosis. Surgical resection is the only treatment that can significantly improve the survival rate of pancreatic cancer patients; however, 70%-85% of patients have already metastasized to blood, lymph nodes, and nerves at the time of diagnosis, making surgical resection impossible. Even those who undergo surgery face the risk of recurrence or metastasis post-surgery. Chemotherapy remains the primary treatment option, with gemcitabine often used as a first-line chemotherapy drug. However, this treatment has significant toxic side effects, affecting the heart, liver, kidneys, and immune system, and long-term use can lead to drug resistance. While the development of targeted and immunotherapeutic drugs for pancreatic cancer has made some progress in recent years, many adverse reactions still exist. Colorectal cancer is one of the most common types of malignant tumors of the digestive tract. Currently, effective treatments for CAC mainly include surgical resection, radiotherapy, and chemotherapy. These are effective for early-stage patients, but for advanced-stage patients, radiotherapy and chemotherapy have significant toxic side effects and are often accompanied by poor quality of life, less than ideal efficacy, and high costs. In recent years, with the in-depth research and widespread application of edible and medicinal fungi, the anti-tumor effects of edible and medicinal fungi have gradually attracted attention. They can effectively reduce adverse reactions caused by chemotherapy, thereby effectively improving the quality of life of patients. They are a new type of highly effective and low-toxicity anti-cancer drug.
[0003] Reishi mushroom, commonly known as "auspicious herb" or "immortal herb," is a fungus belonging to the class Basidiomycetes, order Polyporaceae, family Polyporaceae, and genus Ganoderma. Reishi thrives in warm, humid environments and naturally parasitizes the dead wood or stumps of broad-leaved trees such as oak and beech. Wild resources are scarce, and cultivation is now primarily done artificially using linden wood or substrate. Traditional Chinese medicine considers Reishi a superior tonic, neutral in nature and sweet in taste, entering the heart, lung, liver, and kidney meridians. It is commonly used to replenish qi and calm the mind, relieve coughs and asthma, and treat weakness, insomnia, and coughs. Modern pharmacological studies have found that the active ingredients and pharmacological effects of fermented Reishi mycelium are similar to those of the fruiting body, exhibiting immunomodulatory, antioxidant, and neuromodulatory biological activities. In recent years, with the development of aerospace technology, space breeding technology has become a new method of breeding. Crops, plants, and fungi undergo space radiation-induced mutagenesis, producing new traits and thus obtaining new varieties. However, research on the functional activity of space-bred products is still relatively weak, and there are no related products of space-mutated Ganoderma lucidum in the domestic and international markets. Summary of the Invention
[0004] The purpose of this invention is to provide the application of Ganoderma lucidum strain SS30 in the preparation of drugs for treating cancer, thereby solving the problems existing in the prior art. This invention uses Ganoderma lucidum strain SS30, generated through space-induced mutagenesis, as raw material to prepare mycelial polysaccharides. These polysaccharides have significant inhibitory effects on transplanted pancreatic cancer and primary colorectal cancer, and can achieve the therapeutic effect of cancer by improving immune function and reducing the level of oxidative products. This provides new materials for the development and utilization of Ganoderma lucidum and its products, and provides a research foundation for the research and development of cancer-related drugs and the study of cancer treatment mechanisms.
[0005] To achieve the above objectives, the present invention provides the following solution:
[0006] This invention provides a polysaccharide from the mycelium of Ganoderma lucidum strain SS30. The polysaccharide is composed of glucose, galactose, mannose, fucose, xylose, arabinose, rhamnose, glucuronic acid, glucosamine, ribose, and lacturonic acid in a molar ratio of 466.0:101.9:41.4:22.3:7.8:5.6:4.5:3.2:3.2:1.7:1, with an average molecular weight of 1.57 × 10⁻⁶. 6 Da.
[0007] The present invention also provides a method for preparing the polysaccharide of the above-mentioned Ganoderma lucidum strain SS30 mycelium, comprising the following steps:
[0008] (1) The mycelium of Ganoderma lucidum strain SS30 was subjected to ultrasonic extraction with ethanol and hot water extraction to obtain the supernatant;
[0009] (2) After removing proteins, dialysis and drying the supernatant, crude polysaccharide is obtained;
[0010] (3) The crude polysaccharide was eluted with a DEAE Sepharose FastFlow column in sequence using water and sodium chloride solution as eluents. The eluent was collected, dialyzed, and dried to obtain the mycelial polysaccharide of the Ganoderma lucidum strain SS30.
[0011] Furthermore, the ultrasonic extraction process of ethanol is as follows: the dried Ganoderma lucidum strain SS30 mycelium is mixed with 85%~95% ethanol solution at a ratio of 1g:1mL, and ultrasonically extracted for 20-60min at 80W~120W and 35℃~55℃; after ultrasonic extraction twice, the precipitate is collected by centrifugation.
[0012] Furthermore, the hot water extraction process is as follows: the precipitate is mixed with water at a material-to-liquid ratio of 1:15 to 1:45, and extracted at 60 to 90 °C for 60 to 120 min; after extraction twice, the supernatants are combined.
[0013] Optionally, in step (2), the protein removal method is the Sevag method; the molecular weight cutoff of the dialysis bag used during dialysis is 8000~12000 Da.
[0014] Further, the elution process is as follows: the crude polysaccharide is prepared into a loading solution of 1 mg / mL, and water and 0.1~0.3 mol / L sodium chloride solution are used as elution buffers for gradient elution. The volume of elution buffer used is 500 mL, and the 170~260 mL of elution buffer is collected.
[0015] Optionally, the flow rate during elution is 10 mL / 15 min.
[0016] Optionally, in step (3), the molecular weight cutoff of the dialysis bag used during dialysis is 8000~12000 Da.
[0017] The present invention also provides the application of the above-mentioned Ganoderma lucidum strain SS30 mycelial polysaccharide or the Ganoderma lucidum strain SS30 mycelial polysaccharide prepared by the above preparation method in the preparation of immunomodulatory products.
[0018] The present invention also provides the application of the above-mentioned Ganoderma lucidum strain SS30 mycelial polysaccharide or the Ganoderma lucidum strain SS30 mycelial polysaccharide prepared by the above preparation method in the preparation of products for treating cancer, wherein the cancer includes colorectal cancer and pancreatic cancer.
[0019] The present invention also provides a product for treating cancer, the product comprising the above-mentioned Ganoderma lucidum strain SS30 mycelial polysaccharide or the Ganoderma lucidum strain SS30 mycelial polysaccharide prepared by the above-mentioned preparation method; the cancer includes colorectal cancer and pancreatic cancer.
[0020] The present invention discloses the following technical effects:
[0021] This invention uses Ganoderma lucidum strain SS30, generated through space-induced mutagenesis, as raw material to prepare mycelial polysaccharides. These mycelial polysaccharides can inhibit the proliferation and colony formation of pancreatic cancer cells, reduce the volume of pancreatic cancer solid tumors, promote cancer cell necrosis in tumor tissue, reduce serum NO levels in tumor-bearing mice, and regulate the levels of immune factors such as IL-6, TNF-α, IL-12, and INF-γ in tumor-bearing mice. By enhancing immune function and reducing the production of oxidative products, they achieve a therapeutic effect on pancreatic cancer. These mycelial polysaccharides can also inhibit the development of colorectal cancer and regulate the levels of immune factors such as IL-6, TNF-α, IL-1β, and INF-γ in tumor-bearing mice, thereby enhancing immune function and achieving a therapeutic effect on colorectal cancer. This invention provides new materials for the development and utilization of Ganoderma lucidum and its products, and provides a research foundation for the development of cancer-related drugs and the study of cancer treatment mechanisms, possessing significant economic and market value. Attached Figure Description
[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0023] Figure 1 A chromatogram of polysaccharides from the mycelium of Ganoderma lucidum strain SS30;
[0024] Figure 2 Results of monosaccharide composition analysis of polysaccharides in Ganoderma lucidum strain SS30 mycelium;
[0025] Figure 3 Infrared spectrum of polysaccharides from the mycelium of Ganoderma lucidum strain SS30;
[0026] Figure 4 The inhibitory rate of polysaccharides from Ganoderma lucidum strain SS30 mycelium against pancreatic cancer cells SW1990;
[0027] Figure 5 Changes in body weight in pancreatic cancer mice under different treatment groups;
[0028] Figure 6 Tumor size in pancreatic cancer mice under different treatment groups;
[0029] Figure 7 Spleen index of pancreatic cancer mice in different treatment groups;
[0030] Figure 8 Thymus index of pancreatic cancer mice in different treatment groups;
[0031] Figure 9 The concentration of interleukin-6 (IL-6) in the serum of pancreatic cancer mice in different treatment groups;
[0032] Figure 10 The concentrations of tumor necrosis factor α (TNF-α) in the serum of pancreatic cancer mice in different treatment groups;
[0033] Figure 11 The concentrations of interleukin-12 (IL-12) in the serum of pancreatic cancer mice in different treatment groups;
[0034] Figure 12 The concentration of interferon-γ (IFN-γ) in the serum of pancreatic cancer mice in different treatment groups;
[0035] Figure 13 The concentration of nitric oxide (NO) in the serum of pancreatic cancer mice in different treatment groups;
[0036] Figure 14 Changes in body weight in colorectal cancer mice under different treatment groups;
[0037] Figure 15 Colon length in mice with colorectal cancer in different treatment groups;
[0038] Figure 16 The concentration of interleukin-6 (IL-6) in the colon of mice with colorectal cancer in different treatment groups;
[0039] Figure 17 The concentration of tumor necrosis factor α (TNF-α) in the colon of mice with colorectal cancer in different treatment groups;
[0040] Figure 18 The concentration of interleukin-1β (IL-1β) in the colon of mice with colorectal cancer in different treatment groups;
[0041] Figure 19 The concentration of interferon-γ (IFN-γ) in the colon of colorectal cancer mice in different treatment groups. Detailed Implementation
[0042] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0043] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0044] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0045] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0046] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0047] The Ganoderma lucidum strain SS30 in this invention has been disclosed in Chinese patent "CN 114350525 A Ganoderma lucidum strain SS30 and its application". It is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, on September 30, 2021, with accession number CGMCCNo. 23283.
[0048] Unless otherwise specified, the experimental methods used in the following embodiments of the present invention are conventional methods in the art; unless otherwise specified, the materials and reagents used are commercially available.
[0049] Example 1: Preparation of Ganoderma lucidum mycelium polysaccharides
[0050] 1. Ganoderma lucidum samples: Ganoderma lucidum strain SS30 and its original strain
[0051] A certain amount of mycelium was taken from the cultured original strain and Ganoderma lucidum strain SS30, and ground into powder using liquid nitrogen. Total DNA from both strains was extracted according to the kit instructions. Subsequently, PCR amplification was performed by 35 cycles of pre-denaturation at 94℃ for 4 min, annealing at 55.5℃ for 1 min, and extension at 72℃ for 4 min; followed by a final extension at 72℃ for 5 min. The amplified products were sequenced, and the obtained ITS sequences were analyzed using online BLAST analysis in the NCBI database and DNA star software. The obtained genome sequences of the original strain and Ganoderma lucidum strain SS30 were significantly different, indicating that Ganoderma lucidum strain SS30 was a novel mutant strain.
[0052] The gene sequence of the original strain is shown in SEQ ID NO.1:
[0053] CCTTAAGGGACGGGAAATCTACCTGAATTTGAGGTCAGAGGTCATAAAGCTGTCTCACAAACGAGACGGTTAGAAGCTCGCCAAAACGCTTCACGGTCACGGCGTAGACATTATCACACCGAGAGCCGATCCGCAAGGAATCAAGCTAATACATTTAAGAGGAGCCGACCGAAACACGGCCGACAAGCCTCCAAGTCCAAGCCTACAAACCCGCAAAGGTTTGTAAGTTGAAGATTTCATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTACATAGATGCGTTACATCGCAATACACATTCTAATACTTTATAGAGTTTGTGGTAAACGCAGGCACAGACACGCTCTACAAGCTCCGTAAAGAGCCCGCTTCACGACGTCTGAAGCCCACAGTAAGTGCACAGGTGTAGAGTGGATGAGCAGGGCGTGCACATGCCTCGGGAGGCCAGCTACAACCCAGTCAAAACTCGATAATGATCCTTCCGCAGGTTCCCCCTACGGAAG。
[0054] The gene sequence of Ganoderma lucidum strain SS30 is shown in SEQ ID NO.2:
[0055] .
[0056] 2. Preparation of Ganoderma lucidum mycelium polysaccharides
[0057] 2.1 Preparation of polysaccharides from Ganoderma lucidum strain SS30 mycelium
[0058] After drying the mycelium of Ganoderma lucidum strain SS30, it was pulverized and passed through an 80-mesh sieve. It was then mixed with 90% ethanol solution at a ratio of 1g:1mL. The ultrasonic power was set to 100W, and the mixture was ultrasonically extracted at 40℃ for 40min. The precipitate was then collected by centrifugation at 6000 r / min. The extraction was repeated once, and the organic reagents were evaporated.
[0059] Mycelial polysaccharides were extracted using hot water extraction at 80℃, a solid-liquid ratio of 1:30, and an extraction time of 80 min. After two extractions, the supernatants were combined and concentrated to 1 / 5 of their original volume, then lyophilized for later use. A 5 mg / mL solution of the lyophilized powder was prepared and mixed with Sevag reagent (chloroform:n-butanol = 4:1) at a 1:1 volume ratio. The mixture was stirred thoroughly with a magnetic stirrer for 1 h, centrifuged at 7000 r / min for 10 min, and the supernatant was collected. Sevag reagent was then added to the supernatant at a 2:1 volume ratio, and the reaction was repeated for 1 h. The mixture was centrifuged at 7000 r / min for 10 min, and the supernatant was collected. Organic reagents were removed by rotary evaporation under reduced pressure, and the concentrate was collected. The concentrate was placed in a dialysis bag with a molecular weight cutoff of 8000–12000 Da, embedded in a hydrogel, and the dialysis solution was concentrated to 1 / 5 of its original volume at low temperature. The dialysis solution in the dialysis bag was then lyophilized. The lyophilized product was prepared as a 1 mg / mL loading solution and eluted using a DEAE Sepharose Fast Flow column (1.5 × 90 cm) with water and 0.1–0.3 mol / L sodium chloride solution as eluents in a gradient elution. The eluent volume was 500 mL, and the elution flow rate was 10 mL / 15 min. The elution peaks (elutions from 170 to 260 mL) were collected. The eluent was then transferred to a dialysis bag with a molecular weight cutoff of 8000–12000 Da, dialyzed with pure water, and lyophilized to obtain the polysaccharide from the mycelium of Ganoderma lucidum strain SS30.
[0060] A 2 mg / mL solution of Ganoderma lucidum strain SS30 mycelial polysaccharide was prepared, filtered through a 0.22 μm microporous membrane, and then detected and recorded using a Plaquagel-OH Mixed-H (7.5 × 300 mm) column. The chromatographic conditions were: differential detector, dual-angle laser scattering detector; flow rate 1.0 mL / min, column temperature 45℃, injection volume 50 μL; mobile phase 0.1 mol / L sodium nitrate (0.01% sodium azide), isocratic elution. Results are as follows: Figure 1 As shown in the figure, the polysaccharide chromatogram displays a single symmetrical peak, indicating that the purity of the polysaccharide in the mycelium of Ganoderma lucidum strain SS30 is greater than 98.0%, and the average molecular weight is 1.57 × 10⁻⁶. 6 Da.
[0061] 2.2 Mycelial polysaccharides of the original strain
[0062] The original strain mycelial polysaccharide was prepared according to the process in "2.1 Preparation of Ganoderma lucidum strain SS30 mycelial polysaccharide".
[0063] 3. Structural analysis of polysaccharides in the mycelium of Ganoderma lucidum strain SS30
[0064] Prepare a 5 mg / mL solution of Ganoderma lucidum strain SS30 mycelial polysaccharide, add 2 mol / L trichloroacetic acid, purge with nitrogen, and hydrolyze at 110 °C for 2 h, then dry. Add 0.05 mL of 0.3 mol / L NaOH and 0.05 mL of PMP methanol solution, purge with nitrogen, and incubate in a water bath at 70 °C for 60 min. After cooling to room temperature, add 0.5 mL of 0.3 mol / L HCl, and dilute to 2 mL with water. Add 1 mL of chloroform, shake well, and allow to stand for layering. Discard the lower chloroform layer. Repeat this extraction process three times. Filter the aqueous layer through a 0.45 μm filter membrane and determine the chromatogram using a C18 Agilent (4.6 mm * 250 mm * 5 μm) column. The chromatographic conditions were: Agilent 1200, UV detector; flow rate: 1.0 mL / min, column temperature: 25 ℃, injection volume: 20 μL, detection wavelength: 245 nm; mobile phase A: 0.1 M KH₂PO₄ (pH 6.8), and mobile phase B: acetonitrile. Results are as follows: Figure 2 As shown, this polysaccharide is a heteropolysaccharide composed of glucose, galactose, mannose, fucose, xylose, arabinose, rhamnose, glucuronic acid, glucosamine, ribose, and lacturonic acid, with a molar ratio of 466.0:101.9:41.4:22.3:7.8:5.6:4.5:3.2:3.2:1.7:1. These results indicate that the polysaccharide is predominantly glucose, and also contains acidic sugars such as galactose, a small amount of mannose, and fucose.
[0065] Potassium bromide and polysaccharide were dried. Potassium bromide and polysaccharide from Ganoderma lucidum strain SS30 mycelium were mixed and ground at a mass ratio of 1:100, then compressed into tablets (4000-400 cm³). -1 The scan range was 64 times, with a resolution of 4 cm. -1 The result is as follows Figure 3 As shown, this polysaccharide exhibits the characteristic absorption peaks of cellulose polysaccharides, with the peak at a wavelength of 3564 cm⁻¹. -1 The broad absorption peaks nearby are caused by the stretching vibrations of OH bonds, indicating a large number of intramolecular hydrogen bonds, which increases the hydrophilicity of the polysaccharide; at a wavelength of 2900 cm⁻¹... -1 Stretching vibrations caused by methyl and methylene CH compounds from sugars are observed nearby, at a wavelength of 1600 cm⁻¹. -1 The presence of characteristic peaks near carboxyl or aldehyde groups indicates the presence of uronic acid in the polysaccharide residue; at a wavelength of 1000 cm⁻¹ -1 The left and right sides exhibit stretching vibrations induced by the COC of the pyranose rings at a wavelength of 845 cm⁻¹. -1 The CH-angle vibrations are attributed to α-glycosidic bonds in the polysaccharide, indicating that the polysaccharide of Ganoderma lucidum strain SS30 mycelium is an α-configuration pyranose.
[0066] Example 2: Verification of the efficacy of Ganoderma lucidum mycelium polysaccharides
[0067] 1. In vitro tumor cell inhibition experiment - pancreatic cancer
[0068] Pancreatic cancer cells SW1990, cultured to the logarithmic growth phase, were adjusted to a cell concentration of 5 × 10⁻⁶ cells / year. 4 Cells were cultured at a concentration of 100 μL / mL in 96-well plates, 100 μL per well, and incubated at 37 ℃ with 5% CO2 for 24 h. Three groups were set up: a blank group, a control group, and a treatment group. The blank group received 100 μL of complete culture medium per well; the control group received 100 μL of cell suspension after counting; and the treatment groups received 100 μL of cell suspensions containing 0.05 mg / mL, 0.10 mg / mL, 0.20 mg / mL, 0.40 mg / mL, and 0.80 mg / mL mycelial polysaccharides, respectively, with 5 replicates per group. The 96-well plates were incubated for 48 h. The culture medium was then poured out, and 100 μL of 10% CCK-8 medium was added. The plates were incubated at 37 ℃ for 4 h, and the absorbance was measured at 450 nm. The growth inhibition rate of mycelial polysaccharides on pancreatic cancer cells was calculated. Cell growth inhibition rate (%) = (mean OD value of control group - mean OD value of intervention group) / (mean OD value of control group - mean OD value of blank group) × 100%. Half-maximal inhibition rate (IC50) 50 ) Calculated using Prism 7.0.
[0069] The results are as follows Figure 4 As shown, different concentrations of mycelial polysaccharides inhibited the growth of pancreatic cancer cells SW1990 to varying degrees. When the concentration of mycelial polysaccharides was greater than 50 μg / mL, the cell inhibition rate increased significantly, with a highly significant difference (P<0.01), and the half-maximal inhibitory rate (IC50) was significantly higher. 50 The concentration was 90.1 μg / mL, indicating that mycelial polysaccharide has an inhibitory effect on the growth of SW1990 cells, and this effect is concentration-dependent.
[0070] 2. In vivo tumor suppression experiment - pancreatic cancer
[0071] Pancreatic cancer cells SW1990, cultured to the logarithmic growth phase, were prepared into a culture medium with a concentration of 8 × 10⁻⁶ cells / mL using pre-cooled serum-free culture medium. 7Cell suspension at a concentration of 10 cells / mL was mixed with matrix gel at a 1:1 ratio and thoroughly mixed before inoculation. 0.15 mL was injected subcutaneously into the right axilla of each mouse. Eight days after inoculation, the mice were randomly divided into five groups: a control group, a model group, a positive control group (original strain fermented mycelial polysaccharide), and high- and low-dose mycelial polysaccharide groups, with 10 mice in each group. The control and model groups were administered physiological saline by gavage; the positive control group was administered 200 mg / kg of original strain fermented mycelial polysaccharide by gavage; the high- and low-dose groups were administered 200 mg / kg and 100 mg / kg of Ganoderma lucidum strain SS30 mycelial polysaccharide, respectively, by gavage, once daily for two weeks. During this period, the mice's growth, mental state, and hair condition were observed daily. Results showed that eight days after tumor cell inoculation, the size of the tumor mass in the axilla of the mice indicated a 95% success rate in establishing the tumor model. The model group mice gradually became sluggish, lethargic, and their fur became increasingly disheveled and dull; the positive group showed some recovery; the mice in the high-dose mycelial polysaccharide group had better mental condition than the low-dose group and the positive group. The changes in body weight of the mice in each group during the experiment were statistically analyzed, and the results are as follows: Figure 5 As shown, the mice in the high-dose group of Ganoderma lucidum strain SS30 mycelial polysaccharide had a higher body weight than the low-dose group and the positive group.
[0072] Tumor tissue was dissected from the right axilla of mice in each group, and the total weight was measured. The tumor inhibition rate was calculated as follows: Tumor inhibition rate = [(tumor weight in model group - tumor weight in treatment group) / tumor weight in model group] × 100%. Results are as follows: Figure 6 As shown, both the mycelial polysaccharide of Ganoderma lucidum strain SS30 and the fermented mycelial polysaccharide of the original strain have a certain inhibitory effect on the growth of tumors in mice. Among them, the high-dose group of Ganoderma lucidum strain SS30 mycelial polysaccharide has a similar inhibitory effect on tumors as the fermented mycelial polysaccharide of the original strain, and is slightly better than the fermented mycelial polysaccharide of the original strain. Both are higher than the low-dose group of Ganoderma lucidum strain SS30 mycelial polysaccharide.
[0073] Mice in each group were dissected, and their spleens and thymuses were harvested. After weighing, the organ coefficient was calculated as follows: Organ coefficient = organ weight / body weight. Results are as follows: Figure 7 and Figure 8 As shown, compared with the model group, the spleen index and thymus organ index of mice in both the high- and low-dose groups of Ganoderma lucidum strain SS30 mycelial polysaccharide were increased, indicating that the immune function of the transplanted tumor mice was improved. The spleen index of the positive group was lower than that of the model group, while the thymus index was not significantly different from that of the model group. This indicates that the positive regulatory effect of Ganoderma lucidum strain SS30 mycelial polysaccharide on the immune system of mice is stronger than that of the original strain fermented mycelial polysaccharide.
[0074] Blood was collected from the eyeballs of mice in each group and placed in EP tubes. The tubes were centrifuged at 1000 rpm for 10 min to separate the serum. Serum levels of IL-6, IL-12, TNF-α, IFN-γ, and NO were measured using a kit and analyzed by an ELISA reader.450nm Measure the absorbance and calculate the concentrations of the above cytokines. Results are as follows: Figures 9-13 As shown. Figure 9 The results showed that, compared with the blank group, the serum IL-6 level in the model group was significantly increased (P<0.01); compared with the model group, the serum IL-6 level in mice in the positive group and the high and low dose groups of Ganoderma lucidum strain SS30 mycelial polysaccharide was significantly decreased, among which the high dose group of Ganoderma lucidum strain SS30 mycelial polysaccharide showed the most significant decrease, which was close to the level of the normal group and better than the other groups. Figure 10 The results showed that, compared with the blank group, the serum TNF-α content in the model group was significantly increased (P<0.01). Compared with the model group, the serum TNF-α content in the positive group and the high and low dose groups of Ganoderma lucidum strain SS30 mycelial polysaccharide decreased, with the low dose group showing the most significant decrease, which was close to the level of the normal group and better than the other groups. Figure 11 and Figure 12 The results showed that the serum IL-12 and IFN-γ levels in the model group were lower than those in the blank group. Compared with the model group, the expression levels of IL-12 and IFN-γ in mice in the positive group and the high- and low-dose groups of Ganoderma lucidum strain SS30 mycelial polysaccharide were increased, with the high-dose group showing the most significant upregulation, which was superior to other groups. Figure 13 The results showed that, compared with the blank group, the serum NO content in the model group increased significantly (P<0.05); compared with the model group, the NO content in mice in the positive group and the high and low dose groups of Ganoderma lucidum strain SS30 mycelial polysaccharide decreased to varying degrees, with extremely significant differences (P<0.001), among which the high dose group showed the most significant downregulation, which was better than other groups.
[0075] The above experiments show that the mycelial polysaccharide of the Ganoderma lucidum strain SS30 after space breeding has a stronger anti-pancreatic cancer effect than that of the original strain polysaccharide. Its inhibitory effect is related to its ability to improve the immune function of tumor-bearing mice and reduce the production level of oxidative products.
[0076] 3. In vivo tumor suppression experiment - colorectal cancer
[0077] A mouse model of colorectal cancer was established using intraperitoneal injection of azomethane (AOM) combined with free access to 2% sodium dextran sulfate (DSS). The mice were randomly divided into four groups: a control group, a model group, a positive control group (original strain fermented mycelial polysaccharide), and high- and low-dose mycelial polysaccharide groups, with 10 mice in each group. The control and model groups were administered physiological saline by gavage; the positive control group was administered 200 mg / kg of original strain fermented mycelial polysaccharide by gavage; the high- and low-dose mycelial polysaccharide groups were administered 200 mg / kg and 100 mg / kg of Ganoderma lucidum strain SS30 mycelial polysaccharide, respectively, by gavage once daily for 6 weeks. During this period, the mice's growth, mental state, and coat condition were observed daily. The model group mice developed diarrhea with visible bloody stools, reduced food intake, emaciated appearance, poor mental state, significantly reduced activity, piloerection on the back, and dull coat. Mice given the positive control drug and low and high doses of mycelial polysaccharide experienced milder diarrhea and bloody stools, and their body weight was similar to that of the normal group (P>0.05, see below). Figure 14 Their mental state and hair luster were better than those of the model group.
[0078] After the experiment, colon tissue was taken from each group of mice, and the colon length was measured. The results are as follows: Figure 15 As shown, low and high doses of mycelial polysaccharide and positive control drugs can reverse the colonic shortening induced by the modeling drug and restore colonic length to varying degrees. Among them, the colonic length of mice in the high-dose mycelial polysaccharide group was significantly longer than that in the positive control group and the low-dose mycelial polysaccharide group, and was closer to the colonic length of the normal group.
[0079] Mouse colons were collected in EP tubes, and physiological saline was added at a ratio of 1:9. The mixture was disrupted at 50 Hz for 60 s, then centrifuged at 8000 rpm for 10 min. The supernatant was separated, and the levels of IL-6, IL-1β, TNF-α, and IFN-γ in the mouse colon supernatant were measured using a kit. The results were obtained using a microplate reader. 450nm Measure the absorbance and calculate the concentrations of the aforementioned cytokines. Results are as follows: Figures 16-19 As shown. Figure 16 The results showed that, compared with the blank group, the colonic IL-6 content in the model group was significantly increased (P<0.001); compared with the model group, the colonic IL-6 content in mice in the positive drug and high and low dose mycelial polysaccharide groups was significantly decreased, among which the high dose group of Ganoderma lucidum strain SS30 mycelial polysaccharide showed the most significant decrease, which was close to the level of the normal group and better than the other groups. Figure 17 The results showed that, compared with the blank group, the colonic TNF-α content in the model group was significantly increased (P<0.001). Compared with the model group, the colonic TNF-α content in the positive drug group, the high-dose mycelial polysaccharide group, and the low-dose mycelial polysaccharide group was significantly decreased. Among them, the positive group and the high-dose mycelial polysaccharide group of Ganoderma lucidum strain SS30 had the most significant decrease, which was close to the level of the normal group. Figure 18The results showed that, compared with the blank group, the colonic IL-1β content in the model group was significantly increased (P<0.001). Compared with the model group mice, the IL-1β expression levels in the high-dose mycelial polysaccharide group, the low-dose mycelial polysaccharide group, and the positive group were significantly decreased. Among them, the downregulation was most obvious in the high-dose mycelial polysaccharide group of Ganoderma lucidum strain SS30, which was close to the level of the blank group. Figure 19 The results showed that, compared with the blank group, the IFN-γ content in the colon of the model group was decreased, reaching a highly significant difference (P<0.001). Compared with the model group, the IFN-γ content in the colon of mice in the high- and low-dose mycelial polysaccharide and positive groups all increased to varying degrees, reaching significant differences (P<0.001). Among them, the high-dose group of Ganoderma lucidum strain SS30 mycelial polysaccharide showed the most significant upregulation, which was better than other groups.
[0080] The above experiments show that the mycelial polysaccharide of the Ganoderma lucidum strain SS30 after space breeding has a stronger inhibitory effect on colorectal cancer than the polysaccharide of the original strain, and its inhibitory effect is related to its ability to improve the immune function of tumor-bearing mice.
[0081] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A polysaccharide from the mycelium of Ganoderma lucidum strain SS30, characterized in that, The polysaccharide of the Ganoderma lucidum strain SS30 mycelium is composed of glucose, galactose, mannose, fucose, xylose, arabinose, rhamnose, glucuronic acid, glucosamine, ribose, and lacturonic acid in a molar ratio of 466.0:101.9:41.4:22.3:7.8:5.6:4.5:3.2:3.2:1.7:1, with an average molecular weight of 1.57 × 10⁻⁶. 6 Da.
2. The method for preparing the polysaccharide from the Ganoderma lucidum strain SS30 mycelium according to claim 1, characterized in that, Includes the following steps: (1) The mycelium of Ganoderma lucidum strain SS30 was subjected to ultrasonic extraction with ethanol and hot water extraction to obtain the supernatant; (2) After removing proteins, dialysis and drying the supernatant, crude polysaccharide is obtained; (3) The crude polysaccharide was eluted with water and sodium chloride solution in sequence using a DEAE Sepharose Fast Flow column. The eluent was collected, dialyzed, and dried to obtain the mycelial polysaccharide of the Ganoderma lucidum strain SS30.
3. The preparation method according to claim 2, characterized in that, The ultrasonic extraction process of ethanol is as follows: the dried Ganoderma lucidum strain SS30 mycelium is mixed with 85%~95% ethanol solution at a ratio of 1g:1mL, and ultrasonically extracted for 20-60min at 80W~120W and 35℃~55℃; after ultrasonic extraction twice, the precipitate is collected by centrifugation.
4. The preparation method according to claim 3, characterized in that, The hot water extraction process is as follows: the precipitate is mixed with water at a material-to-liquid ratio of 1:15 to 1:45 and extracted at 60 to 90 °C for 60 to 120 min; after extraction twice, the supernatants are combined.
5. The preparation method according to claim 2, characterized in that, In step (2), the protein removal method is the Sevag method; the molecular weight cutoff of the dialysis bag used during dialysis is 8000~12000 Da.
6. The preparation method according to claim 2, characterized in that, The elution process is as follows: the crude polysaccharide is prepared into a loading solution of 1 mg / mL, and water and 0.1~0.3 mol / L sodium chloride solution are used as elution buffers. Gradient elution is performed with a total volume of 500 mL of elution buffer, and the 170~260 mL of elution buffer is collected.
7. The preparation method according to claim 2, characterized in that, In step (3), the molecular weight cutoff of the dialysis bag used during dialysis is 8000~12000 Da.
8. The use of the Ganoderma lucidum strain SS30 mycelial polysaccharide according to claim 1 or the Ganoderma lucidum strain SS30 mycelial polysaccharide prepared by any one of claims 2-7 in the preparation of immunomodulatory drugs.
9. The use of the Ganoderma lucidum strain SS30 mycelial polysaccharide according to claim 1 or the Ganoderma lucidum strain SS30 mycelial polysaccharide prepared by any one of claims 2-7 in the preparation of a drug for treating cancer, characterized in that, The cancers mentioned include colorectal cancer and pancreatic cancer.
10. A drug for treating cancer, characterized in that, The drug contains the mycelial polysaccharide of Ganoderma lucidum strain SS30 as described in claim 1 or the mycelial polysaccharide of Ganoderma lucidum strain SS30 prepared by any one of claims 2-7; the cancer includes colorectal cancer and pancreatic cancer.
Citation Information
Patent Citations
Application of ganoderma lucidum strain SS30 in preparation of products for treating or preventing diabetes
CN114259508A
Ganoderma lucidum strain SS30 and application thereof
CN114350525A