Saccharomyces cerevisiae and application thereof

Abstract

The invention provides a Monospora serisseria, the Monospora serisseria is a Monospora serisseria AMCC 31719 strain, and is preserved in the China Center for Type Culture Collection (CCTCC), and the preservation number is CCTCC NO: M 20242063. The Monospora serisseria strain disclosed by the invention can utilize multiple carbon sources in the growth process, has the characteristics of high glycerol yield, beta-glucosidase yield and aroma yield, and can be used for preparing a high-yield culture medium. The method can improve the flavor and texture of baked products, and is mainly applied to the field of food or fermented food.

Description

Technical Field

[0001] The present invention relates to the field of microorganisms, and specifically relates to a Monosporozyma servazzii and its application. Background Art

[0002] Monosporozyma servazzii exists in traditional pickled vegetables, pickles, fermented sausage and fermented pasta. Chang Hee Jeong et al. showed through cell experiments, animal experiments and genomic analysis that Monosporozyma kazachstanica has food safety (C-H Jeong, Kim J-Y, Oh Y-J, et al. Safety assessment of white colony-forming yeasts in kimchi[J]. Food Microbiol, 2022, 106104057.). The main role of Monosporozyma kazachstanica in the fermentation process of vegetables and meats is to react with substances such as ethanol and organic acids to generate aromatic substances such as esters, enriching the aroma of food. In flour products, Patent CN117229930A reported a Monosporozyma servazzii strain that increases the viscosity of food by producing polysaccharide compounds, making the pasta more chewy. Patent KR101975105B1 isolated a Monosporozyma servazzii strain with excellent gas production ability from apple preserves, which can be used as a leavening agent for baking food applications. Monosporozyma servazzii has application potential in the field of flour products. Previous studies have explored the development of Monosporozyma servazzii in the application direction of flour products from the characteristics of gas production, polysaccharides, etc., but there is no report on delaying bread staling and improving the flavor of flour products.

[0003] An important sign of bread staling is the increase in hardness. The key to the softness of bread mainly depends on the fluffiness and moisture content. In terms of fluffiness, there are already excellent industrial Saccharomyces cerevisiae strains with very good gas production performance in the food industry that can quickly and fully expand the dough. In terms of moisture content, in bread production, moisturizing additives are often added externally to help improve the softness. However, with the improvement of the public's health awareness, healthy eating methods such as no addition are increasingly advocated by society, and adding moisturizing additives is significantly inconsistent with the current pursuit of natural foods and simple formulations. Summary of the Invention

[0004] In view of the problem of bread staling existing currently and the fact that moisturizing additives are often added externally to help improve the softness in bread production, the present invention provides a Monosporozyma servazzii and its application. This yeast strain can delay bread staling in the application of flour products, reduce the change in hardness during the storage period of bread, maintain the softness of bread, and improve the aroma.

[0005] Specifically, the present invention proposes the following technical solutions:

[0006] In a first aspect, the present invention provides a Monosporozyma servazzii, characterized in that the Monosporozyma servazzii is the strain Monosporozyma servazzii AMCC 31719, which is deposited in the China Center for Type Culture Collection (CCTCC) with the deposit number CCTCC NO: M20242063.

[0007] Preferably, the Monosporozyma servazzii is characterized in that the ITS gene sequence of the Monosporozyma servazzii AMCC 31719 strain is as shown in SEQ ID NO.3.

[0008] Preferably, the Monosporozyma servazzii is characterized in that the carbon sources utilizable by the Monosporozyma servazzii AMCC 31719 strain include one or more selected from the group consisting of glucose, galactose, xylose, melibiose, maltose, cellobiose, inulin, stachyose, trehalose, glycerol and fructose.

[0009] Preferably, the Monosporozyma servazzii is characterized in that the Monosporozyma servazzii AMCC 31719 strain produces glycerol;

[0010] Preferably, the content of glycerol in the strain fermentate is ≥ 7.5 g / L;

[0011] More preferably, the content of glycerol in the strain fermentate is 7.5 - 7.7 g / L.

[0012] Preferably, the Monosporozyma servazzii is characterized in that the Monosporozyma servazzii AMCC 31719 strain produces β-glucosidase.

[0013] Preferably, the Monosporozyma servazzii is characterized in that the Monosporozyma servazzii AMCC 31719 strain produces flavor and aroma substances, and the flavor and aroma substances include alcohols, esters, aldehydes and ketones;

[0014] Preferably, the alcohol substances include linalool, isoamyl alcohol, phenethyl alcohol and / or nerolidol;

[0015] And / or, the ester substances include isoamyl acetate, phenethyl acetate and / or ethyl caprate;

[0016] And / or, the aldehyde substances include nonanal and / or phenylacetaldehyde;

[0017] And / or, the ketone substances include acetoin;

[0018] More preferably, the flavor and aroma substances include acetoin.

[0019] Preferably, the Sporobolomyces salmonicolor is characterized in that the concentration of linalool in the alcohol substance is 33-38 μg / L, and / or the concentration of isoamyl alcohol is 12000-12400 μg / L, and / or the concentration of phenethyl alcohol is 13100-13500 μg / L, and / or the concentration of nerolidol is 1000-1210 μg / L;

[0020] And / or, the concentration of isoamyl acetate in the ester substance is 26-30 μg / L, and / or the concentration of phenethyl acetate is 24000-24200 μg / L, and / or the concentration of ethyl caprate is 100-130 μg / L;

[0021] And / or, the concentration of nonanal in the aldehyde substance is 14-18 μg / L, and / or the concentration of phenylacetaldehyde is 17-21 μg / L;

[0022] And / or, the concentration of acetoin in the ketone substance is 350-400 μg / L.

[0023] In a second aspect, the present invention provides a bacterial agent, which is characterized in that the bacterial agent comprises the Sporobolomyces salmonicolor AMCC 31719 strain.

[0024] Preferably, the bacterial agent is characterized in that the bacterial agent further comprises auxiliary materials.

[0025] In a third aspect, the present invention provides a fermented product, which is characterized in that the fermented product is prepared by fermenting the Sporobolomyces salmonicolor AMCC 31719 strain or the bacterial agent.

[0026] In a fourth aspect, the present invention provides a preparation method of the fermented product, which is characterized in that the method comprises the following steps: culturing the Sporobolomyces salmonicolor AMCC 31719 strain or the bacterial agent.

[0027] Preferably, the preparation method is characterized in that the preparation method comprises the following steps:

[0028] (1) Amplifying and culturing the Sporobolomyces salmonicolor AMCC 31719 strain or the bacterial agent;

[0029] (2) Adding the product obtained in step (1) to a culture medium and performing fermentation culture at 10-45 °C.

[0030] In a fifth aspect, the present invention provides the application of the fermented product prepared by the Sporobolomyces salmonicolor or the bacterial agent or the fermented product or the preparation method of the fermented product in the preparation of food, food additives, feed, drugs or health products.

[0031] Preferably, for the said application, it is characterized in that the application in the preparation of food additives includes the application in the preparation of moisture-retaining food additives or edible flavors.

[0032] Preferably, for the said application, it is characterized in that the application in the preparation of food includes the application in the preparation of baked foods;

[0033] Preferably, the baked foods include bread, pastries, biscuits, steamed buns and / or steamed stuffed buns;

[0034] More preferably, in the preparation of baked foods, it is used in co-fermentation with Saccharomyces cerevisiae.

[0035] Preferably, for the said application, it is characterized in that in the preparation of baked foods, it produces moisture-retaining components during the early fermentation of baked foods, delaying the aging of baked foods.

[0036] Preferably, for the said application, it is characterized in that in the preparation of baked foods, it enhances the flavor of baked foods;

[0037] Preferably, the baked foods contain alcohol, ester, ketone, aldehyde and / or phenolic flavor substances;

[0038] And / or, the alcohol flavor substances include n-hexanol, isoamyl alcohol and / or phenethyl alcohol;

[0039] And / or, the ester flavor substances include γ-nonalactone;

[0040] And / or, the ketone flavor substances include acetoin and / or ethylcyclopentenolone;

[0041] And / or, the aldehyde flavor substances include n-pentanal;

[0042] And / or, the phenolic flavor substances include maltol.

[0043] Preferably, for the said application, it is characterized in that the content of n-hexanol in the alcohol flavor substances is 410-430 μg / kg, and / or the content of isoamyl alcohol is 4000-4300 μg / kg, and / or the content of phenethyl alcohol is 4700-4900 μg / kg;

[0044] And / or, the content of γ-nonalactone in the ester flavor substances is 110-140 μg / kg;

[0045] And / or, the content of acetoin in the ketone flavor substances is 3500-3700 μg / kg, and / or the content of ethylcyclopentenolone is 28-32 μg / kg;

[0046] And / or, the content of n-pentanal in the aldehyde flavor substances is 2800-3100 μg / kg;

[0047] And / or, the content of maltol in the phenolic flavor substance is 650 - 690 μg / kg.

[0048] Preferably, in the application described above, the application in the preparation of food includes the application in the preparation of fermented food;

[0049] Preferably, the fermented food includes fermented fruit and vegetable juice, fermented fruits and vegetables and / or fermented milk;

[0050] More preferably, the fermented fruits and vegetables include pickles.

[0051] Preferably, in the application described above, the application in the preparation of medicine includes the application in the fermentation of traditional Chinese medicine.

[0052] In the sixth aspect, the present invention provides a kind of bread, characterized in that the leavening agent of the bread contains the Thielavia terrestris AMCC 31719 strain described above or the bacterial agent or the ferment or the ferment prepared by the preparation method of the ferment.

[0053] Preferably, in the bread described above, the leavening agent used for making the bread further includes Saccharomyces cerevisiae.

[0054] The beneficial effects of the present invention include:

[0055] During the growth process of the Thielavia terrestris AMCC 31719 strain provided by the present invention, it can utilize a variety of carbon sources, has the characteristics of high glycerol production and high β - glucosidase production, and has the ability to produce flavor substances during the fermentation process. The flavor substances produced include alcohols, esters, aldehydes and ketones. Among them, the alcohol substances include linalool with a concentration of 33 - 38 μg / L, isoamyl alcohol with a concentration of 12000 - 12400 μg / L, phenethyl alcohol with a concentration of 13100 - 13500 μg / L and nerolidol with a concentration of 1000 - 1210 μg / L. The aroma activity value of linalool is 150 - 170, the aroma activity value of isoamyl alcohol is 22 - 26, the aroma activity value of phenethyl alcohol is 20 - 25, and the aroma activity value of nerolidol is 10 - 13. The ester substances include isoamyl acetate with a concentration of 26 - 30 μg / L, phenethyl acetate with a concentration of 24000 - 24200 μg / L and ethyl caprate with a concentration of 100 - 130 μg / L. The aroma activity value of isoamyl acetate is 160 - 190, the aroma activity value of phenethyl acetate is 90 - 100, and the aroma activity value of ethyl caprate is 20 - 25. The aldehyde substances include nonanal with a concentration of 14 - 18 μg / L and phenylacetaldehyde with a concentration of 17 - 21 μg / L. The aroma activity value of nonanal is 13 - 15, and the aroma activity value of phenylacetaldehyde is 3 - 5. The ketone substances include acetoin with a concentration of 350 - 400 μg / L. The aroma activity value of acetoin is 24 - 28.

[0056] The Monosporozyma servazzii AMCC 31719 strain provided in the present invention can delay bread staling, enhance the fragrance in baking applications, and reduce the dosage of additives in bread processing. It can promote the production of alcohol, ester, ketone, aldehyde, and phenolic flavor substances in baked foods. Among them, the alcohol flavor substances include n-hexanol with a content of 3500 - 3800 μg / kg, isopentanol with a content of 4000 - 4300 μg / kg, and phenethyl alcohol with a content of 4500 - 4900 μg / kg. The aroma activity value of n-hexanol is 70 - 80, the aroma activity value of isopentanol is 8 - 10, and the aroma activity value of phenethyl alcohol is 8 - 10. The ester flavor substances include γ-nonalactone with a content of 110 - 140 μg / kg. The aroma activity value of γ-nonalactone is 10 - 15. The ketone flavor substances include acetoin with a content of 3500 - 3700 μg / kg and ethylcyclopentenolone with a content of 28 - 32 μg / kg. The aroma activity value of acetoin is 240 - 260, and the aroma activity value of ethylcyclopentenolone is 1 - 3. The aldehyde flavor substances include n-valeraldehyde with a content of 2800 - 3100 μg / kg. The aroma activity value of n-valeraldehyde is 240 - 260. The phenolic flavor substances include maltol with a content of 650 - 690 μg / kg. The aroma activity value of maltol is 2 - 5.

[0057] The Monosporozyma servazzii AMCC 31719 strain can improve the softness of bread and delay bread staling only through the moisturizing components produced by yeast fermentation without the additional addition of sugars and fats. For the food manufacturing industry, this can reduce the use of additives, lower the calorie and fat content of products, and meet consumers' demands for healthy diets. The Monosporozyma servazzii AMCC 31719 strain can be widely applied to the production of various foods, such as bread, pastries, biscuits, etc., and has broad market demand and good application prospects.

[0058] Strain preservation information

[0059] The Monosporozyma servazzii AMCC 31719 strain provided by the present invention was deposited at the China Center for Type Culture Collection (CCTCC) on September 24, 2024. The deposit number is: CCTCC NO: M20242063. The deposit address is: Wuhan University, Wuhan, China, Postcode: 430072; Tel: 027 - 68754052. Brief description of the drawings

[0060] Figure 1 Shown is the colony morphology of the Monosporozyma servazzii AMCC 31719 strain on YPD solid medium in Example 1.

[0061] Figure 2The cell morphology of the Monosporozyma servazzii strain AMCC 31719 in Example 1 is shown as follows.

[0062] Figure 3 The growth curves of the Monosporozyma servazzii strain AMCC 31719 in different carbon source assimilation media in Example 2 are shown as follows.

[0063] Figure 4 The growth curve of the Monosporozyma servazzii strain AMCC 31719 in YPD medium in Example 2 is shown as follows.

[0064] Figure 5 The phenotypes of the Monosporozyma servazzii strain AMCC 31719 and the Saccharomyces cerevisiae strain AMCC 31194 in the β-glucosidase screening medium plate in Example 4 are shown as follows.

[0065] Figure 6 The infrared scanning pictures of the surface and cross-section of the control group toast and the test group toast in Experimental Example 1 are shown as follows. A is the infrared scanning picture of the surface of the control group toast, B is the infrared scanning picture of the surface of the test group toast, C is the infrared scanning picture of the cross-section of the control group toast, and D is the infrared scanning picture of the surface of the test group toast.

[0066] Figure 7 The hardness changes of the control group and test group toasts during storage in Experimental Example 1 are shown as follows. Detailed implementation manners

[0067] The technical solutions of the present invention will be further described in detail below in conjunction with specific embodiments and the accompanying drawings, but the present invention is not limited to the following technical solutions.

[0068] The Monosporozyma servazzii provided by the present invention was isolated from kimchi in Yanji City, Jilin Province, and the species was identified as Monosporozyma servazzii, which is a natural wild-type microorganism. The Monosporozyma servazzii provided by the present invention is named: Monosporozyma servazzii strain AMCC 31719. The Monosporozyma servazzii provided by the present invention has the ability to utilize multiple carbon sources, high glycerol production, and a variety of flavor substances are produced after the strain is fermented. Further research found that the strain has the ability to produce β-glucosidase. Applying the Monosporozyma servazzii strain AMCC 31719 of the present invention to the preparation of baked foods overcomes the defect that baked foods are prone to aging, improves the fragrance of baked foods, and provides baked foods with clean formulas.

[0069] The Saccharomyces cerevisiae strain AMCC 31194 in Example 3 of the present invention was obtained by hybridization. The specific construction and identification methods of the strain have been disclosed in the patent application with the publication number CN117165456A. The identification results of the strain are as follows: The colony texture of this Saccharomyces cerevisiae strain is cheese-like, the color is milky white, the surface is smooth, the edge is neat, the microscopic morphology is oval, and it reproduces by budding. Through 26S rDNA gene identification, it is determined that this strain is a strain of the species Saccharomyces cerevisiae. This strain was deposited in the China Center for Type Culture Collection on December 29, 2021, with the deposit number CCTCC NO: M20211684, and the deposit address: Wuhan University, Wuhan, China, postal code: 430072; telephone: (027) 68754562.

[0070] Unless otherwise specified, all kinds of reagents and instruments used in the examples and comparative examples of the present invention are conventional commercially available products. The sources of the reagents and instruments used in the present invention are shown in Tables 1 and 2 below.

[0071] Table 1 Reagent Information Table

[0072]

[0073]

[0074] Table 2 Instrument Information Table

[0075]

[0076]

[0077] YPD solid medium: 1 g of yeast extract powder, 2 g of glucose, 2 g of peptone, 2 g of agar, 100 mL of distilled water, sterilized at 115 °C for 20 min.

[0078] YPD liquid medium: 1 g of yeast extract powder, 2 g of glucose, 2 g of peptone, 100 mL of distilled water, sterilized at 115 °C for 20 min.

[0079] Carbon source assimilation medium: 0.67 g of YNB medium, carbon source (glucose, galactose, lactose, sucrose, xylose, raffinose, melibiose, maltose, rhamnose, cellobiose, arabinose, inulin, stachyose, melezitose, trehalose, glycerol, lactic acid, acetic acid, fructose or sorbitol) 2 g, dissolved in 100 mL of sterile distilled water and filtered through a 0.22 μm filter membrane to sterilize. A total of 20 kinds of carbon source assimilation media were prepared.

[0080] β-glucosidase screening medium: 0.1 g of esculin, 0.25 g of ammonium ferric citrate, 1 g of yeast extract powder, 2 g of glucose, 2 g of peptone, 100 mL of distilled water, sterilized at 115°C for 20 min.

[0081] Example 1 Isolation and Identification of Monosporus sergii AMCC 31719 Strain

[0082] 1. Isolation and purification of strains

[0083] The strain of Monosporus serrellii AMCC 31719 was isolated from spicy cabbage in Yanji City, Jilin Province. The specific separation and purification methods are as follows:

[0084] Take 30mL of sterile saline in a 50mL sterile centrifuge tube, scrape the surface of kimchi with sterile tweezers, tear off about 1g of kimchi and put it in the tube, tighten the lid, shake for 2min, mix, and draw 1mL of the mixed solution, inoculate it into a 50mL centrifuge tube containing 40mL YPD medium, and enrich and culture it at 30℃ for 48h. Dip 1 loop of enriched bacterial solution with an inoculation loop, streak culture on YPD solid medium, and after a single colony grows, pick a single bacterium and continue to streak and purify it twice in YPD solid medium. Because only one colony morphology was found during the operation, after purification twice, pick a single colony and inoculate it in YPD liquid medium, culture it overnight at 30℃, and use it to prepare glycerol species and genome extraction.

[0085] 2. Identification of strains

[0086] Identification of the ITS gene sequence of the strain: DNA extraction was performed using a DNA extraction kit, and then ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') (SEQ ID NO.1) and ITS4 (5'-TCCTCCGCTTATTGATATGC-3') (SEQ ID NO.2) were used as primers for gene amplification of the strain. The amplification conditions were as follows: the PCR program was 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s, 55°C annealing for 15 s, 72°C extension for 10 s, 30 cycles, and finally 72°C extension for 10 min, which was used to amplify the ITS gene sequence. After 1% (1 g / 100 mL) gel electrophoresis detection and sequencing, the ITS gene sequence of the yeast AMCC 31719 strain SEQ ID NO.3 was measured as follows:

[0087] AAATGGAAAAGGGTTTTTCGTTGCTTTGCGAGGAGACACTATACTGCTGGACCAGCGCTTAATTGCGCGGTTTGGTGGGTCTCTGTAGCTCAGTAGCACTATTACACACAGTGGAGATTTTTATAATTCTTTGCATGCTTCTTTGGGCTGCTTCGGCGGCCCAGGAGTGACAAACACAAACAATTTTGTAATTTTATGAACTAGTCAAAACCAGAATTCCAGGAAGATTTATCTTTTTGTAATATTAAAACAAATATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACAGCAATGTTTGGTTGTGAGTGATACTCTTTCGGAGTTAGCTTGAAATTGCTGGCCGATGGCTGTTGTGGTTGAGTGTCTCCCTTCGGGGAGAGCGCTTGCTGCGTTAAGGGACGTCCTGCTGGACATCTTCGTATTAGGTTCTACCAACTTCGAAGACGGTTAGCGGGGAGTTCTGCAGTGAGTGTAGTGCTTTTACTACGTTGCACCATGGCGAACAGTGTTCTTTTAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAA was analyzed and aligned with the sequence on GenBank by Blast. Sequences with a similarity greater than 99% are of the same species. Combined with morphological analysis, its colony morphology is milky white and cheese-like, with a smooth surface and neat edges (as shown in Figure 1 ), and the microscopic morphology of the cells is oval (as shown in Figure 2 ). Through morphological analysis and molecular identification, this strain was determined to be Monosporozyma servazzii, and the strain number is AMCC 31719. It was deposited in the China Center for Type Culture Collection (CCTCC) on September 24, 2024, and the deposit number is: CCTCC NO: M20242063.

[0088] Example 2: Carbon Source Assimilation Test and Growth Curve Analysis of Sporobolomyces salmonicolor AMCC 31719 Strain

[0089] (1) Carbon Source Assimilation Test

[0090] Inoculate the Sporobolomyces salmonicolor AMCC 31719 bacterial solution preserved in the glycerol tube of Example 1 into the YPD liquid medium at an inoculation amount of 2% (v / v) and incubate overnight for activation. Take 1 mL of the bacterial solution into a 2 mL EP tube, centrifuge at 8000 rpm for 3 min, discard the supernatant, add 1 mL of sterile water to resuspend for washing the residual sugar, centrifuge again at 8000 rpm for 3 min, and discard the supernatant, then add 1 mL of sterile water to resuspend the bacterial cells. Take 2 μL of the bacterial suspension and inoculate it into an ELISA plate containing 200 μL of carbon source assimilation medium respectively. Incubate at 30 °C and 180 r / min for 72 h, observe the turbidity situation. The more the accumulation of bacterial mass, the more turbid it is, and the higher the carbon source utilization rate. Use "+" and "-" to represent the carbon source utilization situation respectively. Strong positive: "+++", positive: "++", weak positive: "+", negative: "-", and the results are shown in Table 3.

[0091] Table 3

[0092]

[0093] As can be seen from Table 3, the Sporobolomyces salmonicolor AMCC 31719 strain can utilize glucose, galactose, xylose, melibiose, maltose, cellobiose, inulin, stachyose, trehalose, glycerol, fructose, and cannot utilize lactose, sucrose, raffinose, rhamnose, arabinose, melezitose, lactic acid, acetic acid, sorbitol. In addition, Sporobolomyces salmonicolor AMCC 31719 grows vigorously in glucose, galactose and fructose, followed by inulin, stachyose, maltose, and grows slowly in trehalose, glycerol, melibiose, xylose, cellobiose.

[0094] (2) Growth Curve Analysis

[0095] Inoculate the Sporobolomyces salmonicolor AMCC 31719 bacterial solution preserved in Example 1 into the YPD liquid medium at an inoculation amount of 2% (v / v), and culture it at 30 °C and 180 rpm for 24 h to obtain a viable cell count of 10 8CFU / mL bacterial suspension, and centrifuge and wash this bacterial suspension. The specific method of centrifugation and washing is as follows: Take 1 mL of this bacterial suspension and centrifuge it at 8000 rpm for 2 min, discard the supernatant and retain the bacterial cell precipitate. Resuspend the bacterial cell precipitate with 1 mL of sterile water, and centrifuge and wash the bacterial cell precipitate twice. Then resuspend the bacterial cell precipitate with 1 mL of sterile water, and inoculate it into a 100-well culture plate containing 20 kinds of 300 μL carbon source assimilation media at an inoculation amount of 1% (v / v), and measure and plot its growth curve through a Bioscreen C instrument. Among them, the carbon sources in the 20 kinds of carbon source assimilation media are: glucose, galactose, lactose, sucrose, xylose, raffinose, melibiose, maltose, rhamnose, cellobiose, arabinose, inulin, stachyose, melezitose, trehalose, glycerol, lactic acid, acetic acid, fructose, sorbitol. The setting parameters of the Bioscreen C instrument are: temperature 30 °C, wavelength 600 nm, measure the absorbance every 0.5 h. The growth curves of Thraustochytrium sp. AMCC 31719 strain in different carbon source assimilation media are as Figure 3 shown. From Figure 3 it can be seen that Thraustochytrium sp. AMCC 31719 strain grows well in the carbon assimilation media containing glucose, galactose, or fructose as carbon sources. Its growth curve is S-shaped, and the growth rate of the strain is vigorous during the exponential phase, and it reaches the plateau phase after 24 hours of cultivation. The exponential phase of Thraustochytrium sp. AMCC 31719 strain in the media containing inulin, stachyose, or maltose as carbon sources is relatively gentle, its growth curve is S-shaped, and it does not reach its plateau phase after 72 h of cultivation. The growth curves of Thraustochytrium sp. AMCC 31719 strain in xylose, melibiose, cellobiose, trehalose, and glycerol do not show an obvious lag phase, and show a slow and continuous growth trend within 72 h of cultivation. Among them, calculate the specific growth rate (μ) of Thraustochytrium sp. AMCC 31719 strain in each data detection time period (0.5 h) in different carbon source assimilation media = (In OD data at the end - In OD data at the beginning) / 0.5, and take the maximum value of the calculated specific growth rate (μ) as the maximum specific growth rate (μ max ), as shown in Table 4.

[0096] Table 4

[0097]

[0098]

[0099] As can be seen from Table 4, Thraustochytrium sp. AMCC 31719 strain has the maximum specific growth rate in the glucose carbon source assimilation medium, and its μ maxwas 0.31, indicating that glucose was the carbon source with the highest utilization efficiency by Sporobolomyces salmonicolor AMCC 31719 strain. The growth curve of Sporobolomyces salmonicolor AMCC 31719 strain in YPD medium was as Figure 4 shown. In the YPD medium with glucose as the carbon source, the culture period from 0 to 3 hours was the lag phase, the period from 3 to 10 hours was the exponential phase, and it entered the stationary phase after 12 hours of culture. The maximum specific growth rate μ max in the YPD medium was 0.55, and the OD value in the stationary phase was 1.38. The nutrients in the YPD medium were richer than those in the carbon source assimilation medium, and could more truly represent the growth trend and biomass of yeast strains in conventional fermentation.

[0100] Example 3 Analysis of Fermentation Metabolites and Flavor Substances of Sporobolomyces salmonicolor AMCC 31719 Strain

[0101] (1) Fermentation Metabolites of Sporobolomyces salmonicolor AMCC 31719 Strain

[0102] The Sporobolomyces salmonicolor AMCC 31719 bacterial liquid preserved in the glycerol tube of Example 1 was inoculated into YPD liquid medium at an inoculation amount of 2% (v / v) for overnight activation, and then 1.5 mL of the bacterial liquid was inoculated into a 500 mL shake flask filled with 300 mL of YPD liquid medium, and cultured on a shaker at 30 °C and 180 rpm for 24 h to obtain the fermentation broth of Sporobolomyces salmonicolor AMCC 31719 strain. After shaking the fermentation broth evenly, it was aliquoted into 50 mL centrifuge tubes and centrifuged at 5000 rpm for 10 min to collect the fermentation supernatant. The components in the fermentation supernatant were detected by liquid chromatography analysis. And the Saccharomyces cerevisiae strain AMCC 31194 strain was used as a control strain. The collection method and detection method of the fermentation supernatant of the Saccharomyces cerevisiae strain AMCC 31194 strain were the same as those of the Sporobolomyces salmonicolor AMCC 31719 strain. The fermentation supernatant components of the Sporobolomyces salmonicolor AMCC 31719 strain and the Saccharomyces cerevisiae AMCC 31194 strain are shown in Table 5.

[0103] Table 5

[0104]

[0105] As can be seen from Table 5, compared with Saccharomyces cerevisiae, the fermentation metabolites of Sporobolomyces salmonicolor strain AMCC 31719 in the shake flask culture stage are mainly manifested in that the glycerol production is as high as 7532.40 - 7699.10 μg / mL, approximately 7.5 - 7.7 g / L. Since the sweetness threshold of glycerol is 5.2 g / L, as can be seen from Table 5, the glycerol production in the fermentation supernatant of Saccharomyces cerevisiae strain AMCC 31194 is 2467.80 - 2591.50 μg / mL, approximately 2.47 - 2.59 g / L, which does not reach the sweetness threshold of glycerol of 5.2 g / L, and its glycerol production only reaches 33% of that of Sporobolomyces salmonicolor strain AMCC 31719. Since glycerol has hygroscopicity, no odor, and has a sweet taste in terms of taste, its sweetness is similar to that of glucose. In the food processing industry, glycerol is usually used as a sweetener and humectant, giving food a smooth and delicious taste and good sensory properties. It is used as a water-retaining and moisture-retaining agent in bread and cakes, has strong hygroscopicity, can keep the soft texture of bread, and extend the shelf life.

[0106] (2) Volatile fermentation flavor substances of Sporobolomyces salmonicolor strain AMCC 31719

[0107] Take 5 mL of the fermentation supernatant of Sporobolomyces salmonicolor strain AMCC 31719 into a headspace vial, add 1.5 g of sodium chloride and 1 μL of internal standard solution (o-dichlorobenzene), mix well, equilibrate at 50 °C for 30 min, and perform full-scan detection and analysis of volatile components. Gas chromatography conditions: Chromatographic column: DB-HeavyWAX, 30 m × 0.25 mm × 0.25 μm, injection port temperature 250 °C, carrier gas: He; temperature programming: maintain at 40 °C for 3 min, increase to 200 °C at a rate of 5 °C / min, hold for 0 min; increase to 250 °C at a rate of 10 °C / min, hold for 3 min. Aroma components are qualitatively analyzed in scan mode, retrieved in the NIST 17 standard library through chromatographic retention time and mass spectrometry information, and the concentration of volatile substances is calculated based on the peak area. The concentration of volatile substances (μg / L) = (peak area of volatile substance (mAU*min) / peak area of internal standard (mAU*min)) × (concentration of internal standard (μg / L) × volume of internal standard (mL) / sample volume (mL)). Among them, the aroma activity values of different volatile substances are calculated, and volatile components with aroma activity values greater than 1 are selected for analyzing aroma characteristics. The formula for calculating the aroma activity value is as follows: Aroma activity value = concentration of volatile substance (μg / L) / aroma component threshold (μg / L). The aroma component threshold is obtained by referring to the book "Compilation of Olfactory Thresholds of Compounds". The volatile flavor substances with aroma activity values greater than 1 in the fermentation supernatant of Sporobolomyces salmonicolor strain AMCC 31719 are shown in Table 6.

[0108] Table 6

[0109]

[0110] As can be seen from Table 6, there are 10 core volatile flavor substances (odor activity value greater than 1) in the fermentation supernatant of the strain Sporobolomyces salmonicolor AMCC 31719, including 4 alcohols, 3 esters, 2 aldehydes, and 1 ketone. Among the alcohol substances, the main aroma contributor is linalool, with a relative content of about 35.28 μg / L and an odor activity value reaching 160.82, mainly contributing to the lily-of-the-valley aroma. Among the ester substances, isoamyl acetate mainly contributes to the banana aroma, with an odor activity value of 189.73; phenethyl acetate contributes to the peach aroma, with an odor activity value of 96.56; ethyl decanoate contributes to the coconut aroma, with an odor activity value of 22.84. Among the aldehyde substances, nonanal mainly contributes to the sweet orange and oil aromas, with an odor activity value of 14.68; phenylacetaldehyde mainly contributes to the narcissus aroma, with an odor activity value of 4.96. Among the ketone substances, acetoin mainly contributes to the milk aroma, with an odor activity value of 26.81.

[0111] Example 4 Enzyme-producing performance of the strain Sporobolomyces salmonicolor AMCC 31719

[0112] The Sporobolomyces salmonicolor AMCC 31719 bacterial liquid and the Saccharomyces cerevisiae AMCC 31194 bacterial liquid stored in glycerol tubes were respectively inoculated into YPD liquid medium at an inoculation amount of 2% (v / v) for overnight activation. The β-glucosidase screening medium was poured into plates. 2 μL of the overnight-cultured Sporobolomyces salmonicolor AMCC 31719 bacterial liquid and the Saccharomyces cerevisiae AMCC 31194 bacterial liquid were respectively pipetted and spot-inoculated at the center of the plate containing the β-glucosidase screening medium, and cultured inverted at 30°C. After repeating 3 times, it was observed and recorded that a black hydrolysis zone began to appear around the colonies of the Sporobolomyces salmonicolor AMCC 31719 strain at 4 h of culture, and the hydrolysis zone gradually deepened at 6 h of culture, while the Saccharomyces cerevisiae AMCC 31194 did not show an enzyme-producing phenotype at 6 h of culture. As Figure 5 shown, at 20 h of culture, Figure 5The black hydrolysis zone of the Sporobolomyces salmonicolor AMCC 31719 strain on the left was significantly larger and darker in color than that of the Saccharomyces cerevisiae AMCC 31194 strain on the right. At this time, the colony diameter d of Sporobolomyces salmonicolor AMCC 31719 was 0.80 cm, the diameter D of the black hydrolysis zone was 3.15 cm, and D / d = 3.94; at the same time, the colony diameter d of Saccharomyces cerevisiae AMCC 31194 was 0.81 cm, the diameter D of the black hydrolysis zone was 1.5 cm, and D / d = 1.85. The size and depth of the black hydrolysis zone on the β-glucosidase-producing plate can qualitatively illustrate the β-glucosidase-producing characteristics of the strain. Since the D / d ratio of Sporobolomyces salmonicolor AMCC 31719 was 113% higher than that of Saccharomyces cerevisiae AMCC 31194, and the enzyme-producing phenotype of Sporobolomyces salmonicolor AMCC 31719 appeared earlier, it indicated that Sporobolomyces hasegawae AMCC 31719 had a stronger β-glucosidase-producing ability. Because aesculin and ammonium ferric citrate were added to the β-glucosidase screening medium, when aesculin was decomposed into esculetin, esculetin would react with the divalent iron ions in ammonium ferric citrate to form a black compound, turning the medium black. Aesculin and glycoside compounds such as cellobiose have a similar β-D-glucopyranose structure, and in the enzymatic reaction, β-glucosidase can decompose the cellobiose structure, and it can recognize and bind to aesculin to decompose it into esculetin.

[0113] Experimental Example 5 Baking Application of Sporobolomyces salmonicolor AMCC 31719 Strain

[0114] Using Saccharomyces cerevisiae AMCC 31194 strain as the control strain and Monosporascus citharexylum AMCC 31719 strain as the test strain. Respectively take the preserved glycerol seeds of Saccharomyces cerevisiae AMCC 31194 strain and Monosporascus citharexylum AMCC 31719 strain, streak-culture on the YPD solid medium plate for 48 h, pick one loop with an inoculation loop and inoculate it into a test tube containing 5 mL of YPD liquid medium. After overnight culture, inoculate it into a shake flask containing YPD liquid medium according to 0.5% by volume percentage, and culture it on a shaker at 30 °C and 180 rpm for 24 h, centrifuge at 5000 rpm for 10 min, discard the fermentation supernatant, and collect the yeast milk of Saccharomyces cerevisiae AMCC 31194 and Monosporascus citharexylum AMCC 31719 respectively. Prepare the seed dough according to the formula in Table 7. First, weigh the yeast milk. In the control group, weigh 6 g of the yeast milk of Saccharomyces cerevisiae AMCC 31194, and in the test group, weigh 2 g of the yeast milk of Saccharomyces cerevisiae AMCC 31194 and 4 g of the yeast milk of Monosporascus citharexylum AMCC 31719. Add 100 g of water and mix well, then add 100 g of high-gluten flour. After simple stirring until there is no dry powder, cover with plastic wrap and ferment at 30 °C for 2 h until the seed dough doubles in size, and then transfer it to 4 °C for overnight refrigeration for 14 h. Then, pour the seed dough of the control group and the test group into the dough mixer simultaneously according to the main dough formula in Table 7, set the dough mixing program to stop automatically when the dough temperature reaches 26 °C, take out the dough, divide it into dough pieces of 400 g each, mark them as No. 1-3, relax for 4 min after manual shaping, roll them into toast rolls by an automatic shaping machine, put them into toast boxes, and proof at 38 °C until the dough height reaches the top of the toast box mold.

[0115] Table 7

[0116]

[0117]

[0118] Put the No. 1-3 dough of the control group and the test group that have filled the toast box mold into a preheated oven, set the baking temperature to 210 °C for the upper temperature and 230 °C for the lower temperature, bake for 25 min. After baking, demold. After the toast cools down, use an infrared scanner to perform a full scan record of the toast appearance. The surface of the control group toast and the surface of the test group toast are respectively as Figure 6 shown in A and B. There is a slightly visible waist collapse on the surface of the control group toast with the naked eye. The imaging results of the cross-section of the control group toast and the cross-section of the test group toast are respectively as Figure 6As shown in B and C in the figure, the appearance of the toast in the experimental group was flat. Then, the No. 1 toast of the control group and the experimental group was sliced using a slicing machine. The pores of the 3 slices in the very center of the No. 1 toast were selected, and a C-cell instrument was used to analyze the non-uniformity and concavity of the pores of the toast. After analysis, it was found that the pore distribution in the experimental group was more uniform. Among them, the pore non-uniformity in the experimental group was 3.77%, and that in the control group was 8.16%. The pore non-uniformity in the experimental group decreased by 53.80% compared with that in the control group; the concavity of the toast in the control group was 3.20%, and that in the experimental group was 2.23%. The appearance of the toast product in the experimental group was improved by 30.31%. The results are shown in Table 8.

[0119] Table 8

[0120]

[0121] Since the important sign of bread aging is the increase in bread hardness, the cooled No. 2 and No. 3 toasts of the control group and the experimental group were respectively put into fresh-keeping bags and stored at room temperature. Slicing was carried out respectively after 1 day and 4 days of storage. The 6 slices in the very center of the toast were selected, and 2 slices were stacked as 1 group for total texture detection by a texture analyzer. The aging degree was compared by detecting the change in the hardness of the toast. The detection parameters were: strain 50%, probe return speed 20 mm / sec, and contact force 5 g. The detection results are as Figure 7 shown. On the day of baking, the hardness of the toast in the control group was 170.68 ± 4.62 g, and the hardness of the toast in the experimental group was 169.12 ± 17.30 g. There was no significant difference in the hardness of the toast between the two groups (p > 0.05); after 1 day of storage at room temperature, the toast began to age. At this time, the hardness of the toast in the control group was 313.29 ± 12.83 g, and the hardness of the toast in the experimental group was 261.53 ± 9.93 g. The aging degree of the toast in the experimental group was significantly delayed by 16.52% compared with that in the control group (p < 0.05); after 4 days of storage at room temperature, the touch of the toast in the experimental group and the control group was still soft, without peculiar smell or mildew. The toast in the experimental group had a buttery fragrance when smelled. The hardness of the toast in the control group was 491.80 ± 18.63 g, and the hardness of the toast in the experimental group was 419.68 ± 21.70 g. The aging degree of the toast in the experimental group was still significantly delayed by 14.66% compared with that in the control group (p < 0.05).

[0122] Accurately weigh 5 g of the bread cores of the control group toast and the test group toast into a solid-phase extraction headspace vial, add 1 μL of the internal standard solution (o-dichlorobenzene), mix well, and seal with a cap. Equilibrate at 50 °C for 30 min and perform GC-MS analysis. Gas chromatography conditions: Chromatographic column: DB-HeavyWAX, 30 m × 0.25 mm × 0.25 μm, injection port temperature 250 °C, carrier gas: He; temperature programming: hold at 40 °C for 3 min, increase to 200 °C at a rate of 5 °C / min, hold for 0 min; increase to 250 °C at a rate of 10 °C / min, hold for 3 min. Calculate the concentration of volatile substances based on the peak area. The concentration of volatile substances (μg / L) = (peak area of volatile substances (mAU*min) / peak area of internal standard (mAU*min)) × (concentration of internal standard (μg / L) × volume of internal standard (mL) / sample volume (mL)). Among them, calculate the aroma activity value of different volatile substances, screen the volatile components with an aroma activity value greater than 1 to analyze the aroma characteristics. The formula for calculating the aroma activity value is as follows: Aroma activity value = concentration of volatile substances (μg / L) / aroma component threshold (μg / L). The aroma component threshold is obtained by referring to the book "Compilation of Olfactory Thresholds of Compounds". Analyze the effects of Saccharomyces cerevisiae AMCC 31194 in the control group toast and Monosporascus cannonballus AMCC 31719 in the test group toast on the volatile flavor substances in the toast by GC-MS full-scan detection. The results are shown in Table 9.

[0123] Table 9

[0124]

[0125]

[0126] As can be seen from Table 9, 5 core flavor substances were detected in the toast of the control group, and 8 core flavor substances were detected in the toast of the experimental group. 1-Hexanol, γ-nonalactone and ethylcyclopentenolone are unique flavor substances in the toast of the experimental group. Among them, the aroma characteristics of 1-hexanol are fat and fruity, and it is mainly used to prepare coconut and berry flavors. The aroma characteristics of γ-nonalactone are coconut and cream aromas, and the aroma characteristics of ethylcyclopentenolone are aromas similar to caramel, smoked and coffee. From the comparison of relative contents, among the flavor substances common to the two groups, the contents of phenylethyl alcohol, acetoin, n-valeraldehyde and maltol in the toast of the experimental group are much higher than those in the control group. By further comparing the aroma activity values of the two groups, it was found that the substance with the highest aroma activity value in the toast of the control group is n-valeraldehyde, and its aroma characteristics are fermented bread flavor, and the aroma activity value of this substance in the control group is 70.97; the substance with the highest aroma activity value in the toast of the experimental group is acetoin, and its aroma characteristics are milk aroma, and the aroma activity value of this substance in the experimental group is 259.21. Compared with the control group, the aroma activity value of acetoin increased by 378.60%. In addition, the aroma activity values of phenylethyl alcohol, isoamyl alcohol and maltol in the experimental group are more than 3 times higher than those in the control group. In summary, due to the contribution of substances such as acetoin, 1-hexanol and γ-nonalactone in the experimental group, more milk flavor is added to the toast of the experimental group. Therefore, the strain of Thielavia sp. AMCC 31719 can delay the aging of toast and enhance the milk flavor of toast in the application of toast. Thielavia sp. AMCC 31719 can achieve the effect of improving softness and delaying bread aging only through the moisturizing components produced by yeast fermentation without adding extra sugar and oil. For the food manufacturing industry, this can reduce the use of additives, lower the calorie and fat content of products, and meet the needs of consumers for healthy diets.

[0127] The above are only the preferred embodiments of the implementation of the present invention, and do not impose any form of limitation on the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A Monosporascus ceti, characterized in that, The Monosporozyma servazzii is the Monosporozyma servazzii AMCC 31719 strain, which is deposited in the China Center for Type Culture Collection (CCTCC) with the deposit number of CCTCC NO: M 20242063.

2. The Thraustochytrium sp. according to claim 1, characterized in that, The ITS gene sequence of the Monosporozyma servazzii AMCC 31719 strain is as shown in SEQ ID NO.

3.

3. The Thraustochytrium sp. according to claim 1 or 2, characterized in that, The carbon sources utilizable by the Monosporozyma servazzii AMCC 31719 strain include one or more selected from the group consisting of glucose, galactose, xylose, melibiose, maltose, cellobiose, inulin, stachyose, trehalose, glycerol and fructose.

4. The Thraustochytrium sp. according to any one of claims 1-3, characterized in that, The Monosporozyma servazzii AMCC 31719 strain produces glycerol; Preferably, the content of glycerol in the strain fermentate is ≥7.5 g / L; More preferably, the content of glycerol in the strain fermentate is 7.5 - 7.7 g / L.

5. The Thraustochytrium sp. according to any one of claims 1-4, characterized in that, The Monosporozyma servazzii AMCC 31719 strain produces β-glucosidase.

6. The Thraustochytrium sp. according to any one of claims 1-5, characterized in that, The Monosporozyma servazzii AMCC 31719 strain produces flavor substances, and the flavor substances include alcohols, esters, aldehydes and ketones; Preferably, the alcohol substances include linalool, isoamyl alcohol, phenethyl alcohol and / or nerolidol; And / or, the ester substances include isoamyl acetate, phenethyl acetate and / or ethyl caprate; And / or, the aldehyde substances include nonanal and / or phenylacetaldehyde; And / or, the ketone substances include acetoin; More preferably, the flavor substances include acetoin.

7. The Thraustochytrium sp. according to claim 6, characterized in that, The concentration of linalool in the alcohol substances is 33 - 38 μg / L, and / or the concentration of isoamyl alcohol is 12000 - 12400 μg / L, and / or the concentration of phenethyl alcohol is 13100 - 13500 μg / L, and / or the concentration of nerolidol is 1000 - 1210 μg / L; And / or, the concentration of isoamyl acetate in the ester substances is 26 - 30 μg / L, and / or the concentration of phenethyl acetate is 24000 - 24200 μg / L, and / or the concentration of ethyl caprate is 100 - 130 μg / L; And / or, the concentration of nonanal in the aldehyde substances is 14 - 18 μg / L, and / or the concentration of phenylacetaldehyde is 17 - 21 μg / L; And / or, the concentration of acetoin in the ketone substances is 350 - 400 μg / L.

8. A bacterial agent, characterized in that, The microbial agent includes the Monosporozyma servazzii AMCC 31719 strain according to any one of claims 1 - 7.

9. The microbial agent according to claim 8, characterized in that, The microbial agent further includes excipients.

10. A ferment, characterized in that, The fermentate is prepared by fermentation with the Monosporozyma servazzii AMCC 31719 strain according to any one of claims 1 - 7 or the microbial agent according to claim 8 or 9.

11. A method for preparing the fermented product according to claim 10, characterized in that, The method includes the following steps: culturing the Monosporozyma servazzii AMCC 31719 strain according to any one of claims 1 - 7 or the microbial agent according to claim 8 or 9.

12. The preparation method according to claim 11, wherein, The preparation method includes the following steps: (1) Amplify and culture the Monosporozyma servazzii AMCC 31719 strain according to any one of claims 1 - 7 or the microbial agent according to claim 8 or 9; (2) Add the product obtained in step (1) to the culture medium and perform fermentation culture at 10 - 45 °C.

13. Use of the fermented product prepared by the preparation method of Thraustochytrium sp. according to any one of claims 1 - 7, or the microbial agent according to claim 8 or 9, or the fermented product according to claim 10, or the fermented product according to claim 11 or 12 in the preparation of food, food additives, feed, pharmaceuticals or health products.

14. The application according to claim 13, wherein The use in the preparation of food additives includes the use in the preparation of moisture - retaining food additives or the preparation of edible flavors.

15. The application according to claim 13 or 14, characterized in that The use in the preparation of food includes the use in the preparation of baked foods. Preferably, the baked foods include bread, pastries, cookies, steamed buns and / or steamed stuffed buns. More preferably, in the preparation of baked foods, it is used in co - fermentation with Saccharomyces cerevisiae.

16. The application according to claim 15, characterized in that In the preparation of baked foods, it produces moisture - retaining components during the early fermentation of baked foods and delays the aging of baked foods.

17. The application according to claim 15 or 16, characterized in that, In the preparation of baked foods, it enhances the flavor of baked foods. Preferably, the baked foods contain alcohol, ester, ketone, aldehyde and / or phenolic flavor substances. And / or, the alcohol flavor substances include n - hexanol, iso - amyl alcohol and / or phenethyl alcohol. And / or, the ester flavor substance includes γ - nonalactone. And / or, the ketone flavor substances include acetoin and / or ethyl cyclopentenolone. And / or, the aldehyde flavor substance includes n - valeraldehyde. And / or, the phenolic flavor substance includes maltol.

18. The application according to claim 17, wherein The content of n - hexanol in the alcohol flavor substances is 410 - 430 μg / kg, and / or the content of iso - amyl alcohol is 4000 - 4300 μg / kg, and / or the content of phenethyl alcohol is 4700 - 4900 μg / kg. And / or, the content of γ - nonalactone in the ester flavor substances is 110 - 140 μg / kg. And / or, the content of acetoin in the ketone flavor substances is 3500 - 3700 μg / kg, and / or the content of ethyl cyclopentenolone is 28 - 32 μg / kg. And / or, the content of n - valeraldehyde in the aldehyde flavor substances is 2800 - 3100 μg / kg. And / or, the content of maltol in the phenolic flavor substances is 650 - 690 μg / kg.

19. The application according to any one of claims 13-18, characterized in that, The use in the preparation of food includes the use in the preparation of fermented foods. Preferably, the fermented foods include fermented fruit and vegetable juices, fermented fruits and vegetables and / or fermented milk. More preferably, the fermented fruits and vegetables include pickles.

20. The application according to any one of claims 13-19, characterized in that, The use in the preparation of pharmaceuticals includes the use in the fermentation of traditional Chinese medicinal materials.

21. A kind of bread, characterized in that, The leavening agent for bread contains Thraustochytrium sp. according to any one of claims 1 - 7, or the microbial agent according to claim 8 or 9, or the fermented product according to claim 10, or the fermented product prepared by the preparation method according to claim 11 or 12.

22. The bread according to claim 21, characterized in that, The leavening agent used for making bread also includes Saccharomyces cerevisiae.

Images