Recombinant carbonyl reductase mutant and application thereof in synthesis of chiral alcohol

Abstract

The invention relates to the technical field of biology, and discloses a recombinant carbonyl reductase mutant and application thereof in synthesis of chiral alcohol. According to the invention, the 36th-site lysine is mutated into any one of aspartic acid, threonine and valine, or / and the 125th-site histidine is mutated into any one of lysine, serine and leucine, or / and the 170th-site histidine is mutated into any one of lysine, cysteine and leucine; the carbonyl reductase mutants, especially single-site mutants Mut-K36D and Mut-H125K and a combined mutant Mut-K36D-H125K, with activity improved to different extents compared with that of a wild type are obtained, have excellent thermal stability and relative enzyme activity, have relatively high activity and stability aiming at various chiral alcohols, and can be used for preparing the carbonyl reductase. The method has the advantages of high catalytic activity, high enzyme expression quantity, easiness in fermentation and the like.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a recombinant carbonyl reductase mutant and its application in the synthesis of chiral alcohols. Background Art

[0002] Chiral alcohols are a class of optically active alcohol compounds, in which there is one or more chiral centers in the molecular structure, making the molecule non-superimposable with its mirror image. Chiral alcohols have extensive applications in the asymmetric synthesis of pharmaceuticals, pesticides, fragrances, flavorings, and natural products. The biocatalytic asymmetric reduction reaction mediated by carbonyl reductase is an important way to synthesize chiral alcohols.

[0003] Carbonyl reductase (CaRbonyl ReductaSe, E.C.1.1.1.148), as a member of the oxidoreductase family, uses coenzyme NADPH (nicotinamide adenine dinucleotide phosphate) as a hydrogen donor and can catalyze a series of prochiral ketones or aldehydes into the corresponding secondary alcohols. Carbonyl reductase can catalyze the asymmetric reduction of a series of carbonyl compounds under the condition of coenzyme providing H. Its catalytic mechanism is as follows: carbonyl reductase first binds to the coenzyme to form a complex, then collides with the substrate, transfers the hydrogen on the coenzyme to the carbonyl of the oxidizing substrate to form the corresponding chiral alcohol, while coenzyme NAD(P)H is oxidized to NAD(P)+, and finally the product is released from the enzyme-coenzyme complex to complete the catalytic process. Coenzyme NAD(P)H attacks the carbonyl carbon from different directions, generating products with different stereoconfigurations. When the [H] at the C4 position of the nicotinamide ring of NAD(P)H attacks the carbonyl carbon of the substrate from the Re-face, it follows the Prelog rule and generates the S-type product; while when [H] attacks the carbonyl carbon of the substrate from the Si-face, it follows the anti-Prelog rule and generates the R-type product. Most carbonyl reductase-catalyzed reactions follow the Prelog rule.

[0004] VibegRon, (6S)-N-[4-({(2S,5R)-5-[(R)-Hydroxy(phenyl)methyl]pyrrolidin-2-yl}methyl)phenyl]-4-oxo-4,6,7,8-tetrahydropyrrolo[1,2-a]pyrimidine-6-carboxamide, is the first β3-adrenergic receptor agonist (β3-AR agonist) drug for the treatment of overactive bladder (OAB). Methyl (2S,3R)-2-((tert-butoxycarbonyl)amino)-3-hydroxy-3-phenylpropanoate ((2S,3R)-amino-hydroxy ester) is a key chiral intermediate in the synthesis of VibegRon. In the prior art, a coupling system of NADPH-dependent carbonyl reductase KRED and glucose dehydrogenase GDH was constructed, and (S)-2-((tert-butoxycarbonyl)amino)-3-oxo-3-phenylpropanoate methyl ester (methyl (S)-2-((tert-butoxycarbonyl)amino)-3-oxo-3-phenylpropanoate, (S)-amino-ketone ester) was asymmetrically reduced to obtain the product (2S,3R)-amino-hydroxy ester. The substrate concentration was 85 g / L, the co-substrate glucose concentration was 70 g / L, and after 4 h of reaction, the product yield was >95.0%, and the e.e. >99.9%. However, the yield of the enzymatic catalytic asymmetric reduction reaction for the synthesis of chiral alcohols is relatively low.

[0005] Florfenicol is a widely used veterinary chloramphenicol antibacterial drug. (2S,3R)-Ethyl p-toluenesulfonylserine (D-ethyl ester) and its analogs, as key precursors for the synthesis of florfenicol, contain adjacent chiral centers and are difficult to synthesize. Currently, the industrial production of D-ethyl ester at home and abroad mainly uses the methods of aldol condensation and L-(+)-tartaric acid resolution. This method will produce copper ammonia wastewater and copper sulfide solid waste, and the chiral resolution yield is only 41%, with poor atom economy and high production cost. The method of using carbonyl reductase for dynamic kinetic resolution of p-toluenesulfonylphenyl-α-amino-β-ketoester substrates to asymmetrically synthesize D-ethyl ester and its analogs can make up for the deficiencies of the traditional route.

[0006] In addition, the catalytic asymmetric synthesis of (3R,5S)-CDHH, a key chiral intermediate of rosuvastatin, a selective HMG-CoA reductase inhibitor, and the catalytic asymmetric synthesis of tert-butyl (3R,5S)-6-chloro-3,5-dihydroxyhexanoate ((3R,5S)-CDHH), a key chiral intermediate of atorvastatin, a lipid-lowering drug, by carbonyl reductase, such as the carbonyl reductase-catalyzed asymmetric synthesis of ethyl (S)-3-hydroxy-3-(thiophen-2-yl)propanoate ((S)-HEES), a key chiral intermediate of duloxetine, a serotonin-norepinephrine reuptake inhibitor, are important challenges in the field of green biomanufacturing of pharmaceutical chemicals. At present, the yield of the above key chiral intermediates synthesized by the biocatalytic asymmetric reduction reaction mediated by carbonyl reductase is low. Carbonyl reductase WT is a multifunctional biocatalyst with a broad substrate spectrum, but its low thermal stability limits the application of this enzyme. Summary of the Invention

[0007] In order to solve the technical problem of the low yield of chiral alcohol synthesis mediated by the above carbonyl reductase, the present invention provides a recombinant carbonyl reductase mutant and its application in the synthesis of chiral alcohol.

[0008] The specific technical solution of the present invention is as follows: In the first aspect, the present invention provides a recombinant carbonyl reductase mutant obtained by performing single-site mutation or multi-site combination mutation at the following sites on the amino acid sequence shown in SEQ ID NO.2: The lysine at position 36 is mutated to any one of aspartic acid, threonine, and valine; The histidine at position 125 is mutated to any one of lysine, serine, and leucine; The histidine at position 170 is mutated to any one of lysine, cysteine, and leucine.

[0009] In the second aspect, the present invention provides the coding gene of the above carbonyl reductase mutant.

[0010] In the third aspect, the present invention provides an expression vector containing the above coding gene.

[0011] Preferably, the expression vector is a plasmid, phage, or viral vector.

[0012] In the fourth aspect, the present invention provides a cloning vector of the above coding gene.

[0013] Fifth aspect, the present invention provides a host cell of the above-mentioned carbonyl reductase mutant or the above-mentioned encoding gene.

[0014] Preferably, the cell is Escherichia coli.

[0015] Sixth aspect, the present invention provides the application of the above-mentioned carbonyl reductase mutant in the synthesis of chiral alcohols.

[0016] Using prochiral ketone as a substrate, and using wet cells obtained by fermentation culture of a genetically engineered bacterium containing the encoding gene of the above-mentioned recombinant carbonyl reductase mutant, crude enzyme or pure enzyme after ultrasonic disruption of the wet cells as a catalyst, corresponding chiral alcohols can be prepared by biocatalysis.

[0017] Preferably, the chiral alcohol is duloxetine intermediate, florfenicol intermediate, rosuvastatin intermediate, atorvastatin intermediate, vibelon intermediate. That is, the corresponding prochiral ketones can include: methyl (S)-2-((tert-butoxycarbonyl)amino)-3-oxo-3-phenylpropionate, methyl 2-acetamido-3-(4-(methylsulfonyl)phenyl)-3-oxopropionate, ethyl 3-oxo-3-(2-thienyl)propionate, tert-butyl (S)-6-chloro-5-hydroxy-3-oxohexanoate ((S)-CHOH), tert-butyl 6-cyano-5(R)-hydroxy-3-oxohexanoate.

[0018] More specifically: The application includes: using wet cells obtained by fermentation culture of a genetically engineered bacterium containing the encoding gene of a novel carbonyl reductase mutant, crude enzyme solution after disruption of the wet cells or pure enzyme extracted after disruption of the wet cells as a catalyst, and using methyl 2-acetamido-3-(4-(methylsulfonyl)phenyl)-3-oxopropionate, and preparing (2S,3R)-2-acetamido-3-hydroxy-3-(4-(methylsulfonyl)phenyl)propionate by biocatalysis, which is the key chiral intermediate for the synthesis of the drug florfenicol.

[0019] The application includes: using wet cells obtained by fermentation culture of a genetically engineered bacterium containing the encoding gene of a novel carbonyl reductase mutant, crude enzyme solution after disruption of the wet cells or pure enzyme extracted after disruption of the wet cells as a catalyst, and using ethyl 3-oxo-2-(3-thienyl)propionate (KEES) as a substrate, and preparing (S)-ethyl 3-hydroxy-3-(2-thienyl)propionate ((S)-HEES) by biocatalysis. (S)-HEES is the key chiral intermediate for the synthesis of the drug (S)-duloxetine.

[0020] The application includes: using the wet cells obtained by fermenting and culturing a genetically engineered bacterium containing a gene encoding a novel carbonyl reductase mutant, or the crude enzyme solution obtained after disrupting the wet cells, or the pure enzyme extracted after disrupting the wet cells as a catalyst, and using (S)-6-chloro-5-hydroxy-3-hydroxyhexanoic acid tert-butyl ester ((S)-CHOH) as a substrate, and biocatalytically preparing (3R,5S)-6-chloro-3,5-dihydroxyhexanoic acid tert-butyl ester ((3R,5S)-CDHH). (3R,5S)-CDHH is a key chiral intermediate in the synthesis of the drug rosuvastatin.

[0021] The application includes: using the wet cells obtained by fermenting and culturing a genetically engineered bacterium containing a gene encoding a novel carbonyl reductase mutant, or the crude enzyme solution obtained after disrupting the wet cells, or the pure enzyme extracted after disrupting the wet cells as a catalyst, and using 6-cyano-5(R)-hydroxy-3-oxohexanoic acid tert-butyl ester as a substrate, and biocatalytically preparing (3R,5R)-6-cyano-3,5-dihydroxyhexanoic acid tert-butyl ester. That is, the key chiral intermediate in the synthesis of the drug atorvastatin.

[0022] The application includes: using the wet cells obtained by fermenting and culturing a genetically engineered bacterium containing a gene encoding a novel carbonyl reductase mutant, or the crude enzyme solution obtained after disrupting the wet cells, or the pure enzyme extracted after disrupting the wet cells as a catalyst, and using (S)-2-((tert-butoxycarbonyl)amino)-3-oxo-3-phenylpropionic acid methyl ester ((S)-aminoketone ester) as a substrate, and biocatalytically preparing (2S,3R)-2-((tert-butoxycarbonyl)amino)-3-hydroxy-3-phenylpropionic acid methyl ester ((2S,3R)-aminohydroxy ester). (2S,3R)-aminohydroxy ester is a key chiral intermediate in the synthesis of viburon.

[0023] Compared with the prior art, the present invention has the following technical effects: In the present invention, by mutating the lysine at position 36 to any one of aspartic acid, threonine, and valine, and / or mutating the histidine at position 125 to any one of lysine, serine, and leucine, or mutating the histidine at position 170 to any one of lysine, cysteine, and leucine in the amino acid sequence shown in SEQ ID NO.2, a carbonyl reductase mutant with different degrees of improved activity compared to the wild type is obtained. In particular, the single-point mutants Mut-K36D, Mut-H125K, and the combined mutant Mut-K36D-H125K have excellent thermal stability and relative enzyme activity, and have high activity and stability against a variety of chiral alcohols, and have the advantages of high catalytic activity, high enzyme expression level, and easy fermentation. Description of the Drawings

[0024] Figure 1SDS-PAGE diagrams of carbonyl reductase and its mutants, where: Lane M is the protein molecular weight marker, Lane 1 is the pure enzyme of the original carbonyl reductase strain WT, Lane 2 is the pure enzyme of Mut-K36D; Lane 3 is the pure enzyme of Mut-H125K, Lane 4 is the pure enzyme of Mut-H170K, and Lane 5 is the pure enzyme of Mut-K36D-H125K. Detailed implementation manners

[0025] The present invention will be further described below in conjunction with embodiments. Those of ordinary skill in the art will be able to implement the present invention based on these descriptions. In addition, the embodiments of the present invention involved in the following description are usually only a part of the embodiments of the present invention, rather than all of the embodiments. Therefore, all other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the scope of protection of the present invention.

[0026] In the embodiments of the present invention, the amino acid sequence of the wild-type carbonyl reductase is shown in SEQ ID NO.2, and its encoding gene is shown in SEQ ID NO.1.

[0027] Example 1 Construction of carbonyl reductase mutants (1) Connect the wild-type carbonyl reductase encoding gene shown in SEQ ID NO.1 with the expression vector pET28b to construct a heterologous expression recombinant plasmid pET28b(+)-WT containing the carbonyl reductase encoding gene. Transform the expression recombinant plasmid into the competent cells of the host bacterium E. coli BL21(DE3) to obtain a recombinant genetic engineering bacterium E. coli BL21(DE3) / pET28b(+)-WT containing the expression recombinant plasmid of the carbonyl reductase, that is, the carbonyl reductase engineering bacterium.

[0028] After the carbonyl reductase engineering bacterium E. coli BL21(DE3) / pET28b(+)-WT is thawed on ice, take the bacterial liquid and streak it on a kanamycin-resistant LB plate, and incubate it statically at 37°C for 12 h. Pick a single colony and inoculate it into a 10 mL LB test tube with a final concentration of 50 mg / L kanamycin resistance, and shake it at 37°C and 180 Rpm for 7 h for standby. Take 2 mL of the bacterial liquid in the test tube and inoculate it into a 100 mL LB shake flask with a final concentration of 50 mg / L kanamycin resistance, shake it at 37°C and 180 Rpm for 2 h, add 100 μL of 0.1 M IPTG, shake it at 28°C and 180 Rpm for 12 h, centrifuge at 4°C and 8000 Rpm for 15 min to collect the thalli, and store them at -20°C for standby.

[0029] (2) Using the prepared vector heterologous expression recombinant plasmid pET28b(+)-WT as a template, site-directed mutagenesis primers as shown in Table 1 below were used to introduce mutations by PCR. In Table 1, the mutation sites are underlined in the primer sequences. Among them, primers K36-R and K36D-F were used in the PCR to mutate lysine at position 36 of the wild-type enzyme to aspartic acid, primers K36-R and K36T-F were used in the PCR to mutate lysine at position 36 of the wild-type enzyme to threonine, K36-R and K36V-F were used in the PCR to mutate lysine at position 36 of the wild-type enzyme to valine, H125-R and H125K-F were used in the PCR to mutate histidine at position 125 of the wild-type enzyme to lysine, H125-R and H125S-F were used in the PCR to mutate histidine at position 125 of the wild-type enzyme to serine, H125-R and H125L-F were used in the PCR to mutate histidine at position 125 of the wild-type enzyme to leucine, H170-R and H170K-F were used in the PCR to mutate histidine at position 170 of the wild-type enzyme to lysine, H170-R and H170C-F were used in the PCR to mutate histidine at position 170 of the wild-type enzyme to cysteine, and H170-R and H170L-F were used in the PCR to mutate histidine at position 170 of the wild-type enzyme to leucine.

[0030] Table 1 Primer Sequence 5′-3′ K36D-F <![CDATA[CCGGCGCACC GAC GAACTGGAAAGCCTGC]]> K36T-F <![CDATA[CCGGCGCACC ACA GAACTGGAAAGCCTGC]]> K36V-F <![CDATA[CCGGCGCACC GTA GAACTGGAAAGCCTGC]]> K36-R GGTGCGCCGGGCCACCAGAACCAG H125K-F <![CDATA[GCGATTAC AAA GATGTTGAAGGTGC]]> H125S-F <![CDATA[GCGATTAC AGC GATGTTGAAGGTGC]]> H125L-F <![CDATA[GCGATTAC CTA GATGTTGAAGGTGC]]> H125-R TAATCGCGCACATACAGTGAGCTC H170K-F <![CDATA[AGCTGATT AAA AATGATGCGAAACTGAGAG]]> H170C-F <![CDATA[AGCTGATT TGC AATGATGCGAAACTGAGAG]]> H170L-F <![CDATA[AGCTGATT CTA AATGATGCGAAACTGAGAG]]> H170-R AATCAGCTCCTGCGCTAAGCCCT The PCR reaction procedure for introducing mutations by PCR was as follows: 98°C for 10 min, 98°C for 30 s, 56°C for 30 s, 72°C for 3 min 40 s, repeated for 31 cycles; continued extension at 72°C for 5 min.

[0031] The PCR product was treated with DpnI at 37°C for 3 h, inactivated and then transformed into the E. coli BL21(DE3) recipient bacterium, and spread on an LB solid plate containing kanamycin resistance at a final concentration of 50 mg / L. After culturing at 37°C for 12 h, single colonies were randomly picked for sequencing analysis and confirmation, and each carbonyl reductase mutant and its wet cells were obtained respectively.

[0032] Among them, the mutant enzyme with the 36th lysine of the wild-type enzyme mutated to aspartic acid is denoted as Mut-K36D, the mutant enzyme with the 36th lysine of the wild-type enzyme mutated to threonine is denoted as Mut-K36T, the mutant enzyme with the 36th lysine of the wild-type enzyme mutated to valine is denoted as Mut-K36V, the mutant enzyme with the 125th histidine of the wild-type enzyme mutated to lysine is denoted as Mut-H125K, the mutant enzyme with the 125th histidine of the wild-type enzyme mutated to serine is denoted as Mut-H125S, the mutant enzyme with the 125th histidine of the wild-type enzyme mutated to leucine is denoted as Mut-H125L, the mutant enzyme with the 170th histidine of the wild-type enzyme mutated to lysine is denoted as Mut-H170K, the mutant enzyme with the 170th histidine of the wild-type enzyme mutated to cysteine is denoted as Mut-H170C, and the mutant enzyme with the 170th histidine of the wild-type enzyme mutated to leucine is denoted as Mut-H170L.

[0033] (3) Using the plasmid DNA containing the Mut-K36D gene as a template, mutations were introduced by PCR, and the combined mutation primers are as follows (the mutated sites are underlined):

[0034] The PCR reaction program for introducing mutations by PCR was the same as in step (2), and the recombinant carbonyl reductase combined mutant Mut-K36D-H125K and its wet cells were obtained. The nucleotide sequence of the mutant Mut-K36D-H125K is shown in SEQ ID NO.3, and the amino acid sequence is shown in SEQ ID NO.4.

[0035] (4) Using the plasmid DNA containing the Mut-K36D gene as a template, mutations were introduced by PCR, and the combined mutation primers are as follows (the mutated sites are underlined):

[0036] The PCR reaction program for introducing mutations by PCR was the same as in step (2), and the recombinant carbonyl reductase combined mutant Mut-K36D-H170K and its wet cells were obtained.

[0037] (5) Using the plasmid DNA containing the Mut-H125K gene as a template, mutations were introduced by PCR, and the combined mutation primers are as follows (the mutated sites are underlined):

[0038] The PCR reaction program for introducing mutations by PCR was the same as in step (2), and the recombinant carbonyl reductase combined mutant Mut-H125K-H170K and its wet cells were obtained.

[0039] As Figure 1 shown, it is the SDS-PAGE diagram of the above wild-type carbonyl reductase and its mutants.

[0040] Screening of the Optimal Carbonyl Reductase Mutant in Example 2 The residual enzyme activity of the carbonyl reductase mutants obtained in Example 1 was measured and analyzed. After incubating them at 35°C for 24 h and at 50°C for 1 h respectively, the residual enzyme activity was measured to determine the optimal mutant. The steps are as follows: (1) Preparation of crude enzyme solution: The strain containing the carbonyl reductase mutant coding gene obtained in Example 1 was inoculated into LB liquid medium containing 50 mg / L kanamycin resistance at a final concentration, cultured at 37°C and 180 Rpm for 7 h, and then inoculated into fresh LB liquid medium containing 50 mg / L kanamycin resistance at a volume concentration of 2% inoculum, cultured at 37°C and 180 Rpm for 2 h, 100 μL of IPTG with a concentration of 0.1 M was added, induced and cultured at 28°C and 180 Rpm for 12 h, then centrifuged at 4°C and 8000 Rpm for 15 min, the supernatant was discarded, and the wet cells were collected. 125 mg of the wet cells of the prepared mutant was weighed, resuspended in 10 mL of sodium phosphate buffer, and ultrasonically disrupted on ice bath at 4°C until the bacterial solution was clarified (220 W, continuous for 1 S, stop for 2 S). Each of the disrupted crude enzyme solutions was incubated at 35°C for 24 h and at 50°C for 1 h.

[0041] (2) 500 μL reaction system: 150 μL NADP + , 50 μL of glucose, 50 μL of the crude enzyme solution incubated at 35°C for 24 h, 100 μL of the substrate (S)-aminoketone ester mother liquor, made up to 500 μL with sodium phosphate buffer, shaken at 1100 Rpm, and reacted in a shaking reactor at 35°C. Samples were taken immediately after 10 min of reaction. The concentration of the mother liquor substrate (S)-aminoketone ester was 50 g / L (the solvent was dimethyl sulfoxide), the concentration of the mother liquor co-substrate glucose was 180 g / L (the solvent was sodium phosphate buffer), and the concentration of the mother liquor coenzyme NADP + was 1 g / L (the solvent was sodium phosphate buffer). The yield of (2S,3R)-amino hydroxy ester was determined by HPLC analysis and the relative enzyme activity was calculated. Taking the initial enzyme activity of each mutant as 100%, the residual enzyme activity after incubation for a certain time is shown in Table 2.

[0042] (3) 500 μL reaction system: 150 μL NADP +, 50 μL of glucose, 50 μL of crude enzyme solution incubated at 50 °C for 1 h, 100 μL of substrate (S)-aminoketone ester stock solution, made up to 500 μL with sodium phosphate buffer, shaken at 1100 Rpm, and reacted in a shaking reactor at 50 °C. Samples were taken immediately after 10 min of reaction. The concentration of the stock solution of substrate (S)-aminoketone ester was 50 g / L (solvent: dimethyl sulfoxide), the concentration of the stock solution of co-substrate glucose was 180 g / L (solvent: sodium phosphate buffer), and the concentration of the stock solution of coenzyme NADP + was 1 g / L (solvent: sodium phosphate buffer). The yield of (2S,3R)-aminoalcohol ester was determined by HPLC analysis and the relative enzyme activity was calculated. Taking the initial enzyme activity of each mutant as 100%, the remaining enzyme activity after incubation for a certain time is shown in Table 2.

[0043] Table 2 Comparison of remaining enzyme activities Enzyme Residual enzyme activity after incubation at 35℃ for 24 h (%) Residual enzyme activity after incubation at 50℃ for 1 h (%) Wild type 37.60 1.19 Mut-K36D 77.29 11.86 Mut-K36T 59.56 7.88 Mut-K36V 63.21 8.59 Mut-H125K 48.68 6.89 Mut-H125S 39.65 1.59 Mut-H125L 40.58 2.65 Mut-H170K 41.53 3.56 Mut-H170C 42.68 3.86 Mut-H170L 39.16 1.25 Mut-K36D-H170K 44.44 5.23 Mut-H125K-H170K 40.01 1.89 Mut-K36D-H125K 83.68 25.06 From the determination results of the remaining enzyme activities in Table 2, it can be seen that in Example 1, through site-directed mutagenesis technology, the stability of carbonyl reductase was improved. The optimal mutant of the single mutant was Mut-K36D, and the optimal mutant obtained after combined mutation of different mutation sites was Mut-K36D-H125K.

[0044] From the determination results of the remaining enzyme activities in Table 2, it can be seen that the carbonyl reductase mutants Mut-K36D and Mut-K36D-H125K not only had improved catalytic activity, but also had improved thermal stability of the mutants.

[0045] Determination of relative enzyme activity of carbonyl reductase mutants in Example 3 The relative enzyme activity of the carbonyl reductase mutant obtained in Example 1 was determined. The steps are as follows: (1) Preparation of crude enzyme solution: The method was the same as in Example 2.

[0046] (2) 500 μL reaction system: 150 μL of NADP + , 50 μL of glucose, 50 μL of crude enzyme solution incubated at 35 °C for 24 h, 100 μL of substrate (S)-aminoketone ester stock solution, made up to 500 μL with sodium phosphate buffer, shaken at 1100 Rpm, and reacted in a shaking reactor at 35 °C. Samples were taken immediately after 10 min of reaction. The concentration of the stock solution of substrate (S)-aminoketone ester was 50 g / L (solvent: dimethyl sulfoxide), the concentration of the stock solution of co-substrate glucose was 180 g / L (solvent: sodium phosphate buffer), and the concentration of the stock solution of coenzyme NADP + was 1 g / L (solvent: sodium phosphate buffer). The yield of (2S,3R)-aminoalcohol ester was determined by HPLC analysis and the relative enzyme activity was calculated. The results are shown in Table 3.

[0047] Table 3 Comparison of relative enzyme activities Enzyme Relative enzyme activity (100%) Wild type 100.00 Mut-K36D 115.56 Mut-K36T 106.56 Mut-K36V 108.45 Mut-H125K 102.65 Mut-H125S 97.58 Mut-H125L 95.89 Mut-H170K 102.65 Mut-H170C 59.65 Mut-H170L 69.16 Mut-K36D-H170K 101.23 Mut-H125K-H170K 105.69 Mut-K36D-H125K 119.55 As can be seen from the determination results of the relative enzyme activity in Table 3, in Example 1, through site-directed mutagenesis technology, the stability of carbonyl reductase was improved. The optimal mutant of the single mutant was Mut-K36D, and the optimal mutant obtained after combined mutation of different mutation sites was Mut-K36D-H125K.

[0048] Application of the carbonyl reductase mutant in the preparation of florfenicol intermediate in Example 4 Select the single-point mutants Mut-K36D, Mut-H125K with better thermal stability and the combined mutant Mut-K36D-H125K and apply them to the preparation of florfenicol intermediate. The specific steps are as follows: The composition of the catalytic system and the catalytic conditions are as follows: in a 20 mL reaction system: add 100 mM sodium phosphate buffer solution with pH 7.0, co-solvent DMSO (dosage is 20%), add crude carbonyl reductase solution (dosage is 20 g / L, the preparation method is the same as that in Example 2) and glucose dehydrogenase (dosage is 10 g / L), 200 mM glucose, NADP + 2 g / L, 100 g / L of the substrate methyl 2-acetamido-3-(4-(methylsulfonyl)phenyl)-3-oxopropionate, and make up to 20 mL with sodium phosphate buffer solution.

[0049] Place the reaction system in a 35 °C water bath, with a magnetic stirring device at 600 Rpm, and react for 24 h. Samples are taken regularly during the reaction process, the sampling volume is 200 μL, and after separation and purification, it is diluted 100 times with pure acetonitrile, and the conversion rate is analyzed and measured by HPLC.

[0050] The results show that after 24 h of catalysis, the yield of (2S,3R)-methyl 2-acetamido-3-hydroxy-3-(4-(methylsulfonyl)phenyl)propionate catalyzed by WT reaches 77.5%, e.e. > 99%; Mut-K36D reaches 91.4%, e.e. > 99%; Mut-H125K reaches 90.8%, e.e. > 99%; Mut-K36D-H125K reaches 99.5%, e.e. > 99%.

[0051] Application of the carbonyl reductase mutant in the preparation of duloxetine intermediate in Example 5 Select the single-point mutants Mut-K36D, Mut-H125K with better thermal stability and the combined mutant Mut-K36D-H125K and apply them to the preparation of duloxetine intermediate. The specific steps are as follows: The composition of the catalytic system and the catalytic conditions are as follows: In a 20 mL reaction system: The crude enzyme solution (prepared in the same way as in Example 2) is weighed at 20 g / L, the substrate KEES is 150 g / L, the co-solvent DMSO (the dosage is 20%), glucose dehydrogenase (the dosage is 10 g / L), the co-substrate glucose is 100 mM (the solvent is sodium phosphate buffer), and the coenzyme NADP + is 3 g / L (the solvent is sodium phosphate buffer). Use sodium phosphate buffer to make up to 20 mL.

[0052] Place the reaction system in a 35 °C water bath, with a magnetic stirring device at 600 Rpm, react for 24 h, sample at regular intervals during the reaction, the sampling volume is 200 μL, after separation and purification, dilute it 100 times with pure acetonitrile, and determine the conversion rate by HPLC analysis.

[0053] The results show that after 24 h of catalysis, the yield of WT catalyzing the production of (S)-HEES reaches 83.5%, e.e. > 99%; Mut-K36D reaches 92.8%, e.e. > 99%; Mut-H125K reaches 93.7%, e.e. > 99%; Mut-K36D-H125K reaches 99.7%, e.e. > 99%.

[0054] Example 6 Application of carbonyl reductase mutants in the preparation of rosuvastatin intermediates Select the single-point mutants Mut-K36D, Mut-H125K with better thermal stability and the combined mutant Mut-K36D-H125K for use in the preparation of rosuvastatin intermediates. The specific steps are as follows: The composition of the catalytic system and the catalytic conditions are as follows: In a 20 mL reaction system: The crude enzyme solution (prepared in the same way as in Example 2) is weighed at 20 g / L, the substrate (S)-CHOH is 150 g / L, the co-substrate glucose is 100 mM (the solvent is sodium phosphate buffer), glucose dehydrogenase (the dosage is 10 g / L), and the coenzyme NADP + is 3 g / L (the solvent is sodium phosphate buffer). Use sodium phosphate buffer to make up to 20 mL.

[0055] Place the reaction system in a 35 °C water bath, with a magnetic stirring device at 600 Rpm, react for 24 h, sample at regular intervals during the reaction, the sampling volume is 200 μL, after separation and purification, dilute it 40 times with 30% acetonitrile, and determine the conversion rate by HPLC analysis.

[0056] The results show that after 24 h of catalysis, the yield of WT catalyzing the production of (3R,5S)-CDHH reaches 87.1%, e.e. > 99%; Mut-K36D reaches 97.6%, e.e. > 99%; Mut-H125K reaches 93.1%, e.e. > 99%; Mut-K36D-H125K reaches 99.8%, e.e. > 99%.

[0057] Example 7 Application of Carbonyl Reductase Mutants in the Preparation of Atorvastatin IntermediatesSingle-point mutants Mut-K36D, Mut-H125K with relatively excellent thermal stability and the combined mutant Mut-K36D-H125K were selected and applied to the preparation of atorvastatin intermediates. The specific steps are as follows: The composition of the catalytic system and the catalytic conditions are as follows: 20 mL reaction system: The crude enzyme solution (prepared in the same way as in Example 2) was weighed at 20 g / L, the substrate tert-butyl 6-cyano-5(R)-hydroxy-3-oxohexanoate was 150 g / L, the co-substrate glucose was 100 mM (the solvent was sodium phosphate buffer), glucose dehydrogenase (the dosage was 10 g / L), and the coenzyme NADP + was 3 g / L (the solvent was sodium phosphate buffer). The volume was made up to 20 mL with sodium phosphate buffer.

[0058] The reaction system was placed in a 35°C water bath, with a magnetic stirring device at 600 Rpm. Samples were taken at regular intervals during the 24-hour reaction. The sampling volume was 200 μL. After separation and purification, it was diluted 100 times with acetonitrile, and the conversion rate was determined by HPLC analysis. The results showed that after 24 hours of catalysis, the yield of (3R,5R)-6-cyano-3,5-dihydroxyhexanoic acid tert-butyl ester produced by WT catalysis reached 81.2%, e.e. > 99%; Mut-K36D reached 90.6%, e.e. > 99%; Mut-H125K reached 88.8%, e.e. > 99%; Mut-K36D-H125K reached 99.5%, e.e. > 99%.

[0059] Example 8 Application of Carbonyl Reductase Mutants in the Preparation of Veblenone Intermediates Single-point mutants Mut-K36D, Mut-H125K with relatively excellent thermal stability and the combined mutant Mut-K36D-H125K were selected and applied to the preparation of veblenone intermediates. The specific steps are as follows: The composition of the catalytic system and the catalytic conditions are as follows: 20 mL reaction system: The substrate (S)-aminoketone ester was dissolved in 10 mL of n-butyl acetate (final concentration was 100 g / L), 1 mL of 0.1 mM, pH 6.5 NaH2PO4-Na2HPO4 buffer solution was added, the crude enzyme solution was added (final concentration was 20 g / L, prepared in the same way as in Example 2), 2 mL of crude glucose dehydrogenase enzyme solution (final concentration was 10 g / L) was added, 100 mg of coenzyme NADPH was added, and 2.63 g of co-substrate glucose was added. The volume was made up to 20 mL with sodium phosphate buffer.

[0060] The reaction system was placed in a 35°C water bath, with a magnetic stirring device at 600 Rpm. Samples were taken at regular intervals during the reaction. The sampling volume was 200 μL. After separation and purification, it was diluted 100 times with pure acetonitrile, and the conversion rate was determined by HPLC analysis.

[0061] The results showed that after 24 h of catalysis, the yield of (2S,3R)-amino hydroxy ester produced by WT reached 89.2%, e.e. >99%; that of Mut-K36D reached 98.6%, e.e. >99%; that of Mut-H125K reached 98.8%, e.e. >99%; and that of Mut-K36D-H125K reached 99.8%, e.e. >99%.

[0062] Example 9 Influence of feeding process on the preparation of verapamil intermediate by carbonyl reductase mutants Single-point mutants Mut-K36D, Mut-H125K with better thermal stability and the combined mutant Mut-K36D-H125K were selected and applied to the feeding process for the preparation of verapamil intermediate. The specific steps are as follows: (1) 20 mL reaction system: Dissolve the substrate (S)-amino ketone ester in 10 mL of n-butyl acetate (final concentration 80 g / L), add 1 mL of NaH2PO4-Na2HPO4 buffer solution with 0.1 mM and pH 6.5, add crude enzyme solution (final concentration 20 g / L), add glucose dehydrogenase (final concentration 10 g / L), add 100 mg of coenzyme NADPH, and add 2.63 g of co-substrate glucose. Make up to 20 mL with sodium phosphate buffer solution.

[0063] Place the reaction system in a 35 °C water bath with a magnetic stirring device at 600 Rpm. After 8 h, add 1.4 g of substrate by feeding (total input concentration of substrate after feeding is 150 g / L). Take samples regularly during the reaction, with a sampling volume of 200 μL. After separation and purification, dilute with pure acetonitrile by 150 times, and determine the conversion rate by HPLC analysis.

[0064] The results showed that after 24 h of catalysis, the yield of (2S,3R)-amino hydroxy ester produced by WT reached 92.1%, e.e. >99%; that of Mut-K36D reached 97.6%, e.e. >99%; that of Mut-H125K reached 95.8%, e.e. >99%; and that of Mut-K36D-H125K reached 99.8%, e.e. >99%.

[0065] (2) 500 mL reaction system: Dissolve the substrate (S)-amino ketone ester in 10 mL of n-butyl acetate ((S)-amino ketone ester final concentration 80 g / L), add crude enzyme solution (final concentration 20 g / L), add glucose dehydrogenase (final concentration 10 g / L), add 3.0 g of coenzyme NADPH, and add 35.5 g of co-substrate glucose. Make up to 500 mL with sodium phosphate buffer solution.

[0066] The reaction system was placed in a 35 °C water bath, and the stirring device was set at 600 Rpm. After 8 h, 35 g of the substrate was added as a feed (the total input concentration of the substrate after feeding was 150 g / L). Samples were taken at regular intervals during the reaction. The sampling volume was 200 μL. After separation and purification, it was diluted 150 times with pure acetonitrile, and the conversion rate was determined by HPLC analysis.

[0067] The results showed that after 24 h of catalysis, the yield of (2S,3R)-amino hydroxy ester produced by WT catalysis reached 90.2%, e.e. > 99%; Mut-K36D reached 97.8%, e.e. > 99%; Mut-H125K reached 96.6%, e.e. > 99%; Mut-K36D-H125K reached 99.9%, e.e. > 99%. Compared with the non-feeding process, the feeding process further improved the production efficiency.

[0068] Unless otherwise specified, the raw materials and equipment used in the present invention are all common raw materials and equipment in the art; unless otherwise specified, the methods used in the present invention are all conventional methods in the art.

[0069] The above are only the preferred embodiments of the present invention, and do not impose any limitations on the present invention. Any simple modifications, changes, and equivalent transformations made to the above embodiments according to the technical essence of the present invention still fall within the protection scope of the technical solution of the present invention.

Claims

1. A recombinant carbonyl reductase mutant, characterized in that: Obtained by performing single-site mutation or multi-site combined mutation at the following sites on the amino acid sequence shown in SEQ ID NO.2: The lysine at position 36 is mutated to any one of aspartic acid, threonine, and valine; The histidine at position 125 is mutated to any one of lysine, serine, and leucine; The histidine at position 170 is mutated to any one of lysine, cysteine, and leucine.

2. The coding gene of the carbonyl reductase mutant according to claim 1.

3. An expression vector comprising the coding gene according to claim 2.

4. The expression vector according to claim 3, wherein: The expression vector is a plasmid, phage or viral vector.

5. A cloning vector comprising the coding gene according to claim 2.

6. A host cell comprising the carbonyl reductase mutant according to claim 1 or the coding gene according to claim 2.

7. The host cell according to claim 6, characterized in that: The cell is Escherichia coli.

8. The application of the carbonyl reductase mutant according to claim 1 in the synthesis of chiral alcohols.

9. The application according to claim 8, wherein: The chiral alcohol is a duloxetine intermediate, a florfenicol intermediate, a rosuvastatin intermediate, an atorvastatin intermediate, a viburon intermediate.

Images