Expression cassette for improving mRNA stability, expression vector and method for expressing recombinant protein
By adding a reverse complementary sequence to the 5' end of the mRNA to form a pseudocyclization structure, the mRNA instability problem is solved, the expression of recombinant protein is increased, the production cost is reduced, and there is a wide range of application prospects.
Patent Information
- Application Number
- CN202410024386.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-08
- Publication Date
- 2025-07-08
AI Technical Summary
The mRNA instability and immunogenicity problems in existing mRNA therapies limit the realization of high protein expression levels, resulting in excessive drug dose demand, and the existing circular mRNA design is complex and limiting application.
A pseudocyclization structure was designed, and a sequence that was reversely complementary to the 5' end of the mRNA was added to form a pseudocyclization structure at the 3' end of the mRNA, which increased the stability of the mRNA and applied to E. coli expression vectors to increase the expression of recombinant proteins.
It significantly improves the stability of mRNA and the expression of recombinant proteins, reduces production costs, and has broad application prospects.
Smart Images
Figure CN120272507A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology and relates to an expression cassette for increasing mRNA stability, an expression vector, and a method for expressing recombinant proteins. Background Art
[0002] Messenger RNA (mRNA) was first discovered by researchers in the 1960s and has now become a highly regarded basic discipline and field of applied research. Over the past two decades, hundreds of mRNA-based clinical trials have been carried out. However, in the first few decades after mRNA was discovered, it was not recognized as a new class of drugs, and problems such as instability and immunogenicity hindered its development. In recent years, by introducing modified nucleosides into the mRNA sequence and developing various RNA packaging and delivery systems, these key problems have been basically solved. mRNA can theoretically express any protein, so it can be used to treat almost all diseases. From the perspective of the pharmaceutical industry, mRNA is a very promising candidate drug that can meet the needs of gene therapy, cancer treatment, and vaccines. Currently, there are 60 mRNA drugs globally undergoing clinical trials.
[0003] mRNA therapy requires high levels of protein expression to achieve therapeutic effects, usually requiring more than 50 times the dosage of mRNA vaccines (Rohner, Eduarde, et al. "Unlocking the promise of mRNA therapeutics." Nature biotechnology 40.11 (2022): 1586 - 1600.). The need for high protein expression levels has led to various strategies for optimizing mRNA to enhance mRNA stability and maximize translation efficiency. Currently, there are several optimizations of the mRNA structure to increase the duration of protein expression, such as self-amplifying mRNA (saRNA) and circular mRNA (circRNA).
[0004] Self-amplifying mRNA (saRNA) utilizes the self-replication ability of RNA viruses, enabling the target RNA to self-replicate within cells, thereby reducing the dosage and frequency of administration. Compared with linear and modified mRNA, when the protein expression levels are similar, the dosage of self-replicating mRNA is only one-tenth of the former (Fuller, Deborah H., and Peter Berglund. "Amplifying RNA vaccine development." New England Journal of Medicine 382.25 (2020): 2469 - 2471.). However, self-replication requires the use of viral RNA replicase, and its immunogenicity cannot be eliminated.
[0005] Circular messenger ribonucleic acid (circRNA), which circularizes linear mRNA, can prevent mRNA from being degraded by exonucleases, extend the half-life of mRNA in cells, and thus increase the total amount of protein expression. Moreover, circular mRNA avoids the expensive 5'-end cap and cumbersome Poly(A) tail that must be added to linear mRNA (Liu, Xiang, et al. "Circular RNA: An emerging frontier in RNA therapeutic targets, RNA therapeutics, and mRNA vaccines." Journal of Controlled Release 348 (2022): 84-94.). mRNA circularization mainly uses intron self-splicing or enzymatic ligation methods, both of which require complex sequence design or optimization work, greatly limiting its application. Summary of the Invention
[0006] Based on this, we designed a pseudo-circularized structure: by adding a sequence complementary to the 5'-end starting region at the 3'-end, the transcribed mRNA can form a pseudo-circularized structure through complementary base pairing to increase its stability. This design method is simple and has a significant effect on increasing the stability of mRNA, and has high application value in the production of mRNA and the production of recombinant proteins.
[0007] Aiming at the commonly used plasmids for expressing recombinant proteins in current host cells such as Escherichia coli, the present invention designs a pseudo-circularized structure that can increase the stability of mRNA and thus increase the expression level of recombinant proteins.
[0008] The present invention increases the stability of mRNA and thus increases the expression level of the recombinant protein encoded by it by designing a pseudo-circularized structure. The pseudo-circularized structure has the following characteristics: 1) By adding a fragment at the end of the 3'-end of mRNA, this fragment forms a complementary double-stranded pseudo-circularized structure with a corresponding fragment in the 5'-end transcription start region. 2) This pseudo-circularized structure is outside the ribosome binding site and the protein coding region, increasing the stability of mRNA while having no effect on protein translation. 3) This pseudo-circularized structure can increase the stability of mRNA and has universality, and can be applied to the expression of various recombinant proteins to increase the expression level of the protein.
[0009] The technical solution adopted by the present invention is as follows:
[0010] The present invention provides an expression cassette, which includes: a promoter, a 5'-end starting region, a ribosome binding site, a target gene, and a terminator, and a sequence fragment complementary to the 5'-end starting region is further added before the terminator.
[0011] Among them, for the length of the reverse complementary sequence, as long as it can effectively form complementary pairing with the 5'-end starting region after transcription, the length is usually preferably 15 - 25 bp. If it is too short, mismatching is likely to occur, and if it is too long, pairing is difficult. Taking the lactose operon as an example, if its length is 25 bp, the length of the reverse complementary sequence does not exceed 25 bp, otherwise it may interfere with the binding of the RBS and the ribosome binding site, thus affecting the translation efficiency (verified by experiments, when the complementary pairing region covers the RBS, the protein expression level decreases significantly).
[0012] The operon is the lactose operon, the promoter is the T7 promoter, and the terminator is the T7 terminator.
[0013] More specifically, the expression cassette includes the T7 promoter, the lactose operon, the ribosome binding site, the target gene, the sequence fragment reverse complementary to the lactose operon, and the T7 terminator; more preferably, the sequence fragment reverse complementary to the lactose operon is GGAATTGTGAGCGGATAACAATTCC.
[0014] The present invention further provides an expression vector, which includes the above-mentioned expression cassette. Preferably, the expression vector is a prokaryotic cell expression vector, for example, an Escherichia coli expression vector, and for example, its starting vector is a pET series plasmid, such as pET-28a(+).
[0015] The present invention also provides a recombinant host cell, which includes the above-mentioned expression vector. Preferably, the host cell is a prokaryotic cell, and more preferably Escherichia coli.
[0016] The present invention also provides the use of the above-mentioned expression cassette, the above-mentioned expression vector or the above-mentioned recombinant host cell in increasing the expression of recombinant proteins from the target gene in the host cell.
[0017] The present invention particularly provides a method for expressing recombinant proteins, by culturing the above-mentioned recombinant host cell to produce the recombinant protein encoded by the target gene. Optionally, it further includes the step of purifying the recombinant protein.
[0018] The advantages of the present invention are as follows: By adding a sequence capable of forming a pseudo-cyclized structure behind the target gene of a common expression vector to increase the stability of the transcribed mRNA, it can be applied to existing mRNA technologies to increase the stability of the target mRNA when used medicinally. In addition, this method can be used for the expression of recombinant proteins (in vivo or in vitro expression systems). By increasing the stability of the mRNA through this pseudo-cyclized structure, the expression level of the target protein is increased, thereby reducing the production cost of the recombinant protein. This method is simple and highly versatile, and has broad application prospects in the fields of mRNA production and recombinant protein production. Description of the Drawings
[0019] Figure 1 Schematic diagram of pseudo-circularized mRNA: A) Position for adding a sequence that forms complementary base pairing with the 5'-end starting region; B) After adding this complementary base pairing sequence, a pseudo-circularized structure is formed by complementary base pairing between the 5'-end and the 3'-end.
[0020] Figure 2 Plasmid expression vector map of pET28a(+).
[0021] Figure 3 qPCR analysis of the effect of the pseudo-circularized structure on the mRNA expression level.
[0022] Figure 4 RNA PAGE analysis of the effect of the pseudo-circularized structure on the mRNA expression level
[0023] Figure 5 Characterization of the effect of the pseudo-circularized structure on the expression level of EGFP protein by fluorescence intensity.
[0024] Figure 6 Effect of the pseudo-circularized structure on the expression levels of different recombinant proteins. A) SDS-PAGE electrophoresis of recombinant proteins; B) Histogram of normalized expression levels of recombinant proteins. Specific implementation manners
[0025] The present invention will be further described below through specific examples for better understanding, but it does not limit the present invention.
[0026] Example 1: Construction of expression plasmid
[0027] 1. Design of pseudo-circularized expression vector
[0028] Taking the pET series plasmids commonly used in prokaryotic expression systems as an example: the expression cassette region of pET-28a(+) contains: T7 promoter, lac operon, target gene, and T7 terminator ( Figure 1 ). We added a sequence that is reverse complementary to the lac operon in front of the T7 terminator ( Figure 1 ). After transcription, the lac operon sequence at the 5'-end of the mRNA will form a complementary base pairing structure with the reverse complementary sequence of the lac operon at the 3'-end, thus forming a pseudo-circularized structure ( Figure 1 B in).
[0029] Three recombinant proteins (EGFP, Nanoluc, and BPP1) were designed in this invention. Based on the recombinant protein expression plasmid, the reverse complementary sequence of the lactose operon (Lac operator) (GGAATTGTGAGCGGATAACAATTCC, SEQ ID NO: 1) was inserted between the T7 terminator and the target gene, which was complementary to the lactose operon sequence (GGAATTGTGAGCGGATAACAATTCC, SEQ ID NO: 2) on the vector ( Figure 1 ), thus forming a pseudo-circular structure to increase the stability of mRNA and thereby improve the protein expression level.
[0030] 2. Construction of recombinant protein expression plasmid
[0031] Construction of plasmids pET28a(+)-EGFP and pET28a(+)-Circular EGFP:
[0032] The gene sequence of the synthesized protein EGFP was inserted into the pET28a(+) plasmid ( Figure 2 ), between NcoI and BamHI, to obtain plasmid pET28a(+)-EGFP; further, the reverse complementary sequence of the lactose operon + T7 terminator sequence: GGAATTGTTATCCGCTCACAATTCCCTAGCATAACCCCTTGGGGCCTCTAAACGGGTC TTGAGGGGTTTTTTG (SEQ ID NO: 3) was ligated at the XhoI site to obtain plasmid pET28a(+)-Circular EGFP.
[0033] The construction of plasmids pET28a(+)-Nanoluc and pET28a-Circular Nanoluc; plasmids pET-28a(+)-BPP1 and pET-28a(+)-Circualr BPP1 was the same as above.
[0034] Example 2: Identification of pseudo-circular mRNA transcription level and expression level
[0035] 1) BL21(DE3) transformed with plasmids pET28a(+)-EGFP and pET28a(+)-Circular EGFP; pET28a(+)-Nanoluc and pET28a-Circular Nanoluc; pET-28a(+)-BPP1 and pET-28a(+)-Circualr BPP1 were respectively inoculated into LB medium containing 50 mg / L kanamycin and cultured overnight at 37 °C to obtain seed solutions;
[0036] 2) Inoculate the seed culture into TB medium containing the corresponding antibiotic at an inoculum size of 1%, and culture at 37°C until the OD 600 reaches 0.6 - 0.8. Add 0.4 mM IPTG to induce the expression of mRNA, induce at 37°C for 4 h, and collect the cells.
[0037] 3) Take an appropriate amount of cells for total RNA extraction by the phenol method.
[0038] 4) Perform RNA PAGE analysis to increase the expression level of mRNA after adding the pseudocyclic structure
[0039] 4) Reverse transcribe the RNA into cDNA using a reverse transcription kit.
[0040] 5) Measure the mRNA transcription level by qPCR. Using 16s RNA as an internal reference, perform relative expression measurement. The primers for 16sRNA are RT-16s RNA-F and RT-16s RNA-R, the primer sequences for EGFP and Circualr-EGFP are EGFP-F and EGFP-R, the primer sequences for Nanoluc and Circualr-Nanoluc are Nanoluc-F and Nanoluc-R, and the primers for BPP1 and Circualr-BPP1 are BPP1-F and BPP1-R.
[0041] The primers used in this example are as follows:
[0042] Table 1. qPCR primer sequences
[0043]
[0044]
[0045] The measurement results are shown in Table 2 and Figure 3 as follows.
[0046] Table 2
[0047]
[0048] Figure 3 is a normalized quantitative histogram after quantifying the non-pseudocyclic form as 1. As can be seen from Table 2, the mRNA expression level of Circualr-EGFP is increased by about 17.41 times compared to EGFP; the mRNA expression level of Circualr-Nanoluc is increased by about 8.55 times compared to Nanoluc; the mRNA expression level of Circualr-BPP1 is increased by about 7.45 times compared to BPP1, indicating that the pseudocyclic structure can significantly improve the stability and expression level of mRNA.
[0049] From Figure 4It can be seen that after adding the pseudo-cyclization structure, the expression levels of each mRNA are significantly increased, verifying that the pseudo-cyclization structure can significantly improve the stability and expression level of mRNA.
[0050] Example 3: Expression of Recombinant Protein
[0051] 1) The plasmids in Example 1 were separately transformed into Escherichia coli BL21(DE3), and the positive transformants were screened and inoculated into LB medium containing 50 mg / L kanamycin, and cultured overnight at 37 °C to obtain a seed solution.
[0052] 2) The seed solution was transferred into TB medium containing 50 mg / L kanamycin at an inoculation amount of 1%, and cultured at 37 °C until the OD 600 reached 0.6 - 0.8, then 0.4 mM IPTG was added to induce the expression of the recombinant protein, and cultured overnight at 30 °C, and the cells were collected.
[0053] 3) Measure the OD 600 with a spectrophotometer, take the same OD 600 amount of bacterial cells, centrifuge at 12000 rpm for 1 min, discard the supernatant, and resuspend the bacterial cells with PBS for later use.
[0054] Example 4: Determination of the Fluorescence Intensity of Recombinant Protein EGFP
[0055] 1) Add the bacterial solutions of pET28a(+)-EGFP and pET28a(+)-Circular EGFP in Example 2 to a 96-well plate.
[0056] 2) Measure the fluorescence intensity of EGFP with an enzyme-linked immunosorbent assay (ELISA) reader.
[0057] In Table 1 and Figure 5 , the excitation light and emission light were 479 nm and 520 nm respectively to measure the absorption light intensity of EGFP. The results showed that the fluorescence intensity of EGFP with the pseudo-cyclization structure was increased by 1.25 times compared with it (Table 3), and the expression level was significantly improved.
[0058] Table 3
[0059]
[0060] Example 5: Determination of the Expression Level of the Protein Corresponding to the mRNA with the Added Pseudo-Cyclization Structure
[0061] 1) Take 80 μl of the sample in Example 2, add 20 μl of 5×SDS protein loading buffer, and perform denaturation treatment at 100 °C for 10 min.
[0062] 2) Centrifuge at 12000 rpm for 1 min, take the supernatant for SDS-PAGE electrophoresis to detect the expression level.
[0063] 3) Select the endogenous protein as the internal reference, and use Image J to estimate the relative gray values of the internal reference protein (and set its gray value to 1) and the target protein (target protein gray value / internal reference protein gray value) respectively, so as to obtain the expression level of the target protein.
[0064] 4) Normalize and compare the expression levels of the target proteins of the original plasmid and the plasmid with the pseudocyclic structure added (Table 4).
[0065] Table 4
[0066]
[0067] Figure 6 In it, A is the expression of the proteins corresponding to the non-pseudocyclic and pseudocyclic mRNAs; B is the normalized quantitative histogram after quantifying the non-pseudocyclic group as 1. As can be seen from Table 2, the expression level of Circular-EGFP is about 1.67 times higher than that of EGFP; the expression level of Circular-Nanoluc is about 1.64 times higher than that of Nanoluc; the expression level of Circular-BPP1 is about 2.29 times higher than that of BPP1. The results show that the pseudocyclic structure can significantly increase the stability of mRNA and thus improve the expression level of the corresponding protein.
Claims
1. An expression cassette, comprising: A promoter, a 5'-terminal starting region, a ribosome binding site, a target gene, and a terminator, wherein a sequence fragment that is reverse complementary to the 5'-terminal starting region is further added before the terminator.
2. The expression cassette according to claim 1, characterized in that The length of the reverse complementary sequence is 15 to 25 bp; if the 5'-terminal starting region is selected from operons, the length of the reverse complementary sequence does not exceed the length of the operon.
3. The expression cassette according to claim 2, wherein The operon is a lac operon, the promoter is a T7 promoter, and the terminator is a T7 terminator.
4. The expression cassette according to claim 3, characterized in that The expression cassette includes a T7 promoter, a lac operon, a ribosome binding site, a target gene, a sequence fragment that is reverse complementary to the lac operon, and a T7 terminator; more preferably, the sequence fragment that is reverse complementary to the lac operon is GGAATTGTGAGCGGATAACAATTCC.
5. An expression vector, which includes the expression cassette according to any one of claims 1 to 4.
6. The expression vector according to claim 5, wherein, The expression vector is a prokaryotic cell expression vector.
7. The expression vector according to claim 6, wherein, The expression vector is an Escherichia coli expression vector. For example, its starting vector is a pET series plasmid, such as pET-28a(+).
8. A recombinant host cell, which includes the expression vector according to any one of claims 5 to 7; preferably, the host cell is a prokaryotic cell, and more preferably Escherichia coli.
9. Use of the expression cassette according to any one of claims 1 to 4, the expression vector according to any one of claims 5 to 7, or the recombinant host cell according to claim 8 in enhancing the expression of a recombinant protein from a target gene in a prokaryotic host cell.
10. A method for expressing a recombinant protein, by culturing the recombinant host cell to produce the recombinant protein encoded by the target gene; optionally, the method further includes the step of purifying the recombinant protein.