Rapid traceless insertion method of yarrowia lipolytica exogenous gene based on CRISPR / Cas9
The CRISPR/Cas9 system facilitates rapid and marker-free integration of foreign genes into Yarrowia lipolytica by co-transforming a plasmid with a selection marker, addressing inefficiencies in existing methods and improving genetic modification efficiency.
Patent Information
- Application Number
- CN202510475264.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-16
- Publication Date
- 2025-07-08
AI Technical Summary
Yarrowia lipolytica has problems with long processes and insufficient screening markers in gene operations, especially traditional methods are difficult to achieve rapid and traceless foreign gene insertion and screening marker recovery.
Using the CRISPR/Cas9 system, plasmids containing exogenous gene expression cassettes, Cas9 genes and gRNA were co-transformed into the nutritionally deficient Yarrowia lipolytica, non-homologous recombination was used to insert exogenous genes, and nutritional compensation genes were recovered through passage and screening, and rapid traceless insertion and screening marker loss were achieved.
It realizes rapid traceless insertion of exogenous genes in Yarrowia liposia, simplifies the operation process, improves efficiency, reduces workload, and the autonomous loss of plasmids does not affect subsequent experiments, which is highly versatile and popular.
Smart Images

Figure HDA0005361122800000011 
Figure HDA0005361122800000012 
Figure HDA0005361122800000013
Abstract
Description
(1) Technical Field
[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to a method for rapidly and scarlessly inserting foreign genes into the genome of Yarrowia lipolytica. (2) Background Art
[0002] Yarrowia lipolytica is an important oil-producing yeast. Due to its ability to utilize a variety of hydrophobic substrates, good stress tolerance, high-throughput tricarboxylic acid cycle, and the ability to provide sufficient acetyl-CoA precursors, it is considered an ideal host for the production of natural products such as terpenoids, polyketides, and flavonoids, and has a wide range of applications in the field of metabolic engineering.
[0003] In recent years, more and more gene editing, expression, and regulation tools have been gradually developed and improved, making the methods for artificially modifying Yarrowia lipolytica more diverse and reliable. However, as an unconventional yeast, Yarrowia lipolytica has a strong non-homologous recombination ability. Using traditional methods for site-directed modification is extremely prone to off-target and misalignment. Moreover, Yarrowia lipolytica has a high tolerance to most natural antibiotics, and only a few antibiotics such as hygromycin B, bleomycin, and phleomycin can significantly inhibit its growth. When using antibiotics for screening, different strains have different minimum inhibitory concentrations, and problems such as leaky expression, false positives, or reversion mutations are also likely to occur. Therefore, when constructing Yarrowia lipolytica engineering bacteria, it is more suitable to use auxotrophic markers, among which the most commonly used are leucine auxotroph (leu2-) and uracil auxotroph (ura3-). Due to the limited variety of available markers, there is often a problem of insufficient screening markers when performing genetic operations on Yarrowia lipolytica.
[0004] The CRISPR / Cas system is derived from the self-defense mechanism of bacteria and has attracted extensive attention and in-depth research since its discovery. In bacteria, through the cooperation of sgRNA and a series of Cas proteins, a specific gene sequence can be recognized and cleaved, and bacteria can destroy the invading phage DNA in this way. Currently, through the heterologous expression of Cas proteins and gRNA, the CRISPR / Cas system has been extended to more prokaryotic and eukaryotic microorganisms and has become an excellent tool for gene editing, which is used for site-directed knockout, replacement, insertion, etc. of the genome. Among them, the CRISPR / Cas9 system derived from Streptococcus pyogenes only requires gRNA and Cas9 single enzyme to function, and is the simplest and most versatile operating system.
[0005] The CRISPR / Cas9 system has also been studied and applied in Yarrowia lipolytica, mainly for gene knockout and screening marker recycling. However, the experimental process often requires multiple transformations, subcultures, and verifications, resulting in a long operation process and low efficiency. (III) Summary of the Invention
[0006] The object of the present invention is to provide a method for rapid scarless insertion of foreign genes in Yarrowia lipolytica based on CRISPR / Cas9. Using the foreign gene integration method provided by the present invention, genes can be quickly inserted into the genome and screening markers can be recycled, overcoming problems such as long gene operation processes and insufficient screening markers in Yarrowia lipolytica.
[0007] The technical solution adopted by the present invention is as follows:
[0008] The present invention provides a method for rapid scarless insertion of foreign genes in Yarrowia lipolytica based on CRISPR / Cas9, and the method comprises the following steps:
[0009] (1) Co-transforming an exogenous gene expression cassette containing a nutritional compensation gene and a plasmid containing a screening resistance gene, a Cas9 gene, and a gRNA (denoted as plasmid 1) into auxotrophic Yarrowia lipolytica to obtain an initial strain; the nutritional compensation gene in the exogenous gene expression cassette has a gRNA recognition target site; the plasmid is based on the pCRISPRyl yeast editing plasmid, and the screening resistance genes therein include yeast screening resistance genes and Escherichia coli screening resistance genes;
[0010] (2) Inoculating the initial strain obtained in step (1) into a yeast minimal nitrogen medium containing yeast screening resistance for culture, and screening for the grown single colonies, denoted as strain 1; the plasmid 1 containing the screening resistance gene enters auxotrophic Yarrowia lipolytica to express yeast screening resistance (such as hygromycin resistance), enabling the yeast to resist the resistance (such as hygromycin) pressure in the medium; due to the low expression accumulation of gRNA and Cas9 protein when plasmid 1 first enters the yeast and the existence of homologous recombination precise repair, it is difficult to knock out the nutritional compensation gene carried by the exogenous gene expression cassette; the exogenous gene expression cassette that has not been knocked out is randomly integrated into the yeast genome under the action of non-homologous recombination, and expresses the nutritional compensation gene and the exogenous target gene, losing auxotrophy; therefore, the nutritional compensation gene can be used as a screening marker gene to screen on the medium containing resistance, and strain 1 is obtained; compared with the initial strain, one or more exogenous gene expression cassettes are inserted into random positions of the genome of strain 1, expressing the nutritional compensation gene (i.e., the exogenous leu2 gene) and the exogenous target gene (bcaba1 in the present invention), and at the same time, the free plasmid 1 is obtained, which has hygromycin resistance and can express Cas9 protein and gRNA;
[0011] (3) Inoculate the strain 1 screened in step (2) into a liquid yeast complete nutrient medium containing yeast screening resistance for subculture (preferably subculture for 1 - 3 times), stabilize the plasmid and continuously accumulate the expression of Cas9 protein and gRNA, participate in the knockout of the nutritional compensation gene (such as leu2) carried on the exogenous gene expression cassette, and then spread it on a solid yeast complete nutrient medium containing yeast screening resistance for culture, and screen the grown single colonies; compared with strain 1, the screened single colonies have accumulated a large amount of Cas9 protein and gRNA in the cells after subculture under the pressure of yeast screening resistance (hygromycin), and the exogenous nutritional compensation genes on the genome are continuously knocked out;
[0012] (4) Inoculate the single colonies screened in step (3) onto a yeast minimal nitrogen source medium for culture, and screen the single colonies that can grow in the yeast complete nutrient medium in step (3) but cannot grow on the yeast minimal nitrogen source medium, and record them as strain 2; compared with strain 1, strain 2 carries the free plasmid 1, the nutritional compensation gene on its genome is knocked out and damaged, and it cannot synthesize leucine independently, thus regaining auxotrophy;
[0013] (5) Inoculate the strain 2 screened in step (4) into a liquid yeast complete nutrient medium for subculture to remove the free plasmid 1 (preferably subculture for 1 - 3 times), and then spread it on a solid yeast complete nutrient medium for culture, and screen the single colonies; compared with strain 2, the screened single colonies have a decreased stability of the free plasmid 1 after natural subculture without antibiotic pressure and are difficult to retain continuously;
[0014] (6) Inoculate the single colonies in step (5) onto a solid yeast complete nutrient medium containing yeast screening resistance for culture, and screen the single colonies that can grow on the solid yeast complete nutrient medium in step (5) but cannot grow on the solid yeast complete nutrient medium containing yeast screening resistance, and record them as strain 3, that is, obtain the single colonies that can rapidly and seamlessly insert the exogenous target gene; compared with strain 2, the free plasmid 1 of strain 3 has been lost, and it has lost the expression ability of the relevant genes on plasmid 1 and yeast screening (hygromycin) resistance; compared with the initial strain, strain 3 has integrated one or more exogenous target genes at random positions on the genome.
[0015] Furthermore, the yeast screening resistance gene in step (1) is a hygromycin resistance gene, and its nucleotide sequence is as shown in SEQ ID NO.1 (1029bp, an artificially synthesized sequence optimized for codon adaptability, suitable for expressing hygromycin resistance in Yarrowia lipolytica); the Escherichia coli screening resistance gene is an ampicillin resistance gene, and its nucleotide sequence is as shown in SEQ ID NO.2 (861bp, an artificially synthesized sequence optimized for codon adaptability, suitable for expressing ampicillin resistance in Escherichia coli).
[0016] Further, the nucleotide sequence of the Cas9 gene in step (1) is as shown in SEQ ID NO.3 (4140bp, an artificial sequence optimized for codon adaptability, expressing Cas9 protein and corresponding nuclear localization signal in Yarrowia lipolytica).
[0017] Further, the gRNA in step (1) is designed with a nutritional complementation gene as the target gene, capable of recognizing and binding to the nutritional complementation gene (such as the leu2 coding sequence), and not mispairing and binding to other positions on the genome. The preferred nucleotide sequence is as shown in SEQ ID NO.4.
[0018] Further, the plasmid in step (1) is based on the pCRISPRyl yeast editing plasmid (nucleotide sequence as shown in SEQ ID NO.6) containing an ampicillin (Amp) resistance gene (nucleotide sequence as shown in SEQ ID NO.2), a hygromycin resistance gene (yeast screening resistance gene, nucleotide sequence as shown in SEQ ID NO.1), and a Cas9 gene (including a nuclear localization signal, nucleotide sequence as shown in SEQ ID NO.3). The basic plasmid should completely carry the CRISPR / Cas9 system, be able to express the CAS9 protein, and can express a variety of gRNAs to target different sites through simple modification; at the same time, it should be a shuttle plasmid that can be replicated, amplified, screened, and extracted in Escherichia coli, and replicated, screened, and expressed in yeast. The pCRISPRyl yeast editing plasmid of the present invention expresses the ampicillin resistance gene in Escherichia coli for screening and subculture amplification; after extracting the plasmid from Escherichia coli and transforming it into Yarrowia lipolytica, it expresses the hygromycin resistance gene for screening transformants and stable subculture; at the same time, it expresses the Cas9 protein and the set gRNA sequence, and the two act synergistically to break a specific position on the genome. By means of the mismatch repair generated during the highly efficient non-homologous recombination of Yarrowia lipolytica, a nonsense mutation or frameshift mutation of the coding gene is formed to achieve the purpose of simultaneously knocking out the nutritional complementation gene while inserting the foreign gene expression cassette into the foreign target gene.
[0019] Further, the nutritional complementation gene in the foreign gene expression cassette in step (1) is the leucine coding gene leu2, which is expressed using the endogenous leu2 promoter and terminator of Yarrowia lipolytica; the foreign target gene is the foreign target gene bcaba1, which is expressed using the TEF promoter and CYC1 terminator.
[0020] Furthermore, the components of the exogenous gene expression cassette from the 5' end to the 3' end in step (1) are: TEF promoter, exogenous target gene bcaba1, CYC1 terminator, endogenous leu2 promoter of Yarrowia lipolytica, exogenous leu2 gene, and endogenous terminator of leu2. The nucleotide sequence is as shown in SEQ ID NO.5. The leu2 gene is a nutritional compensation gene and serves as the recognition target for the gRNA expressed by the plasmid.
[0021] Furthermore, the auxotrophic Yarrowia lipolytica in step (1) includes leucine auxotrophic Yarrowia lipolytica, and a Yarrowia lipolytica strain with the leucine editing gene leu2 knocked out is particularly preferred.
[0022] Furthermore, the yeast screening resistance in steps (2), (3), and (6) is hygromycin, and the content is 500 mg / L.
[0023] Furthermore, the composition of the yeast basal nitrogen source medium in steps (2) and (4) is: 6.7 g / L of amino acid-free yeast nitrogen source (produced by biosharp), 20 g / L of anhydrous glucose, 20 g / L of agar powder, dissolved in sterile water, and autoclaved.
[0024] Furthermore, the composition of the liquid yeast complete nutrient medium in steps (3) and (5) is: 20 g / L of anhydrous glucose, 20 g / L of peptone, 10 g / L of yeast extract, dissolved in sterile water, and autoclaved.
[0025] Furthermore, the composition of the solid yeast complete nutrient medium in steps (5) and (6) is: 20 g / L of anhydrous glucose, 20 g / L of peptone, 10 g / L of yeast extract, 20 g / L of agar powder, dissolved in sterile water, and autoclaved.
[0026] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:
[0027] The present invention provides a method for rapid scarless insertion of exogenous genes in Yarrowia lipolytica. The exogenous gene expression cassette carrying a nutritional compensation gene (i.e., an auxotrophic selection marker) and a plasmid containing gRNA, Cas gene, and selection resistance gene designed for this nutritional compensation gene are co-transformed into auxotrophic Yarrowia lipolytica. After the exogenous target gene is integrated into the genome, the nutritional compensation gene is recovered through subculture, and then the plasmid is lost to complete the rapid scarless integration of the exogenous gene.
[0028] The plasmid used in the present invention only needs to be amplified by reverse open-loop and re-cyclized once to reset the gRNA and target a new knockout site;
[0029] The present invention only needs 1 selection marker corresponding to the gRNA to achieve the integration of exogenous genes any number of times;
[0030] The whole process of screening marker recovery can be completed with only 1 plasmid in the present invention;
[0031] The plasmid used in the present invention can be spontaneously lost only by simple subculture, without affecting subsequent experiments;
[0032] The present invention adopts the method of co-transformation of plasmid and gene. Only one co-transformation operation is required to express the exogenous gene and the screening marker recovery system, greatly reducing the workload and saving working time;
[0033] Compared with the commonly used Cre / loxP screening marker recovery system, the present invention does not require special modification of the screening marker, and multiple uses do not interfere with each other, with higher versatility and popularization; (IV) BRIEF DESCRIPTION OF THE DRAWINGS
[0034] Figure 1 It is a schematic diagram of plasmid composition.
[0035] Figure 2 It is a schematic diagram of the exogenous gene expression cassette composition.
[0036] Figure 3 It is a flow chart of exogenous gene insertion into the genome.
[0037] Figure 4 It is a schematic diagram of the gRNA binding position.
[0038] Figure 5 It is a verification result diagram of the auxotrophic phenotype after the leu2 gene of strain 1 is knocked out; A represents the growth of strain 1 on the yeast minimal nitrogen source medium before subculture knockout. 1-8 are 8 groups of parallel verifications. The medium does not include leucine (leucine is a necessary nutrient for yeast growth and reproduction), and its normal growth represents that yeast can synthesize leucine autonomously, that is, the leu2 gene can be normally expressed without being disrupted by knockout. B is the reverse side photo of the A medium plate. C represents the growth of the strain on the yeast minimal nitrogen source medium after subculture knockout. 1-8 are 8 groups of parallel verifications. The medium does not include leucine (leucine is a necessary nutrient for yeast growth and reproduction), and its inability to grow after inoculation represents that yeast cannot synthesize leucine autonomously, that is, the leu2 gene cannot be expressed and has been knocked out during subculture. The strain has a leucine auxotrophy, and at this time it is defined as strain 2. D is the reverse side photo of the C medium plate.
[0039] Figure 6Verification diagram of bcaba1 agarose gel electrophoresis bands after PCR amplification of the genomic DNA extracted from strain 3; M represents the nucleic acid Marker lane of agarose gel electrophoresis, and the DNA length represented by each band is marked; 1-6 are 6 groups of parallel verifications, that is, the exogenous gene expression cassette (4835bp) was amplified from the genome of strain 3, and the length was consistent with the expectation, indicating that the exogenous gene expression cassette had been integrated into the genome.
[0040] Figure 7 Verification diagram of the phenotype of strain 3 without hygromycin resistance after plasmid loss; A represents the growth of strain 2 on the complete yeast medium supplemented with hygromycin before subculture. 1-8 are 8 groups of parallel verifications. The normal growth of the strain indicates that the yeast has resistance to hygromycin, suggesting the presence and expression of the plasmid in the cells. B is the reverse side photo of the A medium plate. C represents the growth of the strain on the complete yeast medium supplemented with hygromycin after subculture under the condition of no antibiotic pressure. 1-6 are 6 groups of parallel verifications. The inability of the strain to grow normally after inoculation indicates that it has lost hygromycin resistance, that is, the plasmid has been lost, and it is then defined as strain 3 at this time. (V) Specific implementation methods
[0041] The present invention will be further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:
[0042] The composition of the culture media used in the embodiments of the present invention:
[0043] The composition of the yeast minimal nitrogen source medium is: yeast nitrogen base without amino acids (produced by Biosharp) 6.7 g / L, anhydrous glucose 20 g / L, agar powder 20 g / L, dissolved in sterile water and sterilized by high-pressure steam.
[0044] The composition of the liquid complete yeast medium is: anhydrous glucose 20 g / L, peptone 20 g / L, yeast extract 10 g / L, dissolved in sterile water and sterilized by high-pressure steam.
[0045] The composition of the solid complete yeast medium is: anhydrous glucose 20 g / L, peptone 20 g / L, yeast extract 10 g / L, agar powder 20 g / L, dissolved in sterile water and sterilized by high-pressure steam.
[0046] All aqueous solutions in the embodiments of the present invention are prepared with sterile water.
[0047] Example 1: Method for rapid and scarless insertion of exogenous target genes
[0048] Refer to Figure 3 , and rapidly and scarlessly insert the exogenous target gene bcaba1 into the genome of Yarrowia lipolytica A-5K.
[0049] 1. Construction of plasmid pCRISPRyl - anti - hygB - knock - out leu2
[0050] Refer to Figure 1 , using the pCRISPRyl yeast editing plasmid (nucleotide sequence as shown in SEQ ID NO.6) containing the ampicillin (Amp) resistance gene (nucleotide sequence as shown in SEQ ID NO.2), hygromycin resistance gene (yeast screening resistance gene, nucleotide sequence as shown in SEQ ID NO.1), and Cas9 gene (including nuclear localization signal, nucleotide sequence as shown in SEQ ID NO.3) as the basic vector, insert the 20 - bp DNA transcription template sequence determining gRNA expression (refer to Figure 4 for the designed gRNA targeting the gene leu2, and its corresponding expressed gRNA sequence is as shown in SEQ ID NO.4) at the 8751 - 8770bp site (before the gRNA scaffold) to construct the plasmid pCRISPRyl - anti - hygB - knock - out leu2 (nucleotide sequence as shown in SEQ ID NO.7), denoted as plasmid 1.
[0051] Using the pCRISPRyl - anti - hygB - knock - out leu2 plasmid as the template, perform PCR reverse open - loop amplification with the following primers with homologous arms to obtain a linear plasmid. The linear plasmid is transferred into Escherichia coli DH5α, spread on LB solid medium containing 100mg / L ampicillin, and cultured at 37°C for 1 day to form a loop; pick the transformants and inoculate them into LB liquid medium containing 100mg / L ampicillin, and culture them in a constant - temperature shaker at 37°C at a rotation speed of 220rpm for 1 day. Extract the plasmid from the bacterial liquid for sequencing verification to confirm the obtained plasmid pCRISPRyl - anti - hygB - knock - out leu2.
[0052] Forward primer 5’→3’ sequence: GTCTTGGTCTTCTTAGTTTCgttttagagctagaaatagcaag;
[0053] Reverse primer 5’→3’ sequence: GAAACTAAGAAGACCAAGACgtcaacctgcgccgaccc;
[0054] Use the 2×Phanta Master Mix high - fidelity DNA polymerase from Novoprotein; primer concentration 10μM; template concentration 200mg / L;
[0055] Composition of the PCR system: 20μL of sterile water, 2μL of each of the forward / reverse primers, 1μL of the template, 25μL of 2×Phanta Master Mix, for a total of 50μL;
[0056] The PCR reaction procedure is as follows: ① Pre-denaturation at 95°C for 5 min; ② Denaturation at 95°C for 15 s; ③ Annealing at 57°C for 15 s; ④ Extension at 72°C for 5 min; Repeat steps ②, ③, and ④ for 30 cycles; ⑤ Final extension at 72°C for 5 min.
[0057] SEQ ID NO.4: GUCUUGGUCUUCUUAGUUUC.
[0058] SEQ ID NO.7
[0059]
[0060] 2. Construction of exogenous gene expression cassette
[0061] Refer to Figure 2 , the components of the exogenous gene expression cassette from the 5' end to the 3' end are: TEF promoter, exogenous target gene bcaba1, CYC1 terminator, endogenous leu2 promoter of Yarrowia lipolytica, leu2 coding gene, and endogenous leu2 terminator. The leu2 gene is a selection marker gene and serves as the recognition target for the gRNA expressed by the plasmid.
[0062] The exogenous gene expression cassette was synthesized by Beijing Tsingke Biotechnology Co., Ltd., and its nucleotide sequence is as shown in SEQ ID NO.5 (where 1 - 535bp represents the TEF promoter, 536 - 2065bp represents the exogenous gene bcaba1, 2066 - 2255bp represents the CYC1 terminator, 2256 - 3172bp represents the endogenous leu2 promoter, 3173 - 4390bp represents the leu2 coding gene (auxotrophic selection marker), and 4391 - 4835bp represents the endogenous leu2 terminator), and it was constructed on the commercial plasmid pUC57. After obtaining it, PCR amplification was carried out to obtain the required DNA sequence (i.e., the exogenous gene expression cassette, nucleotide sequence as shown in SEQ ID NO.5).
[0063] Use the 2×Phanta Master Mix high-fidelity DNA polymerase from Novoprotein; primer concentration 10μM; template concentration 200mg / L;
[0064] Forward primer 5’→3’ sequence: AGAGACCGGGTTGGCGGCGC;
[0065] Reverse primer 5’→3’ sequence: TATCATTTGTAACAATTACCCTGTACA;
[0066] The template is the DNA sequence obtained by the above PCR amplification;
[0067] Composition of the PCR system: 20μL of sterile water, 2μL of each forward / reverse primer, 1μL of template, 25μL of 2×Phanta Master Mix, for a total of 50μL;
[0068] The PCR reaction procedure is as follows: pre-denaturation at 95℃ for 5min; (denaturation at 95℃ for 15s; annealing at 65℃ for 15s; extension at 72℃ for 2.5min) for 30 cycles; final extension at 72℃ for 5min.
[0069] SEQ ID NO.5
[0070]
[0071] 3. Co-transformation of Yeast with Plasmid pCRISPRyl - anti - hygB - knock - out leu2 and Exogenous Gene Expression Cassette
[0072] The plasmid pCRISPRyl - anti - hygB - knock - out leu2 constructed in step 1 and the exogenous gene expression cassette constructed in step 2 were co - transformed into the leucine - deficient Yarrowia lipolytica constructed by the method of Example 2 using the PEG - lithium acetate chemical transformation method. The specific transformation steps are as follows:
[0073] (1) Inoculate the leucine - deficient Yarrowia lipolytica into a liquid yeast complete nutrient medium and culture it with shaking at 30 °C and 220 rpm until the OD of the bacterial liquid 600 = 0.5;
[0074] (2) Pipette 1 mL of the bacterial liquid, centrifuge at 4000×g for 5 min, discard the culture medium, and collect the cell pellet;
[0075] (3) Resuspend the cell pellet by pipetting with 1 mL of sterile water, centrifuge at 4000×g for 2.5 min, discard the supernatant, and collect the cell pellet.
[0076] (4) Add 1 mL of 0.1 mol / L lithium acetate aqueous solution and let it stand in a water bath at 28 °C for 1 h;
[0077] (5) Centrifuge at 3000×g for 5 min, discard the supernatant, and collect the cell pellet;
[0078] (6) Resuspend the pellet with 80 μL of 0.1 mol / L lithium acetate aqueous solution to prepare competent cells;
[0079] (7) Sequentially add 5 μL of salmon sperm Carrier DNA, 20 μL of the exogenous gene expression cassette prepared in step 2 (DNA concentration 100 - 500 ng / μL), and 20 μL of the plasmid pCRISPRyl - anti - hygB - knock - out leu2 constructed in step 1 (DNA concentration 100 - 500 ng / μL) to the competent cells;
[0080] (8) Gently mix and place in a water bath at 28 °C for 15 min;
[0081] (9) Sequentially add 350 μL of PEG - lithium acetate mixture (final concentration of lithium acetate is 0.1 mol / L, final volume concentration of PEG (molecular weight 3350) is 40%, and the solvent is sterile water) and 16 μL of 1 mol / L dithiothreitol aqueous solution;
[0082] (10) Mix well and place in a water bath at 28 °C for 1 h;
[0083] (11) Slowly add 40 μL of dimethyl sulfoxide and incubate in a water bath at 42 °C for 10 min;
[0084] (12) Centrifuge at 2500×g for 5 min and discard all the supernatant;
[0085] (13) Add 1 mL of liquid yeast complete nutrient medium, shake at 30 °C and 220 rpm to resuscitate the cells for 4 h;
[0086] (14) Centrifuge at 2500×g for 5 min and discard all the supernatant;
[0087] (15) Resuspend the cells by pipetting with 1 mL of sterile water, centrifuge at 2500×g for 5 min and discard the supernatant;
[0088] (16) Add 200 μL of sterile water to resuspend the cells, collect the suspension and spread it on yeast minimal nitrogen medium containing 500 mg / L hygromycin. After culturing at 30 °C for 1 - 2 d, select the single colonies on the plate ( Figure 5 A, B in it) on the isolation medium to obtain strain 1; Plasmid 1 enters Yarrowia lipolytica expressing hygromycin resistance, enabling the yeast to resist the hygromycin pressure in the medium and grow on yeast minimal nitrogen medium supplemented with hygromycin pressure; When plasmid 1 first enters leucine - deficient Yarrowia lipolytica, due to the low expression accumulation of gRNA and Cas9 protein and the existence of homologous recombination and precise repair, it is difficult to knock out the nutritional defect compensation gene carried by the exogenous gene expression cassette. Without being knocked out, the exogenous gene expression cassette is randomly integrated into the yeast genome under the action of non - homologous recombination and expresses the nutritional defect compensation gene and the exogenous target gene, causing the yeast to lose the nutritional defect type; Therefore, strain 1 can grow on yeast minimal nitrogen medium containing hygromycin resistance. Compared with the initial strain, one or more exogenous gene expression cassettes are inserted at random positions in the genome of strain 1, expressing the exogenous leu2 gene (losing the nutritional defect type) and the exogenous target gene bcaba1. At the same time, free plasmid 1 is obtained, which has hygromycin resistance and can express Cas9 protein and gRNA.
[0089] (17) Extract the genome of strain 1 using the Yeast Genomic DNA Rapid Extraction Kit from Sangon Biotech (Shanghai) Co., Ltd. (Product No. B518227). Through sequencing verification, it is determined that the exogenous gene expression cassette in step 2 is inserted at a random position in the genome, and the free plasmid pCRISPRyl - anti - hygB - knock - leu2 is obtained.
[0090] 4. Sub - culture of transformants and recovery of nutritional defect type screening markers
[0091] The strain 1 obtained in step 3 was subcultured continuously to recover the auxotrophic selection marker. The recovery of the selection marker is based on the phenotype, that is, the reappearance of leucine auxotrophy. The recovery of the selection marker in the present invention is caused by a frameshift mutation induced by non-homologous recombination. As Figure 4 shown, due to the insertion of bases that were not originally present during break repair in the leu2 gene, the entire gene underwent a frameshift mutation and lost its activity, so that the strain could no longer synthesize leucine, and leucine auxotrophy was regained ( Figure 5 ,) that is, the strain could not grow on a medium without leucine, achieving the purpose of recovering the selection marker. The specific operation steps are as follows:
[0092] (1) Inoculate strain 1 into a test tube of liquid yeast complete nutrient medium containing 500 mg / L hygromycin, and culture it with shaking at 30 °C and 220 rpm for 24 h;
[0093] (2) Pipette the bacterial liquid from the test tube in the previous step, and re-inoculate it into a new test tube of liquid yeast complete nutrient medium containing 500 mg / L hygromycin at an inoculation amount of 1% by volume, and culture it with shaking at 30 °C and 220 rpm for 24 h;
[0094] (3) Take the bacterial liquid from the test tube in the previous step, dilute it 100 times with sterile water, and spread it on a solid yeast complete nutrient medium containing 500 mg / L hygromycin, and culture it at 30 °C for 24 h; In the short time after plasmid 1 was just transformed into yeast, the expression and accumulation levels of gRNA and Cas9 protein in the cells were relatively low, and the cleavage efficiency of the target site was relatively low; at the same time, precise repair mediated by homologous recombination might cause correct recombination at the cleavage position, resulting in knockout failure; the knockout rate of the exogenous leu2 gene carried by the exogenous gene cassette in the primary transformants was low. After continuous culture and passage of plasmid 1 in yeast cells, gene expression continued, and gRNA and Cas9 protein accumulated in the cells. At this time, the cleavage efficiency of the target site was very high; at the same time, since the correct repair mediated by homologous recombination did not change the gene sequence, this site would once again become the target site to be cleaved, and this process might be repeated multiple times until a mismatch repair occurred at this position and it no longer served as an identification site; after subculture, the knockout success rate of the exogenous nutritional compensation gene in the transformants was extremely high. Subculture strain 1 in a liquid yeast complete nutrient medium under the pressure of hygromycin to stabilize the plasmid and continuously accumulate the expression of Cas9 protein and gRNA, which participated in the knockout of the nutritional compensation gene leu2 carried on the exogenous gene expression cassette.
[0095] (4) Pick and number the single colonies growing on the solid medium in the previous step, inoculate them into a yeast minimal nitrogen medium, and culture them at 30 °C for 1 - 2 d, and observe their growth conditions. Screen for leucine auxotrophic strains that cannot grow normally on the yeast minimal nitrogen medium ( Figure 5In C and D), it is denoted as strain 2. Compared with strain 1, the nutritional compensation gene leu2 on its genome is knocked out and damaged, and it cannot synthesize leucine autonomously, thus regaining auxotrophy.
[0096] (5) The genome of strain 2 was extracted using the Yeast Genomic DNA Rapid Extraction Kit from Sangon Biotech (Shanghai) Co., Ltd. (product number B518227), verified by sequencing, and it was determined that the exogenous gene expression cassette was inserted at a random position on the genome and carried the free plasmid pCRISPRyl - anti - hygB - knock - leu2. However, the leu2 gene carried on the exogenous gene expression cassette has been knocked out, and only the exogenous target gene bcaba1 is expressed.
[0097] 5. Natural loss and verification of plasmids
[0098] For strain 2 obtained in step 3 that can grow on solid yeast complete nutrient medium containing 500 mg / L hygromycin ( Figure 7 in A and B), continuous sub - culture was carried out to cause the plasmid pCRISPRyl - anti - hygB - knock - leu2 it carried to be naturally lost under stress - free conditions. The specific operation steps are as follows:
[0099] (1) Inoculate strain 2 into a test tube of liquid yeast complete nutrient medium, and culture it at 30 °C with shaking at 220 rpm for 24 h;
[0100] (2) Pipette the bacterial liquid from the previous test tube and re - inoculate it into a new test tube of liquid yeast complete nutrient medium at an inoculation amount of 1%, and culture it at 30 °C with shaking at 220 rpm for 24 h;
[0101] (3) Take the bacterial liquid from the previous test tube, dilute it 10,000 times with sterile water and spread it on solid yeast complete nutrient medium, and culture it at 30 °C for 24 h; After natural sub - culture without antibiotic pressure, the stability of the free plasmid 1 decreases and it is difficult to continue to be retained.
[0102] (4) Pick and number the single colonies growing on the solid medium in the previous step, inoculate them into solid yeast complete nutrient medium containing 500 mg / L hygromycin, and observe their growth at 30 °C for 1 - 2 d. Screen to obtain non - resistant strains that cannot grow normally on solid yeast complete nutrient medium with hygromycin pressure applied ( Figure 7 in C and D), denoted as strain 3. Compared with strain 2, its free plasmid 1 has been lost, losing the expression ability of the relevant genes on the plasmid and hygromycin resistance, and the exogenous target gene bcaba1 has been successfully inserted.
[0103] 6. Verification of the insertion situation of exogenous genes
[0104] After extracting the genomic DNA of strain 3 using the Shanghai Sangon Yeast Genomic DNA Rapid Extraction Kit (Product No. B518227), PCR amplification was performed using the forward and reverse primers in Step 2. The verification diagram of the agarose gel electrophoresis bands of the amplification products is shown in Figure 6 as follows.
[0105] One or more foreign gene expression cassettes were inserted at random positions in the genome of strain 3 obtained by this method, and the foreign gene leu2 carried on the foreign gene expression cassette had been knocked out; that is, one or more foreign gene bcaba1 expression cassettes were randomly inserted into the genome of the starting strain.
[0106] The above Steps 1-5 are the process of completing one round of integration of foreign target genes into the genome using the method of the present invention. The whole process takes about 10 days, and the efficiency is much higher than that of the traditional method (about 15 days); and it does not require the consumption of auxotrophic selection markers, can be reused, is convenient for popularization, and has significant advantages compared with general methods.
[0107] Example 2. Preparation of leucine auxotrophic Yarrowia lipolytica
[0108] 1. Plasmid transformation and transformant screening:
[0109] The plasmid pCRISPRyl - anti - hygB - knock - leu2 constructed in Step 1 of Example 1 was transformed into wild - type Yarrowia lipolytica by the PEG - lithium acetate chemical transformation method. The specific transformation steps are as follows:
[0110] (1) Yarrowia lipolytica, purchased from the China Center for Industrial Culture Collection (CICC), strain number CICC 31251, was inoculated into a liquid yeast complete nutrient medium and cultured with shaking at 30 °C and 220 rpm until the OD of the bacterial solution 600 = 0.5;
[0111] (2) 1 mL of the bacterial solution was taken and centrifuged at 4000×g for 5 min, the culture medium was discarded, and the cell pellet was collected;
[0112] (3) The cell pellet was resuspended by pipetting with 1 mL of sterile water and centrifuged at 4000×g for 2.5 min, the supernatant was discarded, and the cell pellet was collected.
[0113] (4) 1 mL of 0.1 mol / L lithium acetate aqueous solution was added and left standing in a water bath at 28 °C for 1 h;
[0114] (5) Centrifuged at 3000×g for 5 min, the supernatant was discarded, and the cell pellet was collected;
[0115] (6) The pellet was resuspended with 80 μL of 0.1 mol / L lithium acetate aqueous solution to prepare competent cells;
[0116] (7) Add 5 μL of salmon sperm Carrier DNA and 20 μL of the plasmid pCRISPRyl - anti - hygB - knock - leu2 constructed in step 1 (DNA concentration 100 - 500 ng / μL) to the competent cells in sequence;
[0117] (8) After gently mixing, place it in a 28°C water bath for 15 min;
[0118] (9) Add 350 μL of PEG - lithium acetate mixture (final concentration of lithium acetate is 0.1 mol / L, final volume concentration of PEG (molecular weight 3350) is 40%, and the solvent is sterile water) and 16 μL of 1 mol / L dithiothreitol aqueous solution in sequence;
[0119] (10) After mixing, place it in a 28°C water bath for 1 h;
[0120] (11) Slowly add 40 μL of dimethyl sulfoxide and place it in a 42°C water bath for 10 min;
[0121] (12) Centrifuge at 2500×g for 5 min and discard all the supernatant;
[0122] (13) Add 1 mL of liquid yeast complete nutrient medium, shake at 30°C and 220 rpm to resuscitate the bacteria for 4 h;
[0123] (14) Centrifuge at 2500×g for 5 min and discard all the supernatant;
[0124] (15) Resuspend the bacteria by pipetting with 1 mL of sterile water, centrifuge at 2500×g for 5 min and discard the supernatant;
[0125] (16) Resuspend the bacteria with 200 μL of sterile water, collect the suspension and spread it on the yeast complete nutrient medium containing 500 mg / L hygromycin. After culturing at 30°C for 1 - 2 d, pick the single colonies on the plate separation medium where colonies have grown to obtain the transformants; The transformants have obtained the free plasmid 1, have hygromycin resistance, and can express Cas9 protein and gRNA.
[0126] 2. Sub - culture of transformants and obtaining auxotrophs:
[0127] Continuously sub - culture the above - mentioned transformants to disrupt the leu2 gene of the strain to obtain auxotrophs. The specific operation steps are as follows:
[0128] (1) Inoculate the transformants into a test tube of liquid yeast complete nutrient medium containing 500 mg / L hygromycin, and shake - culture at 30°C and 220 rpm for 24 h; In the short time after the plasmid has just been transformed into yeast, the expression and accumulation levels of gRNA and Cas9 protein in the cells are relatively low, and the cleavage efficiency of the target site is relatively low.
[0129] (2) Pipette the bacterial liquid from the test tube in the previous step and re-inoculate it into a new test tube of liquid yeast complete nutrient medium containing 500 mg / L hygromycin at an inoculation amount of 1% by volume. Incubate it with shaking at 30 °C and 220 rpm for 24 h;
[0130] (3) Take the bacterial liquid from the test tube in the previous step, dilute it 100 times with sterile water, and spread it on solid yeast complete nutrient medium containing 500 mg / L hygromycin. Incubate it at 30 °C for 24 h; After continuous culture and passage of the plasmid in yeast cells, gene expression continues, and gRNA and Cas9 protein accumulate in the cells. At this time, the cleavage efficiency of the target site is very high.
[0131] (4) Pick and number the single colonies growing on the solid medium in the previous step, inoculate them into yeast minimal nitrogen medium, and culture them at 30 °C for 1 - 2 d to observe their growth conditions. Screen for leucine auxotrophic strains that cannot grow normally on yeast minimal nitrogen medium, which are the leucine auxotrophic Yarrowia lipolytica we need.
Claims
1. A method for rapid and scarless insertion of foreign genes in Yarrowia lipolytica based on CRISPR / Cas9, characterized in that, The method comprises the following steps: (1) Co-transfer an exogenous gene expression cassette containing a nutritional compensation gene and a plasmid containing a screening resistance gene, a Cas9 gene, and a gRNA into auxotrophic Yarrowia lipolytica to obtain an initial strain; the nutritional compensation gene in the exogenous gene expression cassette has a recognition target for the gRNA; the plasmid is based on the pCRISPRyl yeast editing plasmid, and the screening resistance gene therein includes a yeast screening resistance gene and an Escherichia coli screening resistance gene; (2) Inoculate the initial strain obtained in step (1) into a yeast basal nitrogen source medium containing yeast screening resistance for culture, and screen for the grown single colonies, denoted as strain 1; (3) Inoculate the strain 1 screened in step (2) into a liquid yeast complete nutrient medium containing yeast screening resistance for subculture, and then spread it on a solid yeast complete nutrient medium containing yeast screening resistance for culture, and screen for the grown single colonies; (4) Inoculate the single colonies screened in step (3) onto a yeast basal nitrogen source medium for culture, and screen for the single colonies that can grow in the yeast complete nutrient medium in step (3) but cannot grow on the yeast basal nitrogen source medium, denoted as strain 2; (5) Inoculate the strain 2 screened in step (4) into a liquid yeast complete nutrient medium for subculture, and then spread it on a solid yeast complete nutrient medium for culture, and screen for single colonies; (6) Inoculate the single colonies in step (5) onto a solid yeast complete nutrient medium containing yeast screening resistance for culture, and screen for the single colonies that can grow on the solid yeast complete nutrient medium in step (5) but cannot grow on the solid yeast complete nutrient medium containing yeast screening resistance, denoted as strain 3, that is, obtain a strain with rapid seamless insertion of an exogenous target gene.
2. The method according to claim 1, wherein The yeast screening resistance gene in step (1) is a hygromycin resistance gene, and its nucleotide sequence is as shown in SEQ ID NO.1; the Escherichia coli screening resistance gene is an ampicillin resistance gene, and its nucleotide sequence is as shown in SEQ ID NO.2; the nucleotide sequence of the Cas9 gene is as shown in SEQ ID NO.
3.
3. The method according to claim 1, wherein The nucleotide sequence of the gRNA in step (1) is as shown in SEQ ID NO.
4.
4. The method according to claim 1, characterized in that The nucleotide sequence of the pCRISPRyl yeast editing plasmid in step (1) is as shown in SEQ ID NO.
6.
5. The method according to claim 1, wherein The nutritional compensation gene in the exogenous gene expression cassette in step (1) is the leucine-encoding gene leu2, which is expressed using the endogenous leu2 promoter and terminator of Yarrowia lipolytica; The exogenous target gene is the exogenous target gene bcaba1, which is expressed using the TEF promoter and the CYC1 terminator.
6. The method according to claim 5, characterized in that, The nucleotide sequence of the exogenous gene expression cassette is as shown in SEQ ID NO.
5.
7. The method according to claim 5, wherein The auxotrophic Yarrowia lipolytica in step (1) includes leucine auxotrophic Yarrowia lipolytica.
8. The method according to claim 5, characterized in that In steps (2), (3), and (6), the yeast screening resistance is hygromycin, and the content is 500 mg / L.
9. The method according to claim 1, wherein The composition of the yeast basal nitrogen source medium in steps (2) and (4) is: 6.7 g / L of amino acid-free yeast nitrogen source, 20 g / L of anhydrous glucose, 20 g / L of agar powder, dissolved in sterile water.
10. The method according to claim 1, wherein, The composition of the liquid yeast complete nutrient medium for steps (3) and (5) is: anhydrous glucose 20 g / L, peptone 20 g / L, yeast extract 10 g / L, dissolved in sterile water; the composition of the solid yeast complete nutrient medium for steps (5) and (6) is: anhydrous glucose 20 g / L, peptone 20 g / L, yeast extract 10 g / L, agar powder 20 g / L, dissolved in sterile water.