Method for editing pre-mirna trans-boundary regulation of epct and application thereof

Abstract

The present application relates to a kind of editing pre-miRNA cross-border regulation EPCT method and application.The present application provides a kind of EPCT gene editing method based on stable universal RNA fragment with SPMQS feature, to solve the problems such as RNA easy degradation in prior art, RNA sequence conservation is poor in different species, low communication efficiency.The SPMQS feature provided by the present application and the source plant pre-miRNA sequence edited by using the same can directly and efficiently regulate the traits of source and sink plants, realize the directional regulation of sink end, and have wide application prospect.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology, and in particular to an EPCT method for editing pre-miRNA cross-border regulation and its application. Background Art

[0002] Cross-kingdom RNA regulation refers to the phenomenon in which RNA molecules communicate between species and regulate gene expression. Recent studies have shown that mRNA can be transferred between plants and microorganisms, or plants and animals, through exosomes, viral vectors, or direct absorption, affecting gene expression and traits in the recipient organisms. This discovery provides new insights into plant trait improvement. However, not all RNAs are capable of cross-species communication; those that can possess unique sequence and structural characteristics. Therefore, leveraging the sequence and structural characteristics of cross-kingdom RNAs to modify non-communicable RNAs and applying them to cross-species regulation has important implications for improving crop production efficiency. These include enhancing plant disease resistance, improving plant tolerance to stresses such as drought and salinity, promoting plant growth or altering developmental processes, and modifying plant metabolites through the transfer of specific RNAs.

[0003] There is currently little research on RNA that crosses kingdoms. For example, when infected by pathogens, Arabidopsis thaliana releases exosomes containing disease-resistant RNA. These RNAs can be absorbed and expressed by neighboring plants, thereby improving their disease resistance. Drought-resistant RNA can be introduced into plants via viral vectors, significantly improving their drought tolerance. Flowering can be accelerated or delayed by delivering RNA associated with flowering. And the content of specific secondary metabolites in plants can be increased by delivering RNA associated with the synthesis of secondary metabolites.

[0004] During this process, there are numerous technical challenges. (1) RNA stability: RNA is easily degraded during cross-kingdom transmission, and improving its stability is a major challenge. (2) Transfer efficiency: RNA transfer efficiency varies greatly between species, and improving transfer efficiency is key. (3) Specific regulation: How to achieve specific regulation of RNA and avoid off-target effects is another challenge. For these reasons, current applications are still limited. Summary of the Invention

[0005] In view of the defects in the prior art, the purpose of the present application is to provide an edited pre-miRNA cross-kingdom target control (EPCT) method and application. The present application provides an EPCT gene editing method based on stable and universal RNA fragments with SPMQS characteristics to solve the problems of RNA degradation, poor RNA sequence conservation in different species, and low communication efficiency in the prior art. SPMQS is a long-distance transportable RNA specific sequence, characterized by a short pyrimidine-rich conserved domain, specifically 5'-AGGAGA-3'. The SPMQS characteristics and sequences provided by the present application can directly and efficiently regulate the source-sink plant traits, achieving directional regulation of the sink end, and have broad application prospects.

[0006] To achieve the above purpose, the technical solution adopted by the present application is:

[0007] An EPCT method for editing pre-miRNA cross-kingdom regulation, characterized by,

[0008] The EPCT method is to edit the pre-miRNA of the source plant to form a pre-miRNA with SPMQS characteristics, specifically including:

[0009] Step 1, (1) editing non-crossing pre-miRNA with SPMQS approximate point, and transposing the SPMQS approximate point to SPMQS characteristics;

[0010] Or (2) inserting SPMQS characteristics on the non-crossing pre-miRNA skeleton;

[0011] Step 2, constructing the pre-miRNA with SPMQS characteristics obtained in step 1 to a vector;

[0012] Step 3, obtaining a transgenic source plant by transgenically overexpressing the vector gene obtained in step 2 in the source plant. The transgenic method includes dipping flower method, agrobacterium infection, leaf disc method, etc.

[0013] The SPMQS approximate point in the above step 1 is a fragment similar to the SPMQS characteristics (AGGAGA) in the target sequence, which has the same length as the SPMQS characteristics and can have one to two base differences: such as AGGAGG, AGAAGA, AGGUGU, etc.

[0014] The above step 1 item (1) is illustrated as follows:

[0015] Editing targeted the SPQMS characteristic site of SlTFZ12, a functional gene that regulates tomato ventricle and fruit size traits, and Nt-pre-miR477 b ::[AGGU 99 GU 101 ] is transverted to [AGGA 99 GA 101 ], the full length of the sequence before and after the transversion is shown as SEQ ID NO: 1 and SEQ ID NO: 2, and SEQ ID NO: 2 is constructed into the vector pCAMBIA super1300 On the carrier, the carrier is obtained pCAMBIA super1300- pre-miR477b .

[0016] SEQ ID NO: 1

[0017] 5'-UCCAACCACCCCCAGUCACCUCCGAAGCUCAUCCUCACGCAAAGUUCCUUUUCUUUUUCUAUCUCUCUCCUCGAGAUCCUUCUCUCUUGAAUUCUUGCACUAGAUCGUGAUCCAUUCAUCCAUCUAGUCAAACAA CAAAUGUUUUGUGGAGUUGGAAAUUUGAGAAUGGAAGAUAUAGUGAGGAAUUCGAUAGAGAAAGAUCUCGAGGUGUGAGAGAAGGAACUUUGCGGUCGGUGAGGAUGAGCUUCGGCGGUGACUGGGGUGGUUGGA-3'

[0018] SEQ ID NO: 2

[0019] 5'-UCCAACCACCCCCAGUCACCUCCGAAGCUCAUCCUCACGCAAAGUUCCUUUUCUUUUUCUAUCUCUCUCCUCGAGAUCCUUCUCUCUUGAAUUCUUGCACUAGAUCGUGAUCCAUUCAUCCAUCUAGUCAAACAA CAAAUGUUUUGUGGAGUUGGAAAUUUGAGAAUGGAAGAUAUAGUGAGGAAUUCGAUAGAGAAAGAUCUCGAGGAGAGAGAAGGAACUUUGCGGUCGGUGAGGAUGAGCUUCGGCGGUGACUGGGGUGGUUGGA-3'

[0020] The example of item (2) in step 2 above is as follows:

[0021] Nt-pre-miR47 targeting CeFCQ, a gene involved in the development of dodder haustoria, was designed and inserted into the SPQMS characteristic site (AGGAGA) to become Nt-pre-miR47. CR The full length of the inserted sequences are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively, and constructed into the vector pCAMBIA super1300 On the carrier, the carrier is obtained pCAMBIA super1300- pre- miR47 CR .

[0022] SEQ ID NO: 3

[0023] UAUGCAUUACAGGGCAAGAUCACCAUUGGCAGAGAUCUAUUACUUCAUUCUUGCAUCAUAUGCAUAAAUGUUUGUGGGAGCUCUCUGCCAAUUUGCCCGGUAAUUCUCUU

[0024] SEQ ID NO: 4

[0025] UAUGCAUUACAGGGCAAGAUCACCAUUGGCAGAGAUCUAUUACUUCAUUCUUGCAUCAUAUGCAUAAAUGUUUGUGGUGAGCUCUCUGCCAAAGGAGAUUUGCCCGGUAAUUCUCUU

[0026] The source plants include but are not limited to any one or more of the following: Arabidopsis, tobacco, tomato, and apple.

[0027] On the basis of the above scheme,

[0028] The SPMQS feature is a short pyrimidine-rich conserved domain, specifically 5'-AGGAGA-3'.

[0029] Primers for identifying positive plants treated by the EPCT method according to claim 1, characterized in that the sequences of the primers are shown in SEQ ID NOs: 5-6.

[0030] An application of an EPCT method for editing pre-miRNA cross-border regulation is characterized by: grafting or wrapping a sink-end plant onto a transgenic source-end plant, and cross-border regulating the sink-end plant traits through the source-end plant pre-miRNA with SPMQS characteristics.

[0031] The confluence plant includes but is not limited to any one or more of the following wild-type plants: tomato, dodder, and apple.

[0032] On the basis of the above scheme,

[0033] The plant traits include the number of fruit ventricles, the number of seeds, the number of haustoria, the content of anthocyanin, the flowering time, the fruit yield, etc.

[0034] On the basis of the above scheme,

[0035] Through the edited Nt-pre-miR477 b Regulating the number of fruit ventricles, the edited Nt-pre-miR477 b The sequence is shown in SEQ ID NO: 2 (bp 206 to bp 211 of the sequence shown in SEQ ID NO: 1 are transposed to AGGAGA);

[0036] Through the edited Nt-pre-miR47 CR Regulating the number of haustoria, the edited Nt-pre-miR47 CR The sequence is shown in SEQ ID NO: 4 (AGGAGA is inserted after the 92nd bp of the sequence shown in SEQ ID NO: 3).

[0037] The EPCT method and application of the present invention for editing pre-miRNA cross-border regulation have the following beneficial effects:

[0038] This invention provides an EPCT gene editing method based on a stable, universal RNA segment with SPMQS characteristics, addressing existing issues such as easy RNA degradation, poor RNA sequence conservation across species, and low communication efficiency. The SPMQS characteristics provided by this invention and the source-side plant pre-miRNA sequences edited using them can directly and efficiently regulate source-sink plant traits, achieving targeted regulation at the sink and promising broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] The present invention has the following accompanying drawings:

[0040] Figure 1 Schematic diagram of the pCAMBIA super1300- pre-miR477b transversion vector;

[0041] Figure 2 Schematic diagram of tomato / tobacco grafted plants;

[0042] Figure 3 The results of statistical analysis of the number of ventricles in fruits of tomato / tobacco grafted plants are shown below;

[0043] Figure 4 pCAMBIA super1300-pre-miR47 CRSchematic diagram of the insertion vector;

[0044] Figure 5 A schematic diagram of tobacco dodder wrapped around a plant;

[0045] Figure 6 These are the statistical analysis results of the number of haustoria on tobacco dodder-wrapped plants. DETAILED DESCRIPTION

[0046] To further illustrate the purpose and technical solution of the present invention, the present invention is described in detail below with reference to the following examples, but the present invention is not limited thereto. The experimental equipment, reagents, and materials not otherwise specified in the following examples can all be purchased from commercial channels. The experimental methods not otherwise specified in the following examples are all conventional methods.

[0047] The target genes in the present invention are genes related to regulating the number of fruit ventricles, regulating the number of haustoria, etc.

[0048] The following examples illustrate the technical solution of the present invention by taking the regulation of fruit ventricle number and haustorium number traits by using the pre-miRNA transversion and insertion sequences loaded with SPQMS characteristics as examples.

[0049] Embodiment 1: pCAMBIA super1300- pre-miR477b Can increase the number of fruit ventricles

[0050] 1. Characteristics of SPQMS pre-miR477b Transversion sequence acquisition

[0051] like Figure 1 , the AGGUGU (96-101nt) on Nt-pre-miR477b was transposed to SPMQS (AGGAGA), the sequence is shown in SEQ ID NO: 2, and the full-length sequence was synthesized by an outsourced biological company.

[0052] 2. pCAMBIA super1300-pre-miR477b Vector construction

[0053] (1) The above synthetic gene pre-miR477b and pCAMBIA super1300 The vector was double-digested with HindIII and PstI enzymes at 37°C for 2 h. The reaction system was as follows:

[0054] Element system Fragment or vector 10 μL Enzyme I 1 μL enzyme II 1 μL 10×buffer 2 μL <![CDATA[ddH2O]]> 6 μL Final volume 20 μL

[0055] (2) The digested products were then ligated with T4 DNA ligase at 16°C overnight. The reaction system is shown in the table below. pCAMBIA super1300- pre-miR477b , the carrier diagram is as follows Figure 1 As shown;

[0056] Element system Recycling Fragments 7 μL carrier 1 μL T4 ligase 1 μL 10×T4 buffer 1 μL Final volume 10 μL

[0057] (3) Transform the ligated vector into E. coli Place DH5α competent cells on ice for 20 minutes, heat shock at 42°C for 45 seconds, and place on ice for 2 minutes. Add 200 μL of antibiotic-free LB medium and incubate at 37°C with shaking at 160 rpm for 1 hour. Collect the cells by centrifugation at 4500 rpm for 3 minutes, discard 150 μL of the supernatant, resuspend the cells in the remaining medium, spread evenly on solid LB medium containing Kan resistance, and incubate at 37°C with an inverted plate overnight. The next day, single colonies were picked and incubated in 200 μL of Kan resistance LB medium and incubated at 37°C with shaking at 200 rpm for 6 hours. After colony PCR, positive bacteria were sent for sequencing to select the correct colonies.

[0058] (4) Pick a single clone and shake the bacteria to extract the plasmid;

[0059] (5) Prepare competent cells of Agrobacterium tumefaciens GV3101; streak Agrobacterium on YEP+Rif solid medium and culture at 28°C for 2-3 days; pick a single colony and inoculate it into 5 mL liquid YEP+Rif medium, shake and culture at 28°C and 200 rpm for 12 hours; collect the bacteria at 5000 rpm for 5 minutes, transfer them into 50 mL liquid YEP medium, shake and culture at 28°C and 200 rpm overnight until the OD 600 The value was 0.6-0.8; the cells were collected in a 50 mL centrifuge tube at 5000 rpm for 5 min and the supernatant was discarded; the cells were resuspended in 10 mL of 0.15 M NaCl solution and allowed to stand on ice for 20 min; the cells were collected at 5000 rpm for 5 min at 4°C and the supernatant was discarded; the cells were gently resuspended in 1 mL of pre-cooled 0.02 Mol CaCl2 solution; the cells were aliquoted into pre-cooled 1.5 mL centrifuge tubes, 100 μL per tube, and an equal volume of glycerol was added and stored at -80°C until use.

[0060] (6) Transform Agrobacterium competent cells; pCAMBIA super1300-pre-miR477b Add 1-2 μL of plasmid to 100 μL of competent cells and place on ice for 30 min. Place the competent cells with the plasmid in liquid nitrogen for 1 min. Place in a 37°C metal bath for 5 min. Place on ice for 2 min. Add 500 μL of resistance-free YEP liquid medium and culture at 28°C with shaking at 160 rpm for 4-6 h. Collect the cells at 4000 rpm, remove 300 μL of supernatant, resuspend the remaining bacteria, spread on YFP+Rif+Kan solid medium, and culture overnight at 28°C.

[0061] 3. Tobacco genetic modification

[0062] (1) Take tobacco leaves and rinse them with running water for 2-3 hours;

[0063] (2) In a clean bench, rinse with 75% ethanol for 30 seconds and rinse twice with sterile water;

[0064] (3) Rinse with 2% NaClO for 6 minutes and then rinse with sterile water 5-6 times;

[0065] (4) Cut the leaves along the main vein and on both sides into 0.5 cm × 0.5 cm squares, spread them flat on the pre-culture medium, and culture them at 25 °C under light for 48 h.

[0066] (5) Pick the positive clones of transformed Agrobacterium and inoculate them into 5 mL of YEP liquid medium containing Rif and Kan, and culture them overnight at 28°C and 200 rpm until the OD 600 =0.6-0.8;

[0067] (6) Collect the bacteria at 6000 rpm for 5 min, discard the supernatant, resuspend in 50 ml of YEP liquid medium containing Rif and Kan, and culture at 28℃ and 200 rpm for 3-4 h until the OD 600 =0.6-0.8;

[0068] (7) Collect the bacteria at 6000 rpm for 5 min, discard the supernatant, resuspend in 30 mL of liquid MS medium, and culture at 28°C and 200 rpm for 3-4 h;

[0069] (8) Place the pre-cultured leaf in the bacterial solution and gently shake it for 1 min. Remove it, absorb the excess bacterial solution on sterile filter paper, and return it to the original pre-culture medium and culture it in the dark at 25°C for 48 h.

[0070] (9) Transfer to sterile solid culture medium and continue culturing under light;

[0071] (10) When the regenerated seedlings grow out, cut them and inoculate them into a culture medium containing Cef.

[0072] 4. Identification of transgenic tobacco plants

[0073] Take the leaves of the positive seedlings and extract DNA using the CTAB method as follows:

[0074] (1) Grind the leaves in liquid nitrogen and add 700 μL of CTAB extract containing 0.2% β-mercaptoethanol preheated at 60°C;

[0075] (2) Incubate at 65°C for approximately 30 min, add 700 μL of chloroform:isoamyl alcohol (24:1), and vortex for 15 s.

[0076] (3) Centrifuge at 13,000 rpm for 10 min at room temperature and transfer the supernatant to a new centrifuge tube;

[0077] (4) Add an equal volume of isopropanol, mix thoroughly, and precipitate at -20 °C for more than 30 min;

[0078] (5) Centrifuge at 13,000 rpm for 10 min at room temperature, rinse twice with 70% ethanol, and air dry;

[0079] (6) Add 30 μL ddH2O to dissolve;

[0080] (7) Use specific primers to identify positive plants and extract RNA from positive plants. Specific primers are used to identify RNA-positive plants. The primer sequences are as follows:

[0081] pCAMBIA1300-F (forward identification primer designed on 1300 vector):

[0082] GCCGTCTAGAGTTAGATGGTTAAC (SEQ ID NO: 5);

[0083] pCAMBIA1300-R (reverse identification primer on 1300 vector):

[0084] GCAAGACCGGCAACAGGATTCAATC (SEQ ID NO: 6).

[0085] 5. Tomato / Tobacco Grafting

[0086] (1) Transplant transgenic tobacco and tomato plants of the same size into the soil;

[0087] (2) After one month of growth, use a scalpel blade to remove the top leaves of the rootstock in a flat cut, and then cut the rootstock stem longitudinally to form a 2-3 cm incision downward. Only 1-2 leaves at the top of the scion are retained. The bottom of the scion stem is cut into a wedge shape with a scalpel and inserted into the incision of the rootstock. The grafting interface is tightly wrapped with sealing film (such as Figure 2 shown).

[0088] 6. Counting the number of ventricles in tomato fruits

[0089] Three months after grafting, the number of ventricles in tomato fruits of different grafting combinations was observed. pre-miR477b It can be transferred from tobacco to tomato. The transgenic graft combination has a significantly increased number of ventricles in tomato fruits compared with the wild-type graft combination (e.g. Figure 3 shown).

[0090] Example 2 pCAMBIA super1300- pre-miR47 CR Can increase the number of haustoria

[0091] 1. Characteristics of SPQMS pre-miR477b Insert sequence acquisition

[0092] like Figure 4 , designed Nt-pre-miR47 targeting Ce-FCQ, and inserted it into the SPQMS characteristic site (AGGAGA) to become Nt-pre-miR47 CR The sequence is shown in SEQ ID NO: 4, and the full-length sequence was synthesized by an outsourced biological company.

[0093] Steps 2-4 are the same as in Example 1. Figure 4 shown.

[0094] 5. Tobacco dodder entanglement

[0095] Plant tobacco and dodder together in the same pot, so that the dodder will naturally wrap around the tobacco (such as Figure 5 shown).

[0096] 6. Statistics on the number of dodder haustoria

[0097] After the tobacco dodder was wrapped for 15 days, the number of haustoriae grown in different wrapping combinations was counted. pre-miR47 CR It can be transferred from tobacco to dodder. The transgenic twining combination has a significantly increased number of haustoria compared with the wild type twining combination (such as Figure 6 shown).

[0098] The above examples illustrate a plant source-end cross-kingdom SPQMS feature, whereby pre-miRNAs with this feature can cross the boundary from the source end to the sink end and be processed into miRNAs to exert regulatory functions. Therefore, a series of protection schemes are proposed in this application.

[0099] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to fall within the scope of protection claimed herein.

[0100] The contents not described in detail in this specification belong to the prior art known to those skilled in the art.

Claims

1. An EPCT method for editing pre-miRNA cross-border regulation, characterized in that: The EPCT method is to edit the pre-miRNA of the source plant to form a pre-miRNA with SPMQS characteristics, specifically including: Step 1: (1) edit the non-cross-border pre-miRNA with SPMQS approximate sites and convert the SPMQS approximate sites into SPMQS features; or (2) inserting SPMQS features on the pre-miRNA backbone that does not span the boundary; Step 2, constructing the pre-miRNA with SPMQS characteristics obtained in step 1 into a vector; Step 3, overexpressing the vector gene obtained in step 2 in the source plant by transgenic means to obtain a transgenic source plant; The SPMQS feature is a short pyrimidine-rich conserved domain, specifically 5′-AGGAGA-3′; The SPMQS approximate site described in step 1 (1) is: a fragment in the target sequence that has the same length as the SPMQS feature and has one or two base differences.

2. The use of the EPCT method according to claim 1, characterized in that: The sink plant is grafted or wrapped onto the transgenic source plant, and the sink plant traits are regulated across the boundaries through the source plant pre-miRNA with SPMQS characteristics.

3. The use according to claim 2, characterized in that: The terminal plant traits include: the number of fruit ventricles and the number of haustoria.

4. The use according to claim 3, characterized in that: Through the edited Nt-pre-miR477 b Regulating the number of fruit ventricles, the edited Nt-pre-miR477 b The sequence is shown in SEQ ID NO: 2; after editing, Nt-pre-miR47 CR Regulating the number of haustoria, the edited Nt-pre-miR47 CR The sequence is shown in SEQ ID NO:4.

Images