Biosensor for detecting olfactory labeled protein by using multi-component nuclease and preparation method of biosensor
Through the combination of isothermal self-primer non-component amplification reaction and multi-component nuclease, efficient and sensitive detection of olfactory labeled proteins is achieved, solving the problems of insufficient sensitivity and high cost of existing detection methods, and is suitable for early diagnosis of olfactory dysfunction.
Patent Information
- Application Number
- CN202311651127.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-04
- Publication Date
- 2025-07-08
- Estimated Expiration
- 2043-12-04
AI Technical Summary
The existing olfactory labeled protein detection methods are insufficiently sensitive, cumbersome and costly, making it difficult to meet the needs of fast and simple detection.
A multi-component nuclease biosensor based on isothermal self-primer non-component amplification reaction is used to identify the olfactory marker protein genes through the SPEXPAR reaction, and combine it with the MNAzyme reaction to generate fluorescent signals to achieve efficient and sensitive detection.
It provides a simple operation, low cost and high sensitivity detection method for olfactory marker proteins, suitable for early diagnosis of olfactory dysfunction.
Smart Images

Figure CN120272578A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to a fluorescent biosensor for detecting olfactory marker protein and a preparation method thereof. Background Art
[0002] Smell is an important sense of human beings. Olfactory dysfunction is a disease in which partial or complete decline, loss or abnormality of olfactory function occurs. After the occurrence of olfactory dysfunction, it not only affects the quality of life, social activities, daily work and mental health of patients, but also is a related or early indicator of a series of diseases. It has been found that compared with typical symptoms such as cough, fever and chest tightness, olfactory disorders may be more highly correlated with the detection before the symptoms of novel coronavirus infection, and are more important for the early detection of novel coronavirus. For neurodegenerative diseases that cannot be diagnosed early, olfactory function can reflect the episodic memory ability and medial temporal lobe atrophy of at-risk individuals. Olfactory dysfunction appears earlier than motor symptoms and is related to the progression of the disease. In addition, olfactory disorders may also be the result of diseases such as genetic diseases, sinusitis, nasal polyps, allergies, head trauma and viral infections of the upper respiratory tract. At present, the examination methods for olfactory dysfunction, in addition to relying on the subjective complaints of patients, can also use different types or concentrations of odorants for stimulation, MRI and PET observation, respiratory resistance measurement and olfactory evoked potential detection, etc. Some of these methods rely on the cooperation of patients and are greatly interfered by humans. Some are relatively objective, but are cumbersome to operate and require special instruments, making it difficult to carry out in ordinary hospitals. Selecting a specific olfactory marker gene for molecular detection may be a valuable supplement to the above methods.
[0003] Olfactory marker protein (OMP) is a soluble acidic protein expressed in mature olfactory nerves. By directly capturing cyclic adenosine monophosphate (cAMP), OMP can enhance olfactory responses and regulate olfactory sensitivity and olfactory nerve axon targeting. When OMP is lacking, the basal cAMP concentration will increase, and the difference in basal cAMP levels between ORNs expressing different odorant receptors is eliminated, and thus different odors cannot be distinguished. When the OMP expression level is restored, the ability to perceive odors is also significantly restored. At present, the detection of OMP levels mostly uses immunohistochemistry and fluorescence quantitative PCR methods. These methods are accurate and reliable, but new detection methods with higher sensitivity, rapid and simple operation and low cost are very important for specimens with limited sampling amounts such as olfactory nerves.
[0004] Multicomponent Nucleic Acid Enzyme (MNAzyme) is a multi-nucleic acid molecule aggregate formed by the spontaneous folding of multiple nucleic acid molecules. Although the aggregate does not have protease components, it has the ability to cleave substrate nucleic acid molecules. When a fluorescent group or electroactive molecule binds to the end of the substrate nucleic acid, the biological reaction can be detected by detecting the change in fluorescence signal or electrical signal. The biosensor constructed based on this has been widely used in nucleic acid detection. Traditional MNAzyme reactions require the assembly and folding of multiple nucleic acid sequences, with a complex system composition, high cost, and limited signal amplification efficiency.
[0005] Isothermal Self-Priming Explicit Amplification Reaction (SPEXPAR) is a newly invented isothermal amplification technique in recent years. It does not require the addition of extra primers. The target sequence specifically recognizes and binds to the hairpin molecule, causing a conformational change in the hairpin and undergoing a zipper-sliding-like refolding. Using the hairpin molecule itself as a template, under the action of DNA polymerase and endonuclease, a new nucleic acid fragment extends from the 5' end of the hairpin molecule and is cleaved off. During this process, the target sequence is also released from the hairpin. These released target sequences and the newly synthesized nucleic acid fragments can rebind to the hairpin molecule, continuously promoting this reaction cycle, and ultimately generating a large number of new nucleic acid fragments. The method is ingeniously designed, with a simple system, low cost, and rapid and convenient operation.
[0006] Therefore, the MNAzyme fluorescence biosensor improved based on the SPEXPAR reaction is conducive to the efficient, sensitive, accurate, and rapid detection of the OMP gene. Summary of the Invention
[0007] The purpose of the present invention is to provide a biosensor for detecting olfactory marker protein based on isothermal self-priming non-component amplification reaction using multicomponent nucleic acid enzyme, which has high sensitivity and specificity, is simple, rapid, and inexpensive to operate, and its preparation method.
[0008] The technical solution of the present invention is:
[0009] A biosensor for detecting olfactory marker protein using multicomponent nucleic acid enzyme, characterized in that: the components of the biosensor include: two target sequences OMP1 and / or OMP2 at different sites of the OMP gene, a hairpin molecule D-MH for isothermal amplification reaction, a substrate nucleic acid ssDNA of the multicomponent nuclease complex, DNA polymerase Klenow, endonuclease Nb.BbvCI, substrate dNTP, 10×NEB buffer, and MgCl2 solution.
[0010] A method for preparing a biosensor for detecting olfactory marker protein with a multi-component nuclease, characterized in that: the SPEXPAR isothermal amplification reaction can specifically recognize the OMP genes: OMP1 and OMP2 through its hairpin molecule D-MH, and initiate the isothermal amplification reaction without the action of primers to generate a new nucleotide molecule OMP 1+2; in the SPEXPAR reaction, in addition to the target sequence and the D-MH molecule, DNA polymerase Klenow, endonuclease Nb.BbvCI, substrate dNTP and 10×NEB buffer are also required; the D-MH molecule binds to the avidinylated magnetic beads through the biotin-avidin reaction and is removed from the SPEXPAR reaction product by magnetic adsorption. The D-MH-biotin-avidin magnetic beads can be reused after washing; the newly generated nucleic acid molecule reacts with the ssDNA molecule and the MgCl2 solution in the MNAzyme reaction, undergoes complementation and folding to form a multi-component nuclease complex with cleavage activity, and specifically cleaves the rGrU site on the ssDNA, causing the separation of the fluorescence reporter group and the quenching group modified at both ends of the ssDNA, thereby generating a detectable fluorescence signal.
[0011] The 3' end of the D-MH molecule is biotinylated and connected to the avidinylated magnetic beads through the biotin-avidin reaction. After the SPEXPAR reaction, the D-MH molecule is removed from the reaction product with a magnetic rack, and the D-MH molecule coated on the magnetic beads can be recycled after washing.
[0012] In the SPEXPAR reaction, the final concentrations of D-MH, Klenow, Nb.BbvCI and dNTP are 100 nM, 0.1 U / μl, 0.1 U / μl and 0.25 mM, respectively.
[0013] The SPEXPAR reaction temperature is 37 °C and the SPEXPAR reaction time is 1 h.
[0014] The optimal final concentration of ssDNA is 100 nM, and the final concentration of Mg 2+ is 30 mM; the MNAzyme reaction temperature depends on the Tm value of the nucleic acid molecule, the reaction temperature is 70 °C, and the MNAzyme reaction time is 0.5 h.
[0015] The nucleic acid sequences are as follows:
[0016] OMP 1: 5’TGGAGAGCCTGAAGCAGCGCGGGGAGAAGCGCCAG 3’
[0017] OMP 2: 5’AGCGCCTGTCGGACCTGGCCAAGATCCGCAAGGTC 3’
[0018] D-MH:
[0019] 5’ AGCAGCGGCTTAGCAGTCTACTGTTACTAAAAGCCGCTGCTCCTCAGCTGCGGATCTTGGCCAGGTCCGACAGTAGACTGCTTCTCCCCGCGCTGCTTCAGGCT - Biotin 3’
[0020] ssDNA:
[0021] 5’ FAM - GCTGCGGATCTTGGCCAGGTCCGACrGrUTCTCCCCGCGCTGCTTCAGGCT - BHQ 3’;
[0022] OMP 1 + 2:
[0023] 5’ AGCCTGAAGCAGCGCGGGGAGAAGCAGTCTACTGTCGGACCTGGCCA AGATCCGCAGC 3’.
[0024] SPEXPAR reaction result interpretation: Using non - denaturing polyacrylamide gel electrophoresis at 200V for 60 minutes. After the electrophoresis result is stained with GelRed nucleic acid dye, the electrophoresis products are detected by a gel imager.
[0025] SPEXPAR reaction condition optimization:
[0026] Detect the product band conditions in the reaction systems of D - MH - magnetic beads, DNA polymerase Klenow, endonuclease Nb.BbvCI, and dNTP solution at different concentrations respectively, and find the optimal reaction concentrations of each component. The results show that the optimal final concentrations of D - MH - magnetic beads, Klenow, Nb.BbvCI, and dNTP solution are 100 nM, 0.1 U / μL, 0.1 U / μL, and 0.25 mM respectively.
[0027] According to the temperature requirement of endonuclease Nb.BbvCI, select 37 °C as the SPEXPAR reaction temperature.
[0028] Detect the product band conditions of the SPEXPAR reaction for 0.5 h - 4 h, and select 1 h as the SPEXPAR reaction time.
[0029] MNAzyme reaction result reading: On a fluorescence spectrophotometer, the excitation light source wavelength for detection is 490 nm, and the emission spectrum from 500 - 700 nm is recorded.
[0030] MNAzyme reaction condition optimization:
[0031] Detect the fluorescence intensity of the products in the reaction system of ssDNA and MgCl₂ solutions with different concentrations, and find the optimal concentrations of ssDNA and MgCl₂ solutions. The results show that the optimal final concentration of ssDNA is 100 nM, and the optimal final concentration of MgCl₂ solution is 30 mM.
[0032] Detect the fluorescence intensity of the MNAzyme reaction products at 50 - 80 °C to find the optimal reaction temperature. The reaction temperature depends on the Tm value of the nucleic acid molecules in the reaction. The optimal reaction temperature for this system is 70 °C.
[0033] Detect the fluorescence intensity of the MNAzyme reaction products for 0.5 h - 4 h, and select 0.5 h as the optimal reaction time for MNAzyme.
[0034] Couple SPEXPAR with the MNAzyme reaction:
[0035] Mix the supernatant of the SPEXPAR reaction product with FAM - ss - DNA - BHQ and MgCl₂ solution in proportion for reaction. After the reaction, use a fluorescence spectrophotometer to record the emission spectrum at 500 - 700 nm under an excitation wavelength of 490 nm.
[0036] Methodological evaluation: Conduct methodological evaluations such as specificity, linear range, lowest detection limit, intra - batch and inter - batch repeatability on the established method.
[0037] Compared with the prior art, the beneficial effects of the present invention are as follows: The present invention couples the SPEXPAR isothermal amplification technology with the multi - component nuclease MNAzyme system. The conformation - variable hairpin D - MH molecule recognizes the target sequence OMP, and a large amount of amplification produces a new nucleic acid molecule OMP1 + 2. This nucleic acid molecule can fold and combine with the substrate ssDNA to form an enzyme - active multi - component nucleic acid complex, which cleaves ssDNA, thereby generating a detectable fluorescence signal, and constructs a simple, efficient and sensitive olfactory marker protein detection biosensor. This method provides a new method for the detection of OMP gene.
[0038] The following further illustrates the present invention with reference to the accompanying drawings and embodiments. Description of the Drawings
[0039] Figure 1 It is a schematic diagram of the detection of multi - component nuclease based on isothermal self - priming non - component amplification reaction.
[0040] Figure 2 It is a non - denaturing polyacrylamide gel electrophoresis diagram of the SPEXPAR reaction under different conditions.
[0041] Figure 3 It is a non - denaturing polyacrylamide gel electrophoresis diagram of the SPEXPAR reaction in different groups.
[0042] Figure 4 It is the fluorescence intensity diagram of the MNAzyme reaction under different conditions.
[0043] Figure 5 It is the fluorescence intensity diagram of the MNAzyme reaction in different groups.
[0044] Figure 6 It is the fluorescence intensity diagram of the SPEXPAR-MNAzyme reaction.
[0045] Figure 7 It is the schematic diagram of the specificity detection of the SPEXPAR-MNAzyme reaction.
[0046] Figure 8 It is the schematic diagram of the sensitivity detection of the SPEXPAR-MNAzyme reaction. Detailed implementation manners
[0047] 1. Sequence design and synthesis
[0048] The schematic diagram of the principle of the present invention is shown in Figure 1 . Search for the OMP sequence on pubmed, and select two sites as the target sequences for detection. According to the experimental principle and these two sequences, design the corresponding D-MH hairpin molecules, design the substrate nucleic acid sequence that can be complementary to it according to the SPEXPAR product sequence, and add the fluorescent reporter group FAM and the quenching group BHQ at both ends respectively. The sequences used in the present invention are as follows:
[0049] OMP 1 5’TGGAGAGCCTGAAGCAGCGCGGGGAGAAGCGCCAG 3’
[0050] OMP 2 5’AGCGCCTGTCGGACCTGGCCAAGATCCGCAAGGTC 3’
[0051] D-MH
[0052] 5’AGCAGCGGCTTAGCAGTCTACTGTTACTAAAAGCCGCTGCTCCTCAGCTGCGGATCTTGGCCAGGTCCGACAGTAGACTGCTTCTCCCCGCGCTGCTTCAGGCT-biotin 3’
[0053] ssDNA:
[0054] 5’FAM-GCTGCGGATCTTGGCCAGGTCCGACrGrUTCTCCCCGCGCTGCTTCAGGCT-BHQ 3’
[0055] 2. Preparation of D-MH Magnetic Beads
[0056] Connection of D-MH to magnetic beads: Vortex the magnetic bead bottle for 20 s to resuspend the magnetic beads. Pipette 20 μl of magnetic beads into a new centrifuge tube. Place the centrifuge tube on a magnetic separator and let it stand for 1 min (this operation will be abbreviated as magnetic separation hereafter). Aspirate the supernatant and remove the centrifuge tube from the magnetic separator. Add 1 mL of Buffer I (10 mM Tris-HCl (pH 7.5), 1 mM EDTA, 1 M NaCl, 0.01% - 0.1% Tween-20). After resuspending by oscillation and magnetic separation, remove the supernatant and repeat this operation once. Add 100 μL of biotinylated nucleic acid diluted with Buffer I (to make the magnetic bead concentration 2 mg / mL). Resuspend by oscillation and mix by rotation at room temperature for 30 min. After 30 min, perform magnetic separation, wash the magnetic beads three times with Buffer I solution, and add 100 μL of DEPC water to resuspend the magnetic beads to complete the connection reaction of D-MH-biotin and avidinylated magnetic beads.
[0057] 3. Optimization of SPEXPAR Reaction Conditions
[0058] The SPEXPAR reaction system consists of D-MH magnetic beads, DNA polymerase Klenow, endonuclease Nb.BbvCI, dNTP solution, 10× NEB buffer, and target sequences OMP1 and / or OMP2.
[0059] When the concentrations of target sequences OMP1 and / or OMP2, DNA polymerase Klenow, endonuclease Nb.BbvCI, and dNTP solution are fixed, and the concentrations of D-MH magnetic beads are 1 μM, 100 nM, and 10 nM respectively, the band conditions of SPEXPAR products are detected. It is found that when the final concentration of D-MH magnetic beads is 100 nM, the target product band is the brightest and the background bands are the fewest. Select 100 nM as the final concentration of D-MH magnetic beads ( Figure 2 A).
[0060] When the concentrations of target sequences OMP1 and / or OMP2, D-MH magnetic beads, endonuclease Nb.BbvCI, and dNTP solution are fixed, and DNA polymerase Klenow is 0.2 U / μL, 0.1 U / μL, and 0.05 U / μL respectively, the band conditions of SPEXPAR products are detected. Considering both economy and product band conditions, select 0.1 U / μL as the optimized final concentration of Klenow DNA polymerase ( Figure 2 B).
[0061] Detect the SPEXPAR product banding patterns when the concentrations of the target sequences OMP1 and / or OMP2, D-MH beads, DNA polymerase Klenow, and dNTP solution are fixed, and the endonuclease Nb.BbvCI is 0.2 U / μL, 0.1 U / μL, and 0.05 U / μL respectively. Considering both economy and product banding patterns, select 0.1 U / μL as the optimized final concentration of the endonuclease Nb.BbvCI.
[0062] Detect the SPEXPAR product banding patterns when the concentrations of the target sequences OMP1 and / or OMP2, D-MH beads, DNA polymerase Klenow, and endonuclease Nb.BbvCI are fixed, and the dNTP solution is 2.5 mM, 1.25 mM, 0.625 mM, and 0.25 mM respectively. Considering both economy and product banding patterns, select 0.25 mM as the optimized final concentration of the dNTP solution( Figure 2 B).
[0063] Take 1 μL of 10 μM OMP 1 and / or OMP 2, 1 μL of 1 μM D-MH beads, 1 μL of 1 U / μL Klenow DNA polymerase, 1 μL of 1 U / μL endonuclease Nb.BbvCI, 1 μL of 2.5 mM dNTP solution, and 1 μL of 10× NEB buffer. Make up to a total volume of 10 μL with 3 μL of H2O, mix well, react at 37°C for 0.5 h - 4 h, observe the product banding patterns, and select 1 h as the shortest reaction time for SPEXPAR.
[0064] 4. Interpretation of SPEXPAR reaction results
[0065] Take 1 μL of 10 μM OMP 1 and / or OMP 2, 1 μL of 1 μM D-MH beads, 1 μL of 1 U / μL Klenow DNA polymerase, 1 μL of 1 U / μL endonuclease Nb.BbvCI, 1 μL of 2.5 mM dNTP solution, and 1 μL of 10× NEB buffer. Make up to a total volume of 10 μL with 3 μL of H2O, mix well, react at 37°C for 1 h, perform non-denaturing polyacrylamide gel electrophoresis at 200 V for 60 min. Take 15 μL of the GelRed nucleic acid dye 10,000× stock solution and 5 mL of 1 M NaCl and add to 45 mL of H2O to obtain the non-denaturing polyacrylamide gel staining solution. Stain the non-denaturing polyacrylamide gel by the soaking method for 30 min, and observe the banding patterns with a gel imager. The results show that compared with other groups, the target-sized bands are generated only when all components in the system are present( Figure 3 A), and whether OMP 1, OMP 2 is present alone or simultaneously, it can lead to the generation of target-sized bands( Figure 3 B).
[0066] 5. Optimization of MNAzyme Reaction Conditions
[0067] The MNAzyme reaction system consists of the OMP 1+2 sequence, ssDNA, and MgCl2 solution.
[0068] When the concentrations of OMP 1+2 and MgCl2 solution were fixed and the concentrations of ssDNA were 100 nM, 10 nM, and 1 nM respectively, the fluorescence intensity (FL) of the reaction products was detected. It was found that when the final concentration of ssDNA was 100 nM, a relatively obvious FL peak could be generated. Therefore, 100 nM was selected as the optimized final concentration of ssDNA( Figure 4 A).
[0069] When the concentrations of OMP 1+2 and ssDNA were fixed and the final concentrations of MgCl2 solution were 40 mM, 30 mM, 20 mM, 10 mM, 5 mM, and 2.5 mM respectively, the FL of the reaction products was detected. It was found that when the final concentration of MgCl2 solution was 30 mM, the FL value was the largest. Therefore, 30 mM was selected as the optimized final concentration of MgCl2 solution( Figure 4 B).
[0070] Take 1 μL of 10 μM OMP 1+2, 1 μL of 1 μM ssDNA, and 3 μL of 100 mM MgCl2 solution, and make up to a total volume of 10 μL with 5 μL of H2O. Mix well and react in the dark at 55 - 75 °C for 4 h. Detect the FL of the reaction products. It was found that when the reaction temperature was 70 °C, the FL reached the peak. Therefore, 70 °C was selected as the optimal reaction temperature( Figure 4 C).
[0071] Take 1 μL of 10 μM OMP 1+2, 1 μL of 1 μM ssDNA, and 3 μL of 100 mM MgCl2 solution, and make up to a total volume of 10 μL with 5 μL of H2O. Mix well and react in the dark at 70 °C for 0.5 - 5 h. Detect the FL of the reaction products. It was found that the FL reached the maximum at 0.5 h and then did not increase. Therefore, 0.5 h was selected as the optimal reaction time( Figure 4 D).
[0072] Take 1 μL of 10 μM OMP 1+2, 1 μL of 1 μM ssDNA, and 3 μL of 100 mM MgCl2 solution, and make up to a total volume of 10 μL with 5 μL of H2O. Mix well and react in the dark at 70 °C for 0.5 h. After the reaction, add 200 μL of H2O, mix well, and detect the emission spectrum values at an excitation light source wavelength of 490 nm and 500 - 700 nm on a fluorescence spectrophotometer. The results showed that a significant fluorescence intensity peak was generated only when all components in the MNAzyme system were present( Figure 5 ).
[0073] 6. Coupling of SPEXPAR and MNAzyme reaction
[0074] Take 1 μL of 10 μM OMP 1 and / or OMP 2, 1 μL of 1 μM D-MH magnetic beads, 1 μL of 1 U / μL Klenow DNA polymerase, 1 μL of 1 U / μL endonuclease Nb.BbvCI, 1 μL of 2.5 mM dNTP solution, and 1 μL of 10× NEB buffer. Make up to a total volume of 10 μL with 3 μL of H2O. Mix well and react at 37 °C for 1 h. After the reaction, remove the D-MH magnetic beads on a magnetic stand. Pipette 10 μL of the reaction supernatant, 10 μL of 1 μM ssDNA, and 3 μL of 1 M MgCl2 solution. Make up to a total volume of 100 μL with 77 μL of H2O. Mix well and react in the dark at 70 °C for 0.5 h. After the reaction, add 100 μL of H2O, mix well, and then, on a fluorescence spectrophotometer, measure the emission spectrum values at an excitation light source wavelength of 490 nm in the range of 500 - 700 nm. The results show that a significantly increased fluorescence peak will be generated after the combination of the two methods ( Figure 6 ).
[0075] 7. Methodology evaluation
[0076] ①Specificity detection: Synthesize nucleic acid sequences NC 1, NC 2, and NC 3 that are mismatched with OMP 1 and OMP 2 by 1 or 2 bases respectively,
[0077] NC 1 5’TGGAGAGCCTGAAGCAGTGCGGGGAGAAGCGCCAG 3’
[0078] NC 2 5’AGCGCCTGTCGGACCTGGCCGAGATCCGCAAGGTC 3’
[0079] NC 3 5’TGGAGAGCCTGAAGCAGTACGGGGAGAAGCGCCAG 3’
[0080] Detect the fluorescence intensities of OMP 1 and OMP 2 at 5 μM, OMP 1 and OMP 2 at 100 nM, NC 1 at 10 μM, NC 2 at 10 μM, and NC 3 at 10 μM respectively using the SPEXPAR combined with MNAzyme method. Take 1 μL of the test sequence, 1 μL of 1 μM D-MH magnetic beads, 1 μL of 1 U / μL Klenow DNA polymerase, 1 μL of 1 U / μL endonuclease Nb.BbvCI, 1 μL of 2.5 mM dNTP solution, and 1 μL of 10× NEB buffer, and make up to a total volume of 10 μL with 3 μL of H2O. Mix well and react at 37 °C for 1 h. After the reaction, remove the D-MH magnetic beads on a magnetic stand, pipette 10 μL of the reaction supernatant, add 10 μL of 1 μM ssDNA and 3 μL of 1 M MgCl2 solution, and make up to a total volume of 100 μL with 77 μL of H2O. Mix well and react in the dark at 70 °C for 0.5 h. After the reaction, add 100 μL of H2O, mix well, and on a fluorescence spectrophotometer, detect the emission spectrum values at an excitation light source wavelength of 490 nm and 500 - 700 nm. The results show that the present invention has good specificity( Figure 7 ).
[0081] ② Detection of linear range: Dilute OMP 1 and OMP 2 into solutions of 10 μM, 1 μM, 100 nM, 10 nM, 1 nM, 100 pM, 10 pM, and 1 pM respectively. Take 1 μL of each of the above-concentration test sequences, 1 μL of 1 μM D-MH magnetic beads, 1 μL of 1 U / μL Klenow DNA polymerase, 1 μL of 1 U / μL endonuclease Nb.BbvCI, 1 μL of 2.5 mM dNTP solution, and 1 μL of 10× NEB buffer, and make up to a total volume of 10 μL with 3 μL of H2O. Mix well and react at 37 °C for 1 h. After the reaction, remove the D-MH magnetic beads on a magnetic stand, pipette 10 μL of the reaction supernatant, add 10 μL of 1 μM ssDNA and 3 μL of 1 M MgCl2 solution, and make up to a total volume of 100 μL with 77 μL of H2O. Mix well and react in the dark at 70 °C for 0.5 h. After the reaction, add 100 μL of H2O, mix well, and on a fluorescence spectrophotometer, detect the emission spectrum values at an excitation light source wavelength of 490 nm and 500 - 700 nm. The results show that as the concentration of the target sequence increases, the fluorescence intensity value gradually increases( Figure 8 A). Using the fluorescence intensity value FL at a wavelength of 522 nm as the ordinate and log(sample concentration) as the abscissa, plot the regression equation. The results show that the present invention example has good linearity in the range of 100 nM - 1 pM, and the linear equation is Y = 302.08X + 1467.6, R 2 = 0.9975( Figure 8 B).
[0082] ③ Without adding the sequence to be detected, take 1 μL of 1 μM D-MH magnetic beads, 1 μL of 1 U / μL Klenow DNA polymerase, 1 μL of 1 U / μL endonuclease Nb.BbvCI, 1 μL of 2.5 mM dNTP solution, and 1 μL of 10× NEB buffer, make up to a total volume of 10 μL with 5 μL of H2O, mix well, react at 37 °C for 1 h. After the reaction, remove the D-MH magnetic beads on a magnetic rack, pipette 10 μL of the reaction supernatant, add 10 μL of 1 μM ssDNA and 3 μL of 1 M MgCl2 solution, make up to a total volume of 100 μL with 77 μL of H2O, mix well, react in the dark at 70 °C for 0.5 h. After the reaction, add 100 μL of H2O, mix well, and on a fluorescence spectrophotometer, measure the emission spectrum values at 500 - 700 nm with an excitation light source wavelength of 490 nm, measure the FL of the blank sample, repeat 10 times, calculate the standard deviation (N) of the FL of the blank sample, and calculate the lowest detection limit according to the lowest detection limit (LOD) formula LOD = 3N / S (S is the slope in the linear regression equation). The lowest detection limit of this example of the present invention is 1.06 pM.
[0083] It should be noted that the preparation method described in this embodiment can also be used to construct a fluorescence biosensor for detecting other sites of the OMP gene or other genes based on isothermal self-priming non-component amplification reaction.
[0084] The above are only the embodiments of the present invention, and do not limit the patent scope of the present invention accordingly. Any equivalent structural or equivalent process transformation made by using the content of the specification and drawings of the present invention, or directly or indirectly applied in other related technical fields, shall be included in the patent protection scope of the present invention by the same token.
Claims
1. A biosensor for detecting olfactory marker protein with a multi-component nuclease, characterized in that: The components of the biosensor include: two target sequences OMP1 and / or OMP2 at different sites of the OMP gene, a hairpin molecule D-MH for isothermal amplification reaction, a substrate nucleic acid ssDNA of a multi-component nuclease complex, DNA polymerase Klenow, endonuclease Nb.BbvCI, substrate dNTP, 10× NEB buffer, and MgCl2 solution.
2. A method for preparing a biosensor for detecting olfactory marker protein with a multi-component nuclease, characterized in that: The SPEXPAR isothermal amplification reaction can specifically recognize the OMP gene: OMP1 and OMP2 through its hairpin molecule D-MH, and initiate the isothermal amplification reaction without the action of primers, generating a new nucleotide molecule OMP 1+2; in the SPEXPAR reaction, in addition to the target sequence and D-MH molecule, DNA polymerase Klenow, endonuclease Nb.BbvCI, substrate dNTP, and 10× NEB buffer are also required; the D-MH molecule binds to avidin-coated magnetic beads through a biotin-avidin reaction and is removed from the SPEXPAR reaction product by magnetic adsorption. The D-MH-biotin-avidin magnetic beads can be reused after washing; the newly generated nucleic acid molecule reacts with the ssDNA molecule and MgCl2 solution in a MNAzyme reaction, undergoes complementation and folding to form a multi-component nuclease complex with cleavage activity, and specifically cleaves the rGrU site on the ssDNA, causing the separation of the fluorescence reporter group and quenching group modified at both ends of the ssDNA, thereby generating a detectable fluorescence signal.
3. The preparation method of the multi-component nuclease-based biosensor for detecting olfactory marker protein according to claim 2, characterized in that: The 3' end of the D-MH molecule is biotinylated and connected to avidin-coated magnetic beads through a biotin-avidin reaction. After the SPEXPAR reaction, the D-MH molecule is removed from the reaction product using a magnetic stand. The D-MH molecule coated on the magnetic beads can be recycled after washing.
4. The preparation method of the multi-component nuclease-based biosensor for detecting olfactory marker proteins according to claim 2, characterized in that: In the SPEXPAR reaction, the final concentrations of D-MH, Klenow, Nb.BbvCI, and dNTP are 100 nM, 0.1 U / μl, 0.1 U / μl, and 0.25 mM, respectively.
5. The preparation method of the multi-component nuclease-based biosensor for detecting olfactory marker protein according to claim 2, wherein: The temperature of the SPEXPAR reaction is 37 °C, and the reaction time of the SPEXPAR reaction is 1 h.
6. The preparation method of the multi-component nuclease-based biosensor for detecting olfactory marker protein according to claim 2, characterized in that: The optimal final concentration of ssDNA is 100 nM, and the final concentration of Mg 2+ is 30 mM; the reaction temperature of MNAzyme depends on the Tm value of the nucleic acid molecule, the reaction temperature is 70 °C, and the reaction time of MNAzyme is 0.5 h.
7. The preparation method of the multi-component nuclease-based biosensor for detecting olfactory marker protein according to claim 2, characterized in that: The nucleic acid sequences are as follows: OMP 1: 5’TGGAGAGCCTGAAGCAGCGCGGGGAGAAGCGCCAG 3’ OMP 2: 5’AGCGCCTGTCGGACCTGGCCAAGATCCGCAAGGTC 3’ D-MH: 5’AGCAGCGGCTTAGCAGTCTACTGTTACTAAAAGCCGCTGCTCCTCAGCTGCGGATC TTGGCCAGGTCCGACAGTAGACTGCTTCTCCCCGCGCTGCTTCAGGCT-biotin 3’ ssDNA: 5’FAM-GCTGCGGATCTTGGCCAGGTCCGACrGrUTCTCCCCGCGCTGCTTCAG GCT-BHQ 3’.
Citation Information
Patent Citations
Detection method for multi-genotyping based on isothermal signal amplification of nuclease and hairpin DNA (deoxyribonucleic acid) probe
CN103215366A
Expression of functional human olfactory cyclic nucleotide gated (CNG)channel in recombinant host cells and use thereof in cell based assays to identify smell modulators
CN1541223A
Magnetic bead technology system for amplifying signal of nucleic acid detection based on crispr technology, and use thereof
WO2022033607A2