A cluster of miR-19899 biomarkers for lipid metabolism-related diseases and their applications

Abstract

This invention belongs to the field of biodetection technology, specifically relating to a lipid metabolism-related disease biomarker, the miR-19899 cluster, and its applications. The miR-19899 cluster, a lipid metabolism-related disease biomarker provided by this invention, includes miR-19899, ​​the nucleotide sequence of which is shown in SEQ ID NO:1. This invention has found that the microRNA of the miR-19899 cluster is significantly downregulated in Alzheimer's disease, and the miR-19899 cluster can serve as a biomarker for AD, used for the detection and / or treatment of AD.

Description

Technical Field

[0001] This invention belongs to the field of biodetection technology, specifically relating to a lipid metabolism-related disease biomarker cluster miR-19899 and its applications. Background Technology

[0002] Alzheimer's disease (AD) is a progressive neurodegenerative disease with insidious onset and a high degree of age-related progression. The clinical features of AD include cognitive decline, particularly in learning and memory. The pathological mechanisms of AD are complex, primarily involving extracellular senile plaques formed by amyloid protein aggregation and intracellular neurofibrillary tangles formed by tau protein hyperphosphorylation. Due to the complexity and lack of clarity regarding the pathological mechanisms of AD, and the absence of reliable biomarkers and effective drug targets, the diagnosis and treatment of AD face significant challenges. Currently, AD diagnosis relies mainly on neuropsychological testing, supplemented by humoral pathological marker examinations. However, these diagnostic methods lack sensitivity, specificity, accuracy, and adaptability. Furthermore, the efficacy of anti-AD drugs currently in clinical use or under investigation is limited, failing to slow or cure disease progression. Therefore, seeking reliable diagnostic biomarkers and drug intervention targets for AD is a pressing scientific problem that needs to be solved in the prevention and treatment of AD.

[0003] Lipids are a major component of brain tissue, accounting for more than 50% of its dry weight, making the brain the second most lipid-rich organ after adipose tissue. Studies have shown that the levels of unsaturated fatty acids in the brain tissue, cerebrospinal fluid, and plasma of Alzheimer's disease (AD) patients are decreased. As a key component of brain lipids, changes in the content and composition of fatty acids can significantly affect neurological function and even lead to neurological dysfunction. Therefore, whether microRNAs (miRNAs) regulate fatty acid metabolism in brain tissue in the context of AD has become a new direction for research into the pathogenesis and development of AD.

[0004] miRNAs are an important class of endogenous molecules whose expression exhibits significant tissue specificity and temporality, regulating the expression levels of key genes and influencing disease progression. Familial Alzheimer's disease (AD) and... PSEN1 , PSEN2 , APPLipid-related diseases, such as Alzheimer's disease (AD), are closely related to gene mutations, allowing for early diagnosis and intervention through genotyping. However, effective therapeutic targets and agents are lacking for lipid-related diseases, particularly AD, and research on the immune regulatory mechanisms of non-coding genes is still in its early stages. Based on the multi-targeting nature of miRNAs, miRNA-mediated epigenetic regulatory mechanisms hold promise for intervening in lipid metabolism at the upstream gene level by modulating complex and interactive lipid metabolism signaling pathway networks. Therefore, discovering novel gene biomarkers for AD and identifying new targets regulating lipid metabolism at the gene level is of great significance for curing AD and other chronic diseases caused by lipid metabolism. Summary of the Invention

[0005] The purpose of this invention is to provide a biomarker for lipid metabolism-related diseases, the miR-19899 cluster, and its applications. By designing an early detection kit, it can effectively diagnose and / or treat lipid metabolism-related diseases, determine disease outcomes, and improve patients' quality of life.

[0006] A biomarker for lipid metabolism-related diseases, the miR-19899 cluster, comprising miR-19899, ​​the nucleotide sequence of which is shown in SEQ ID NO:1.

[0007] The present invention also provides the use of substances of the miR-19899 cluster as described above in the preparation of a kit having one or more functions in the detection, diagnosis and treatment monitoring of lipid metabolism-related diseases; wherein the treatment monitoring includes condition monitoring during treatment and prognostic monitoring.

[0008] The present invention also provides the use of the miR-19899 cluster or substances overexpressing the miR-19899 cluster as described above in the preparation of medicaments for the prevention and / or treatment of lipid metabolism-related diseases.

[0009] Preferably, the lipid metabolism-related diseases include Alzheimer's disease.

[0010] Preferably, the drug comprises one or both of 1) to 2):

[0011] 1) Inhibit microglia Rock2 / Plin4 Signaling pathways and drugs that reduce lipid accumulation; the lipids include lipid droplets, triglycerides, and cholesterol;

[0012] 2) Drugs that promote lipid metabolism; the lipids include lipid droplets, triglycerides and cholesterol.

[0013] The present invention also provides a medicament for treating lipid metabolism-related diseases, wherein the active ingredient of the medicament includes the miR-19899 cluster as described above or a substance that overexpresses the miR-19899 cluster.

[0014] The present invention also provides a primer set for detecting the miR-19899 cluster as described above, the primer set comprising a reverse transcription primer, an upstream primer, and a downstream primer;

[0015] The reverse transcription primers comprise nucleotide sequences as shown in SEQ ID NO:2;

[0016] The upstream primer comprises a nucleotide sequence as shown in SEQ ID NO:3;

[0017] The downstream primer comprises a nucleotide sequence as shown in SEQ ID NO:4.

[0018] The present invention also provides the application of the primer set described above in the preparation of a kit with one or more functions in the detection, diagnosis and treatment monitoring of lipid metabolism-related diseases;

[0019] The treatment status monitoring includes status monitoring during the treatment process and prognosis monitoring.

[0020] The present invention also provides a screening kit for lipid metabolism-related diseases, the kit comprising the primer set as described above.

[0021] The beneficial effects of this invention are as follows:

[0022] The miR-19899 cluster, a biomarker for lipid metabolism-related diseases provided by this invention, includes miR-19899, ​​the nucleotide sequence of which is shown in SEQ ID NO:1. Through detection in AD model cells, AD model animals, and clinical blood samples, this invention has found that the microRNA expression of the miR-19899 cluster is significantly downregulated in Alzheimer's disease, and the miR-19899 cluster can serve as a biomarker for detecting AD.

[0023] Furthermore, this invention utilizes laser confocal microscopy, Western blotting, dual-luciferase reporter assays, and gene function gain and knockout experiments to conduct an in-depth and systematic study of the function of miR-19899. The study found that miR-19899 can alleviate lipid accumulation in microglia and reduce pro-inflammatory cell phenotypes; downregulation of miR-19899 expression induces microglia to exhibit both lipid accumulation and inflammatory phenotypes. Rock2 / Plin4Activation of the signaling pathway induces lipid accumulation in microglia, promoting inflammatory responses. Therefore, overexpression or restoration of miR-19899 can inhibit lipid accumulation in microglia, improve the inflammatory pathological process of Alzheimer's disease (AD), and effectively prevent and treat AD. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0025] Figure 1 A heatmap showing the expression level of the miR-19899 cluster in the cerebral cortex of 5×FAD mice detected by high-throughput sequencing of miRNAs.

[0026] Figure 2 To detect the expression level of miR-19899 in APPswe cells of an AD neural cell model at different time points after copper ion treatment by qRT-PCR;

[0027] Figure 3 To detect the expression level of miR-19899 in a neuroinflammatory cell model after LPS treatment of microglia by qRT-PCR;

[0028] Figure 4 The results of qRT-PCR detection of miR-19899 expression levels in the cerebral cortex of animal models, including 5×FAD mice and WT mice;

[0029] Figure 5 The results of qRT-PCR detection of miR-19899 expression levels in hippocampal brain tissue of animal models, including 5×FAD mice and WT mice;

[0030] Figure 6 To detect the expression level of miR-19899 in the plasma of AD patients and age-matched healthy volunteers (HAVs) using qRT-PCR;

[0031] Figure 7 ROC curve analysis was performed to assess the diagnostic predictive value of miR-19899 in AD patients;

[0032] Figure 8 The results of qRT-PCR detection of miR-19899 expression levels in different tissues of WT mice;

[0033] Figure 9 To detect changes in lipid droplet levels in resting and activated microglia under miR-19899 downregulation using laser confocal microscopy;

[0034] Figure 10Representative images for detecting changes in lipid droplets in resting and activated microglia under miR-19899 downregulation using laser confocal microscopy;

[0035] Figure 11 To detect changes in lipid droplets in resting and activated microglia upregulated by miR-19899 using laser confocal microscopy;

[0036] Figure 12 Representative images for detecting changes in lipid droplets in resting and activated microglia with miR-19899 upregulation using laser confocal microscopy;

[0037] Figure 13 The results of KEGG pathway enrichment analysis of potential binding targets of miR-19899 using bioinformatics software;

[0038] Figure 14 To utilize online software to perform KEGG pathway enrichment analysis on potential binding targets predicted by miR-19899;

[0039] Figure 15 A schematic diagram showing the results of GO analysis of potential binding targets predicted by miR-19899 using online software;

[0040] Figure 16 qRT-PCR was used to detect the downregulation of APPswe cells by miR-19899 overexpression. Rock2 The expression;

[0041] Figure 17 qRT-PCR was used to detect the downregulation of APPswe cells by miR-19899 overexpression. Plin4 The expression;

[0042] Figure 18 To detect microglia in a resting (unactivated) state with downregulated miR-19899 expression using qRT-PCR Rock2 Express;

[0043] Figure 19 To detect microglia in a resting (unactivated) state with downregulated miR-19899 expression using qRT-PCR Plin4 Express;

[0044] Figure 20 Dual-luciferase reporter assay for miR-19899 and target genes Rock2 The combination of the 3'UTR;

[0045] Figure 21 Dual-luciferase reporter assay for miR-19899 and target genes Plin4 The combination of 3'UTR. Detailed Implementation

[0046] This invention provides a miR-19899 cluster, a biomarker for lipid metabolism-related diseases, wherein the miR-19899 cluster includes miR-19899, ​​and the nucleotide sequence of miR-19899 is shown in SEQ ID NO:1.

[0047] SEQ ID NO: 1: 5'-UGACUCUCAUUCCUUUCUGUAGU-3';

[0048] As one implementation, the miR-19899 cluster described in this invention includes, but is not limited to, miR-19899. Genes with sequences similar to miR-19899 are all within the scope of protection of this invention. For example, any one of the following—a modified derivative of miR-19899, ​​a microRNA of 18-26 nt in length, or a microRNA or a modified derivative of the microRNA—can serve as a biomarker for lipid metabolism-related diseases. miR-19899 should not be construed as representing the entire scope of protection of this invention. As one implementation, the lipid metabolism-related disease described in this invention is Alzheimer's disease.

[0049] This invention uses 7-month-old transgenic mice stably transfected with the 5×FAD gene and wild-type mice as experimental subjects. It utilizes a high-throughput, high-accuracy, and low-cost next-generation sequencing technology based on bridge PCR combined with sequencing-by-synthesis to perform high-throughput genomics expression profiling. RNA was extracted from mouse brain tissue using the Trizol method, isolated, and a sequencing gene library was constructed. miR-19899, ​​with distinct characteristic changes and a novel sequence, was identified. miR-19899 expression was downregulated in the brain tissue of 5×FAD mice of different ages. Furthermore, this invention uses qRT-PCR technology for reverse transcription and real-time quantitative PCR to detect the downregulated expression of miR-19899 in AD model cells, AD model animals, and the serum of AD patients. The miR-19899 cluster is associated with AD and can serve as a biomarker for AD diagnosis.

[0050] This invention also provides the application of substances detecting the miR-19899 cluster as described above in the preparation of kits with one or more functions for the detection, diagnosis, and monitoring of treatment status in lipid metabolism-related diseases; the monitoring of treatment status includes monitoring of status during treatment and prognostic monitoring. As one embodiment, the lipid metabolism-related diseases include Alzheimer's disease.

[0051] This invention uses the miR-19899 cluster as a detection target. By measuring the expression of the miR-19899 cluster in samples, it can screen and diagnose lipid metabolism-related diseases, monitor the condition of people with lipid metabolism-related diseases after treatment, and enrich the diagnostic markers for Alzheimer's disease.

[0052] This invention also provides the use of the miR-19899 cluster as described above, or substances overexpressing the miR-19899 cluster, in the preparation of medicaments for the prevention and / or treatment of lipid metabolism-related diseases. As one embodiment, the lipid metabolism-related diseases include Alzheimer's disease. This invention, by overexpressing miR-19899 or restoring miR-19899 expression, can reduce the pathological progression of lipid accumulation in Alzheimer's disease (AD), effectively preventing and treating lipid metabolism-related diseases, including AD.

[0053] In one embodiment, the drug comprises one or both of 1) to 2):

[0054] 1) Inhibit microglia Rock2 / Plin4 Signaling pathways and drugs that reduce lipid accumulation; the lipids include lipid droplets, triglycerides, and cholesterol;

[0055] 2) Drugs that promote lipid metabolism; the lipids include lipid droplets, triglycerides and cholesterol.

[0056] In one implementation, the active ingredient includes small molecule drugs, nucleic acid drugs, and / or antibody drugs.

[0057] The present invention also provides a medicament for treating lipid metabolism-related diseases, wherein the active ingredient of the medicament includes the miR-19899 cluster as described above or a substance overexpressing the miR-19899 cluster.

[0058] The present invention also provides a primer set for detecting the miR-19899 cluster as described above, the primer set comprising a reverse transcription primer, an upstream primer, and a downstream primer;

[0059] The reverse transcription primers comprise nucleotide sequences as shown in SEQ ID NO:2;

[0060] SEQ ID NO: 2: 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACTACA-3';

[0061] The upstream primer comprises a nucleotide sequence as shown in SEQ ID NO:3;

[0062] The downstream primer comprises a nucleotide sequence as shown in SEQ ID NO:4.

[0063] Forward primer (SEQ ID NO:3): 5'-CCTGCTGGTGACTCTCATTCCTT-3';

[0064] Reverse primer (SEQ ID NO:4): 5'-ATCCAGTGCAGGGTCCGAGG-3'.

[0065] The present invention also provides the application of the primer set in the preparation of a kit with one or more functions in the detection, diagnosis and treatment monitoring of lipid metabolism-related diseases; the treatment monitoring includes condition monitoring and prognosis monitoring during treatment.

[0066] The present invention also provides a screening kit for lipid metabolism-related diseases, the kit comprising the primer set as described above.

[0067] This invention, based on the discovery that the miR-19899 cluster can serve as a biomarker for Alzheimer's disease, can also be used as a molecular therapeutic target for developing drugs to treat lipid metabolism-related diseases. In-depth and systematic research on the function of the microRNA of the miR-19899 cluster revealed that downregulation of the miR-19899 cluster can induce activation of lipid-accumulating microglia, activating... Rock2 / Plin4 This invention regulates the expression of lipid metabolism-related molecular markers in microglia, promoting lipid accumulation. Downregulation of microRNA expression in the miR-19899 cluster activates microglia, leading to lipid accumulation and promoting inflammatory responses. Therefore, overexpression or restoration of miR-19899 expression can reduce the pathological progression of lipid accumulation and effectively prevent and treat Alzheimer's disease. This invention reveals the relationship between the miR-19899 cluster and Alzheimer's disease, providing a potential new target for reducing lipid accumulation. It addresses the lack of diagnostic markers for Alzheimer's disease at the gene level in existing technologies and helps to resolve the current lack of effective therapeutic targets for lipid metabolism, including Alzheimer's disease.

[0068] To further illustrate the present invention, the miR-19899 cluster of lipid metabolism-related disease biomarkers and its applications are described in detail below with reference to the accompanying drawings and embodiments. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0069] Unless otherwise specified, the methods described in this invention are all conventional operations in the field, and the time described in this invention can be conventionally purchased or configured by oneself according to the product manual.

[0070] Example 1: Detection of differentially expressed microRNAs in the pathological progression of Alzheimer's disease using high-throughput miRNA sequencing technology.

[0071] 5×FAD transgenic mice (referred to as 5×FAD mice, purchased from Zhishan (Beijing) Health and Medical Research Institute) and wild mice (referred to as WT mice, purchased from Zhishan (Beijing) Health and Medical Research Institute) were used as experimental materials. Mice were euthanized by inhaling excessive amounts of ether. Brain tissue from 7-month-old 5×FAD mice and WT mice was taken, and the cerebral cortex and hippocampus were separated. The tissue was immediately placed in liquid nitrogen and stored overnight in a -80°C freezer. High-throughput, high-accuracy, and low-cost next-generation sequencing of genomic expression profiles was performed using a sequencing technology combining bridge PCR and sequencing-by-synthesis. Total RNA was extracted from the cerebral cortex and hippocampus of 5×FAD and WT mice using the Trizol method, and then isolated and constructed sequencing gene libraries. Single-end sequencing of the constructed sample gene libraries was performed using Illumina HiSeq 2500. FastQC was used to assess the quality of the raw sequencing data. miRNA alignment with the reference genome, miRNA secondary structure analysis, and differential miRNA expression analysis were performed using miRDeep2 software. Differentially expressed non-coding RNAs (such as...) were found in the hippocampus and cerebral cortex of 5×FAD and WT mice of the same age. Figure 1 As shown, the results are expressed as mean ± SEM ( n =3)calculated), denoted as miR-19899.

[0072] The nucleotide sequence of miR-19899, ​​the precursor of miR-19899, ​​is shown in SEQ ID NO:1; the mature miR-19899 has its nucleotide sequence shown in SEQ ID NO:1; and the reverse transcription primer sequence of miR-19899 is shown in SEQ ID NO:2.

[0073] miR-19899 was detected using real-time quantitative PCR (qRT-PCR). The primer pairs for detecting miR-19899 are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively.

[0074] The above steps were entrusted to Sangon Biotech (Shanghai) Co., Ltd.

[0075] Example 2: Expression changes of miR-19899 cluster microRNAs in Alzheimer's disease (AD) model cells

[0076] (1) Single clones were obtained by cell culture technology, transient transfection with polyethyleneimine (CAS: 49553-93-7, Darmschmerkl Group, Germany), antibiotic pressure screening, and limiting dilution method. At the same time, relevant proteins were detected by Western blotting or ELISA to construct a stable transfected human-mouse chimeric strain. APPThe gene was used in human neuroblastoma cells (APPswe cells), specifically referring to the literature (Wang, CY, et al. (2011). Huperzine A activates Wnt / β-catenin signaling and enhances the nonamyloidogenic pathway in an Alzheimertransgenic mouse model). Neuropsychopharmacology . 36(5), 1073–1089.).

[0077] (2) The APPswe cells constructed in step (1) were cultured in DMEM medium containing 10 v / v% FBS (fetal bovine serum) at 37°C with 5% CO2. Puromycin was used to maintain the phenotypic characteristics of the stable cell line; the concentration of puromycin in DMEM medium containing 10 v / v% FBS was 1 μg / ml. When the cell confluence reached 80%, copper ions were used for treatment; the concentration of copper ions in DMEM medium containing 10 v / v% FBS was 200 μM. After inducing treatment of APPswe cells with copper ions, copper ions formed chelates with APP and Aβ, aggravating the production and deposition of Aβ, inducing oxidative stress and neuronal apoptosis. Therefore, APPswe cells treated with copper ions can be used to simulate the pathological state of AD neurons and to study the mechanism of drug action.

[0078] Total RNA was extracted from APPswe cells treated with copper ions for 0, 12, 24, 36, and 48 h using the Trizol method (Kangwei Biotechnology Kit, CW0581). Reverse transcription was then performed using the stem-loop method (Novozymes Nanjing, MIR-101). The expression level of miR-19899 in APPswe cells was quantitatively detected using real-time quantitative polymerase chain reaction (Novozymes Nanjing, MQ-101) qRT-PCR, following the manufacturer's instructions. The reverse transcription primer sequences are shown in SEQ ID NO:2, the forward primer sequences for real-time quantitative detection are shown in SEQ ID NO:3, and the reverse primer sequences for real-time quantitative detection are shown in SEQ ID NO:4.

[0079] Test results as follows Figure 2 As shown, the results are expressed as mean ± SEM ( n =3) Calculated, * indicates comparison with 0h without copper ions, P <0.05, ** indicates compared to 0 h, P <0.01.

[0080] according to Figure 2It can be seen that the cell damage induced by copper ion stimulation worsened over time, and the expression level of miR-19899 decreased accordingly, indicating that miR-19899 is downregulated in the pathological process of AD.

[0081] (3) Mouse microglia EOC20 cells (purchased from ATCC, catalog number: EOC20(CRL-2469)) were grown in DMEM conditioned medium containing 10 v / v% fetal bovine serum and 20 v / v% LADMAC medium at 5% CO2 and 37°C. EOC20 cells were cultured at a rate of 1×10⁻⁶ cells / year. 5 Cells were seeded at 1 / mL in six-well plates, and LPS was added at final concentrations of 500 ng / mL and 1000 ng / mL. After 24 h, total RNA was extracted from cells using the Trizol method (Kangwei Biotechnology Kit, CW0581), reverse transcribed (Novozymes Nanjing, R323), and then subjected to real-time quantitative polymerase chain reaction (Novozymes Nanjing, Q711) to obtain the final RNA. U6 The gene was used as an internal control. The expression level of miR-19899 in a neuroinflammatory cell model was detected by reverse transcription and real-time quantitative PCR using qRT-PCR technology. Among the results:

[0082] U6 The gene sequence is shown in SEQ ID NO:5. U6 The RT sequence of the gene is shown in SEQ ID NO:6. U6 The primer pairs for the gene are shown in SEQ ID NO:7 and SEQ ID NO:8.

[0083] SEQ ID NO: 5: 5'-gtcccttcggggacatccgataaaattggaacgatacagagaagattagcatggcccctgcgcaaggatgacacgcacaaatcgagaaatggtccaaaatttt-3';

[0084] SEQ ID NO: 6: 5'-GTCGTATCCAGTGCAGGGTCCGAGG TATTCGCACTGGATACGACAAAATA-3';

[0085] SEQ ID NO:7: 5'-CAAATTCGTGAAGCGTTCCA-3';

[0086] SEQ ID NO:8: 5'-AGTGCAGGGTCCGAGGTATT-3'.

[0087] The reverse transcription primer sequence is shown in SEQ ID NO:2, the forward primer sequence for real-time quantitative detection is shown in SEQ ID NO:3, and the reverse primer sequence for real-time quantitative detection is shown in SEQ ID NO:4.

[0088] Test results as follows Figure 3 As shown, the results are expressed as mean ± SEM ( n =3) , ** indicates comparison with the resting microglia treatment group P <0.01; *** indicates that compared with the resting microglia treatment group, P <0.001.

[0089] according to Figure 3 It can be seen that the expression level of miR-19899 is significantly decreased in the inflammatory cell model.

[0090] Example 3: Expression changes of microRNAs of the miR-19899 cluster in Alzheimer's disease (AD) model animals.

[0091] 3-, 6-, 7-, 9-, and 12-month-old 5×FAD transgenic mice were used as the experimental group (designated as 5×FAD mice, purchased from Zhishan (Beijing) Health and Medical Research Institute), and 3-, 6-, 7-, 9-, and 12-month-old wild-type control mice were used as the control group (designated as WT mice, purchased from Zhishan (Beijing) Health and Medical Research Institute). Mice were euthanized under anesthesia. Cortical and hippocampal brain tissues from 3-, 6-, 7-, 9-, and 12-month-old 5×FAD and WT mice were rapidly isolated on ice. After liquid nitrogen freezing, total mRNA was extracted from the cerebral cortex and hippocampal brain tissues of 5×FAD and WT mice using the Trizol method. The concentration and purity of total RNA were determined by ultraviolet spectrophotometry. The expression changes of miR-19899 in the pathological progression of AD were detected using qRT-PCR. The results are as follows: Figure 4 and Figure 5 As shown, where Figure 4 These are the results of mouse cortical examination. Figure 5 This is the result of hippocampal brain tissue examination. Figure 4 and Figure 5 The results shown are expressed as mean ± SEM ( n =3) , * indicates 5×FAD mice compared to WT mice, P <0.05.

[0092] according to Figure 4 and Figure 5 It can be seen that the expression level of miR-19899 in the cerebral cortex and hippocampus of 5×FAD mice was significantly lower at 7, 9 and 12 months of age compared with WT mice of the same age.

[0093] Example 4: Expression changes of microRNAs of the miR-19899 cluster in the serum of AD patients

[0094] Serum samples were collected from 13 Alzheimer's disease (AD) patients and 12 healthy age-matched individuals (HAVs). Total RNA was extracted from both patients and healthy individuals. RNA concentration and purity were verified using ultraviolet spectrophotometry. The level of miR-19899 in the serum of AD patients was detected using qRT-PCR. ROC curve analysis was used to analyze the ability of differentially expressed miR-19899 as a diagnostic indicator to distinguish AD patients from healthy individuals. The results are as follows: Figure 6 and Figure 7 As shown, where Figure 6 The results are from qRT-PCR detection, and are expressed as mean ± SEM. n ≥12) count, ** indicates that AD patients compared to HAVs P <0.01; Figure 7 The results are shown in the ROC curve analysis, where the area under the ROC curve is AUC = 0.80 (CI: 0.800–1.00). P <0.01), sensitivity 69.2%, specificity 83.3%.

[0095] according to Figure 6 and Figure 7 It can be seen that the relative expression level of miR-19899 in the blood of AD patients is significantly reduced. The sensitivity and specificity of ROC curve detection are both high. Using the differential relative expression of miR-19899 as a diagnostic method can effectively distinguish between patients and healthy individuals with high accuracy.

[0096] Example 5: Expression levels of miR-19899 cluster microRNAs in different tissues of wild-type mice

[0097] Seven-month-old wild-type mice (designated WT mice, purchased from Zhishan (Beijing) Health and Medical Research Institute) were used as the research subjects. Mice were euthanized under anesthesia. Brain tissue, liver, spleen, kidney, lung, heart, stomach, thymus, trachea, skin, fat, muscle, eye, intestine, bone tissue, and serum from the seven-month-old WT mice were rapidly isolated on ice. After liquid nitrogen freezing, total mRNA was extracted from different tissues of the WT mice using the Trizol method. The concentration and purity of total RNA were determined by ultraviolet spectrophotometry. The expression changes of miR-19899 in different tissues were detected using qRT-PCR. The results are as follows: Figure 8 As shown. Figure 8 The results shown are expressed as mean ± SEM ( n =3) Calculated.

[0098] according to Figure 8It can be seen that miR-19899 expression is mainly enriched in brain tissue. Secondly, miR-19899 is highly expressed in lipid-rich organs such as the heart and liver.

[0099] Example 6: Effects of microRNA dysregulation of the miR-19899 cluster on lipid accumulation in resting and activated microglia.

[0100] (1) Based on miRNA inhibitors, microglia models in both resting and activated states with miRNA knockout were constructed using polyethyleneimine transient transfection technology. The following procedures were designed and synthesized by Sangon Biotech (Shanghai) Co., Ltd.:

[0101] EOC20 mouse microglia were divided into 4 groups, and the following procedures were performed on each group:

[0102] NCI group: 50 nM miRNA irrelevant sequence negative control was transiently transfected with polyethyleneimine. The NCI sequence of the miRNA irrelevant sequence negative control is shown in SEQ ID NO:9.

[0103] SEQ ID NO:9: 5'-CAGUACUUUUGUGUAGUACAA-3';

[0104] NCI+LPS group: Based on the NCI group, lipopolysaccharide (LPS) was added to the culture medium at a concentration of 500 ng / mL.

[0105] miR-19899 inhibitor group: 50 nM miR-19899 inhibitor was transiently transfected with polyethyleneimine. The miR-19899 inhibitor is the sequence of SEQ ID NO:10 after / i2OMe methylation modification. The nucleotide sequence of SEQ ID NO:10 before methylation modification is shown below:

[0106] SEQ ID NO: 10: 5'-ACUACAGAAAGGAAUGAGAGUCA-3';

[0107] miR-19899 inhibitor+LPS group: Based on the miR-19899 inhibitor group, LPS was added to the culture medium at a concentration of 500 ng / mL.

[0108] Cells from each treatment group were incubated at 37°C for 36 h. After incubation, the cells were stained with DAPI (4',6-diamidinyl-2-phenylindole, CAS: 28718-90-3, Shanghai Haoyuan Biomedical Technology Co., Ltd.) and BODIPY (fluoroboron dipyrrole, CAS: 121207-31-6, Shanghai Haoyuan Biomedical Technology Co., Ltd.) dyes to examine lipid changes.

[0109] (2) After step (1) was completed, laser confocal microscopy was used to detect changes in lipid-related indicators in microglia. The results are as follows: Figures 9-12 As shown, where Figure 9 The level of lipid droplets in resting and activated microglia is downregulated by miR-19899. Figure 10 Representative images of lipid droplet changes in resting and activated microglia under miR-19899 downregulation; Figure 11 The level of lipid droplets in resting and activated microglia is upregulated by miR-19899. Figure 12 Representative images of lipid droplet changes in resting and activated microglia under miR-19899 upregulation. Figure 9 and Figure 11 The results are expressed as mean ± SEM (n>25). * indicates P<0.05 between two different treatment groups, ** indicates P<0.01 between two different treatment groups, *** indicates P<0.001 between two different treatment groups, and **** indicates P<0.0001 compared with NCI. Figure 10 and Figure 12 In the diagram, DAPI represents a representative image of cell morphology after staining cells with DAPI dye; BODIPY represents a representative image of lipid droplet changes after staining cells with BODIPY dye; and Merge represents a representative image of lipid droplet changes in each cell after combining the results of DAPI and BODIPY staining.

[0110] according to Figures 9-12 It can be seen that inhibiting miR-19899 expression induces lipid accumulation in both resting and activated microglia, while overexpression of miR-19899 alleviates lipid accumulation in both resting and activated microglia.

[0111] Example 7: Prediction of microRNA target genes of the miR-19899 cluster

[0112] Potential binding targets of miR-19899 were predicted using the bioinformatics software miRDB. KEGG pathway enrichment and GO analyses were performed on the predicted binding genes of miR-19899 using the online software DAVID and Metascape. The results are as follows: Figures 13-15 As shown. According to Figures 13-15 It can be seen that the target genes of miR-19899 are enriched in pathways related to inflammation, nerves and lipid metabolism, suggesting that miR-19899 may have a regulatory role in immune metabolic pathways.

[0113] Example 8: Translation-specific regulation of microRNAs in the miR-19899 cluster Rock2 and Plin4 expression

[0114] Following the miRNA overexpression / silencing technique shown in step (3) of Example 2, miRNA mimics / inhibitors were constructed. A neuronal cell model overexpressing or knocking down miR-19899 was established using polyethyleneimine transient transfection technology. The specific operations are as follows:

[0115] Neuronal cells (APPwse cells) were divided into four groups, which were named NCM group, NCI group, miR-19899 mimics group and miR-19899 inhibitor group, respectively.

[0116] NCM group: A negative control group was formed by transient transfection of 50 nM miRNA with an irrelevant sequence using polyethyleneimine. The sequence of NCM is shown in SEQ ID NO:11 and SEQ ID NO:12.

[0117] Sense (SEQ ID NO:11): 5'-UUGUACUACACAAAAGUACUG-3';

[0118] Antisense (SEQ ID NO:12): 5'-GUACUUUUGUGUAGUACAAUU-3';

[0119] NCI group: Negative control using transient transfection of 50 nM miRNA with an irrelevant sequence using polyethyleneimine. The NCI sequence is shown in SEQ ID NO:9.

[0120] miR-19899 mimics group: 50 nM miR-19899 mimics were transiently transfected with polyethyleneimine, wherein the sequences of miR-19899 mimics are shown in SEQ ID NO:13 and SEQ ID NO:14.

[0121] Sense (SEQ ID NO:13): 5'-UGACUCUCAUUCCUUUCUGUAGU-3';

[0122] Antisense (SEQ ID NO:14): 5'-UACAGAAAGGAAUGAGAGUCAUU-3';

[0123] miR-19899 inhibitor group: 50 nM miR-19899 inhibitor was transiently transfected with polyethyleneimine. The sequence of miR-19899 inhibitor is shown in SEQ ID NO:10.

[0124] Thirty-six hours after transfection, the miR-19899 target gene was detected by qRT-PCR. Rock2 and Plin4 Expressing the situation, the result is as follows Figure 16 and Figure 17 The results are expressed as mean ± SEM (mean ± SEM value). n =3) count, ** indicates a comparison between two different treatment groups P <0.01, *** indicates P <0.001, **** indicates P <0.0001.

[0125] The qRT-PCR procedure is as follows:

[0126] (1) Total RNA extraction and reverse transcription

[0127] APPswe cells: 0 h, 12 h, 24 h, 36 h, and 48 h of different Cu levels in a six-well plate 2+ APPswe cells with a stimulation duration were used for total RNA extraction. The culture medium was aspirated, and 1 mL of TRIzon reagent was added to each 6-well plate. Cells were repeatedly pipetted to lyse the cells.

[0128] Brain tissue: Mice were euthanized under anesthesia. The brains were isolated on ice, and the hippocampus and cortex were distinguished. The brains were rapidly flash-frozen in liquid nitrogen and then stored at -80°C. 1 mL of TRIzon reagent was added to every 50 mg of sample, and the mixture was homogenized on ice for 40 s. Cell and tissue samples containing TRIzon were collected in 1.5 mL RNase-free centrifuge tubes and incubated at room temperature for 5 min to allow for complete dissociation and release of nucleic acids.

[0129] (2) RNA isolation

[0130] Add 200 μL of chloroform to each tube, shake vigorously for 15 s, and let stand at room temperature for 2 min to denature the protein and separate the organic and aqueous phases. Then centrifuge at 12000 rpm (~13400×g) at 4℃ for 10 min, collect the upper aqueous phase containing RNA and transfer it to a new RNase-Free centrifuge tube to remove the middle layer containing denatured protein and high molecular weight DNA molecules and the lower organic phase.

[0131] (3) Adsorption

[0132] Add isopropanol to the collected upper aqueous phase (600 μL of isopropanol per 1 mL Trizol), invert 10 times, let stand for 10 min, centrifuge at 12000 rpm for 10 min at 4℃, and discard the supernatant.

[0133] (4) Purification

[0134] Add 1 mL of 75% ethanol to each centrifuge tube, centrifuge at 12000 rpm for 2 min at 4°C, and discard the supernatant. Repeat this step twice.

[0135] (5) Washing

[0136] After the centrifuge tubes have been completely air-dried, add an appropriate amount (20-100 μL) of RNase-free water, let stand at room temperature for 3 minutes, and then use a Spark microplate reader to detect the RNA concentration and purity. The samples can be used immediately for experiments or stored at -80℃.

[0137] (6) mRNA cDNA strand synthesis was performed using the Nanjing Novizan HiScript III 1st Strand cDNASynthesis Kit. The experiment was conducted on ice and consisted of two steps: first, genomic DNA was removed, and then cDNA synthesis was performed.

[0138] ① Genomic DNA removal: Add the reagents shown in Table 1 below to an RNase-free PCR tube, mix the components by pipetting, and then react in a 42℃ water bath for 2 min.

[0139] Table 1 Genomic DNA Removal Reagents

[0140]

[0141] ②cDNA synthesis reaction: Prepare the mixture in Table 2 below and mix it thoroughly by pipetting.

[0142] Table 2 Reagents for cDNA synthesis

[0143]

[0144] The reaction was carried out under the conditions shown in Table 3:

[0145] Table 3 Conditions for cDNA Synthesis

[0146]

[0147] (7) qRT-PCR reaction

[0148] qPCR was performed using the Nanjing Novizan ChamQ Universal SYBR qPCR Master Mix. The reaction mixture was prepared in 20 µL volumes per well according to the proportions shown in Table 4, with three replicates per sample.

[0149] Table 4 qPCR reaction system

[0150]

[0151] The qPCR primer sequences are shown in Table 5:

[0152] Table 5 qPCR primer sequences

[0153]

[0154] according to Figure 16 and Figure 17 It can be seen that overexpression of miR-19899 inhibits neuronal cell models. Rock2 and Plin4 Expression, while knocking down miR-19899 can promote expression in neuronal cell models. Rock2 and Plin4 Express.

[0155] Example 9: Translation-specific regulation of microRNAs in the miR-19899 cluster Rock2 and Plin4 expression

[0156] Based on miRNA mimics / inhibitors, a microglia (mouse EOC20 microglia) model with miR-19899 overexpression or knockdown was established using polyethyleneimine transient transfection technology.

[0157] Specifically: Following the method shown in Example 7, microglia were divided into four groups, which were named NCM group, NCI group, miR-19899 mimics group and miR-19899 inhibitor group, respectively, and transfected with the corresponding miRNAs.

[0158] Thirty-six hours after transfection, the miR-19899 target gene was detected using the qRT-PCR method described in Example 7. Rock2 and Plin4 Expressing the situation, the result is as follows Figure 18 and Figure 19 The results are expressed as mean ± SEM (mean ± SEM value). n =3) count, * indicates a comparison between two different treatment groups. P <0.05, ** indicates P <0.01, *** indicates P<0.001.

[0159] according to Figure 18 and Figure 19 It can be seen that overexpression of miR-19899 inhibits the expression of miR in the microglia model. Rock2 and Plin4 Expression, while knockdown of miR-19899 can promote expression in microglia models. Rock2 and Plin4 Express.

[0160] Example 10: MicroRNAs of the miR-19899 cluster and their target genes Rock2 and Plin4 combination

[0161] Following the steps in Example 6, cell models of miR-19899 overexpression or knockdown were constructed using polyethyleneimine transfection technology. Dual-luciferase reporter gene assays were used to detect miR-19899 and its target genes. Rock2 and Plin4 The combination situation. The results are as follows. Figures 20-21 As shown, where Figure 20 This indicates the use of dual-luciferase reporter assay to detect miR-19899 and its target genes. Rock2 The 3'UTR directly binds to the action; Figure 21 This indicates the use of dual-luciferase reporter assay to detect miR-19899 and its target genes. Plin4 The 3'UTR directly binds to it. Figures 20-21 Results are expressed as mean ± SEM ( n =3) Calculated, * indicates comparison with NCM, P <0.05.

[0162] according to Figures 20-21 It can be seen that miR-19899 can interact with its target genes. Rock2 and Plin4 Direct binding effect.

[0163] In summary, the miR-19899 provided by this invention exhibits significantly decreased expression during the pathological progression of Alzheimer's disease. ROC curves based on serum expression levels demonstrate that miR-19899 possesses a good diagnostic effect and can serve as a biomarker for detecting AD, while also negatively regulating... Rock2 and Plin4 Gene expression. Inhibiting miR-19899 expression activates lipid accumulation in microglia, while overexpression of miR-19899 reduces lipid accumulation in microglia and alleviates AD symptoms.

[0164] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments without creative effort, as shown in these embodiments, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An Alzheimer's disease biomarker miR-19899, ​​characterized in that, The nucleotide sequence of miR-19899 is shown in SEQ ID NO:

1.

2. The use of the substance miR-19899 as described in claim 1 in the preparation of a kit for the detection and / or diagnosis of Alzheimer's disease.

3. The use of miR-19899 as described in claim 1 or a substance overexpressing miR-19899 as described in claim 1 in the preparation of a drug for inhibiting lipid accumulation in microglia, characterized in that, The substance that overexpresses miR-19899 is called miR-19899 mimics, which are prepared from nucleotides with sequences as shown in SEQ ID NO:13 and SEQ ID NO:

14.

4. A primer set for detecting miR-19899 as described in claim 1, characterized in that, The primer set consists of reverse transcription primers, upstream primers, and downstream primers; The reverse transcription primer is a nucleotide sequence as shown in SEQ ID NO:2; The upstream primer is a nucleotide sequence as shown in SEQ ID NO:3; The downstream primer is a nucleotide sequence as shown in SEQ ID NO:

4.

5. The use of the primer set according to claim 4 in the preparation of a kit for the detection and / or diagnosis of Alzheimer's disease.

6. An Alzheimer's disease screening kit, characterized in that, The kit includes the primer set as described in claim 4.

Images