Clinical chemotherapy-resistant gastric cancer drug-resistant animal model and construction method thereof

Abstract

The invention discloses a gastric cancer drug-resistant animal model with clinical chemotherapy drug resistance and a construction method of the gastric cancer drug-resistant animal model. The model is characterized in that the model carries Cldn18-CreERT2; apcfl / fl; trp 53fl / fl; the method comprises the following steps: hybridizing a gastric cancer spontaneous tumorigenesis transgenic mouse of KrasG12D (Cldn18-ATK) with a CadD1371A / D1371A gene knock-in mouse, so as to obtain a Cldn18-ATK CadD1371A / D1371A double gene edited mouse; experiments show that the tumor volume reduction degree of the model after 5-FU chemotherapy is obviously lower than that of a control group (Cad + / +), and the proliferative activity (Ki-67 level) and the lifetime prolonging effect are also obviously weakened, so that the model simulates the clinical chemotherapy drug resistance phenotype. The model provides an efficient tool for gastric cancer drug resistance mechanism research and chemotherapy drug screening, and has important application value.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a gastric cancer drug-resistant animal model with clinical chemotherapy resistance and a method for constructing the same. Background Art

[0002] Mammalian cell proliferation requires de novo synthesis of pyrimidine nucleotides. This gene encodes a trifunctional protein that is associated with the enzymatic activities of the first three of six enzymes in the pyrimidine biosynthetic pathway: carbamoyl phosphate synthetase (CPSII), aspartate transcarbamylase, and dihydroorotase. That is, the metabolic flux of the de novo pyrimidine synthesis pathway is regulated by the first rate-limiting enzyme, Cytosolic carbamyl-phosphate synthetase II, asparate transcarbamylase, and Dihydroorotase (CAD). In the applicant's preliminary study, it was found that the multifunctional enzyme CAD is a physiological substrate of Caspase-3 in the chemotherapy drug-induced endogenous apoptosis pathway. Targeting these metabolic perturbations in cancer cells is the basis of all effective treatment strategies. The applicant's subsequent research results showed that a gain-of-function (GOF) mutation of CAD at codon 1371 in the aspartic acid cleavage site enhanced chemotherapy resistance, which was confirmed in clinical samples. Summary of the Invention

[0003] The purpose of the present invention is to provide a gastric cancer drug-resistant animal model with clinical chemotherapy resistance and a method for constructing the same.

[0004] The technical solution of the present invention is as follows:

[0005] A gastric cancer drug-resistant animal model with clinical chemotherapy resistance, wherein the animal model is a gene-edited mouse with the following genotype:

[0006] (1) Carrying a Cldn18-CreERT2 driving element to achieve gastric epithelial cell-specific Cre recombinase expression;

[0007] (2) Homozygous floxed knockout of Apc gene and Trp53 gene (Apc fl / fl ; Trp53 fl / fl );

[0008] (3) Expression of the G12D mutant of Kras gene (Kras G12D );

[0009] (4) Simultaneously carrying a homozygous point mutation at the D1371A site of CAD protein (Cad D1371A / D1371A );

[0010] (5) The gene editing combination results in the formation of hyperplastic tumors in the stomach of mice and significantly reduces the sensitivity to chemotherapeutic drugs, manifested as limited shrinkage of tumor volume, maintenance of proliferative activity, and weakened effect of prolonged survival.

[0011] Further, the chemotherapeutic drug in (5) is 5-FU (5-fluorouracil).

[0012] The present invention also provides a method for constructing the gastric cancer drug-resistant animal model, which includes the following steps:

[0013] (1) Obtain Cldn18-CreERT2; Apc fl / fl ; Trp53 fl / fl ; Kras G12D (Cldn18-ATK) transgenic mice;

[0014] (2) Construct homozygous knock-in (Cad D1371A / D1371A ) mice at the D1371A site of the Cad gene;

[0015] (3) Hybridize the Cldn18-ATK mice in step (1) with the Cad D1371A / D1371A mice in step (2), and screen to obtain compound mutant mice with the genotype of Cldn18-CreERT2; Apc fl / fl ; Trp53 fl / fl ; Kras G12D ; Cad D1371A / D1371A ;

[0016] (4) Induce the activity of CreERT2 recombinase through tamoxifen to achieve conditional knockout of Apc and Trp53 in gastric epithelial cells and activated expression of Kras G12D ;

[0017] (5) Verify the model phenotype.

[0018] Further, in step (5), verifying the model phenotype includes: confirming the ability of the mice to form hyperplastic tumors in the stomach and verifying its drug resistance through chemotherapy experiments.

[0019] Further, in step (5), the chemotherapy uses 5-FU chemotherapy, and the experiments include analysis of tumor volume changes, Ki-67 proliferation level, and survival period.

[0020] The present invention also provides the gastric cancer drug-resistant animal model obtained by the above construction method.

[0021] The present invention also provides the application of the gastric cancer drug-resistant animal model in drug screening.

[0022] Further, the CAD gene of the gastric cancer drug-resistant animal model has mutated.

[0023] Furthermore, compared with the wild-type CAD gene, the gain-of-function (GOF) mutation of the CAD gene in the gastric cancer drug-resistant animal model at codon 1371 of the aspartic acid cleavage site enhances chemoresistance.

[0024] The present invention also provides the application of the gastric cancer drug-resistant animal model in the preparation of chemoresistance detection products.

[0025] The advantages of the present invention are as follows:

[0026] The present invention provides a gastric cancer drug-resistant animal model with clinical chemoresistance and a construction method thereof. The model is obtained by crossing a gastric cancer spontaneous tumorigenesis transgenic mouse carrying Cldn18-CreERT2; Apc fl / fl ; Trp53 fl / fl ; Kras G12D (Cldn18-ATK) with a Cad D1371A / D1371A gene knock-in mouse to obtain a Cldn18-ATK Cad D1371A / D1371A double gene-edited mouse. Experiments show that the degree of tumor volume reduction in this model after 5-FU chemotherapy is significantly lower than that of the control group (Cad + / + ), and the proliferation activity (Ki-67 level) and the effect of prolonging survival period are also significantly weakened, confirming that it mimics the clinical chemoresistance phenotype. This model provides an efficient tool for the study of gastric cancer chemoresistance mechanisms and the screening of chemotherapeutic drugs, and has important application value. Brief Description of the Drawings

[0027] The present invention will be further described below with reference to the drawings and embodiments.

[0028] Figure 1 :(A) Sequence alignment of human and mouse CAD proteins at the designated amino acid sites. The identified CAD-D1371 site is highlighted in red. (B) Schematic diagram of the mouse Cad gene locus and the Cad-D1371A allele. (C) Genotyping of the tail tips of Cldn18-ATK Cad + / + and Cldn18-ATK Cad D1371A / D1371A mutant mice by sequencing.

[0029] Figure 2 :(A) Whole specimen images of the stomachs of untreated or 5-FU-treated Cldn18-ATK Cad + / + and Cldn18-ATK Cad D1371A / D1371A mice. The tumor areas are marked with black dotted lines. Each group contains 8 biologically independent samples (n = 8). (B) Statistical analysis of the maximum tumor area in the stomach, with each group containing 8 biologically independent samples (n = 8).

[0030] Data are presented as mean ± standard deviation (mean ± SD), and statistical analysis was performed using two-tailed Student's t-test. ns: not significant, *p < 0.05, **p < 0.01, ***p < 0.001.

[0031] Figure 3 :(A) Representative images of H&E staining, CAD, cleaved PARP, P53, and Ki67 staining of gastric sections from untreated or 5-FU-treated Cldn18-ATK Cad + / + and Cldn18-ATK Cad D1371A / D1371A mice. Scale bar: 50 μm. Each group contained 8 biologically independent samples (n = 8).

[0032] (B) Quantitative and statistical analysis of Ki67 staining images. Each group contained 8 biologically independent samples (n = 8).

[0033] Data are presented as mean ± standard deviation (mean ± SD), and statistical analysis was performed using two-tailed Student's t-test. ns: not significant, *p < 0.05, **p < 0.01, ***p < 0.001.

[0034] Figure 4 :(A) Kaplan-Meier survival analysis of 5-FU-treated Cldn18-ATK Cad + / + and Cldn18-ATK Cad D1371A / D1371A mice.

[0035] Figure 5 : Genotype identification of Cldn18-ATK mice. Detailed implementation

[0036] Example 1 Cldn18-ATK Cad D1371A / D1371A Construction method and identification of double gene-edited mice

[0037] I. Acquisition and identification of Cldn18-ATK mouse model

[0038] The applicant previously obtained Cldn18-CreERT2; Apc fl / fl ; Trp53 fl / fl ; Kras G12DSpontaneous tumorigenic transgenic mouse model of gastric cancer (abbreviated as Cldn18-ATK). In this model, the Cre recombinase driven by the Cldn18 promoter is used to specifically knockout the Apc and Trp53 genes in gastric epithelial cells and express the KrasG12D mutant. (The relevant paper on this Cldn18-ATK mouse model was published in the journal Nature Cell Biology in 2021).

[0039] PCR experimental protocol for genotyping Cldn18-ATK mice:

[0040] PCR primers:

[0041] Cldn18

[0042] Cldn18 WT_For: GTCAGTCCTACTAAACACACATGAA (SEQ ID NO: 1)

[0043] Cldn18 mut_For: GCATGAAGTGCAAGAACGTG (SEQ ID NO: 2)

[0044] Cldn18_Rev: GTAGACTCCCGTTGCTTTGG (SEQ ID NO: 3)

[0045] WT band: ~300bp, Mutant band: ~480bp

[0046] APC

[0047] APC_For: CAC TCA AAA CGC TTT TGA GGG TTG ATT C (SEQ ID NO: 4)

[0048] APC_Rev: GTT CTG TAT CAT GGA AAG ATA GGT GGT C (SEQ ID NO: 5)

[0049] WT band: 266bp, Mutant band: 314bp

[0050] P53

[0051] P53_For: GGT TAA ACC CAG CTT GAC CA (SEQ ID NO: 6)

[0052] P53_Rev: GGA GGC AGA GAC AGT TGG AG (SEQ ID NO: 7)

[0053] WT band: 228bp, Mutant band: 335bp

[0054] Kras

[0055] Kras_For: CGC AGA CTG TAG AGC AGC G(SEQ ID NO: 8)

[0056] Kras_Rev: CCA TGG CTT GAG TAA GTC TGC(SEQ ID NO: 9)

[0057] Positive band: ~450 to 500bp

[0058] The reaction system for genotype identification PCR using the Promega GoTaq kit (Cat. No.: M7122 / M7123):

[0059]

[0060] PCR cycling conditions:

[0061] Stage 1: 95°C 3min, 1 cycle

[0062] Stage 2: 95°C 30sec, 58°C 30sec, 72°C 30sec, 35 cycles

[0063] Stage 3: 72°C 5min, 1 cycle

[0064] Hold at 4°C indefinitely

[0065] ① Temperature gradient verification: When using new primers for the first time, it is recommended to set an annealing temperature gradient (such as 55 - 65°C) and select the Tm value with the best specificity. ② Cycle number adjustment: If the band is weak, the number of cycles can be increased to 40, but this may increase non-specific products. ③ Extension time: For short fragments (<500bp), 30 seconds of extension is sufficient, while for long fragments (>1kb), it needs to be extended to 1 - 2 minutes.

[0066] Identification example: As Figure 5 shown, Figure 5 is the genotype identification of the first batch of Cldn18-ATK mouse models obtained from the team of Professor Yoshiaki Ito at the National University of Singapore, representing that the F0 generation mice obtained by the applicant are those in which the Apc and Trp53 genes are specifically knocked out in gastric epithelial cells by the Cre recombinase driven by the Cldn18 promoter and the KrasG12D mutant is expressed. II. Cad in C57BL / 6 background + / +With Cad D1371A / D1371A Construction and Identification of Cad Gene Knock-in Mice

[0067] In this application, through the CRISPR / Cas9-mediated homology-directed repair (HDR) technology, a precise point mutation of aspartic acid (Asp, D) to alanine (Ala, A) at position 1371 of the Cad gene was achieved in C57BL / 6 mice. The specific method is as follows:

[0068] Source of C57BL / 6 mice: (The C57BL / 6 mice were obtained from the Experimental Animal Center of Xiamen University. All animal experiments conducted in this application have been approved by the Animal Ethics Committee of Xiamen University, approval number XMULAC20200080. The ethical protocol clearly defines the criteria for humane endpoints, stipulating that the maximum allowable tumor burden shall not exceed 20 mm in diameter, or strictly limit the tumor volume not to exceed 10% of the animal's body weight to ensure animal welfare. All animals were housed in a standardized 12-hour light and 12-hour dark cycle environment during the experiment and had free access to food and water throughout the process.

[0069] Targeted Design and Verification

[0070] A specific sgRNA was designed for the exon region of the Cad gene, and its target sequence is 5'-TGAAGAGGCGGTGGATGGTGAGTGCCCACCACAACGGAGCATCTTGGATC-3' (SEQ ID NO: 10, Protospacer Adjacent Motif sequence is TGG), and sgRNA was synthesized in vitro (forward primer with T7 promoter sequence added: 5'-TAATACGACTCACTATAGGACCTGCAGGATGTCAACGT-3', SEQ ID NO: 11; reverse 5'-AAAAGCACCGACTCGGTGCC-3', SEQ ID NO: 12). At the same time, a single-stranded oligonucleotide (SSO) was designed as a homologous recombination template, including 50 bp left / right homologous arms and the p.D1371A mutation (example sequence: 5'-CTGGATCCGAGCTCAAGCTTG...CACTAGTCC GGAATTCCGG-3' (SEQ ID NO: 13), the mutation site is marked as D→A).

[0071] Preparation of CRISPR / Cas9 System

[0072] Use commercial Cas9 mRNA and mix it with the specific sgRNA and SSO synthesized in the previous step. Final concentrations: Cas9 mRNA 50 ng / μL, specific sgRNA 25 ng / μL, SSO 100 ng / μL. Microinject into the pronuclear stage fertilized eggs of C57BL / 6 mice, and transplant them into pseudopregnant female mice to obtain F0 generation chimeric mice.

[0073] Genotyping of F0 generation

[0074] Extract genomic DNA from the mouse tail tip. Use primers Cad-F: 5'-CAGGTGCTGAAGATGGACCT-3' (SEQ ID NO: 14) and Cad-R: 5'-GTCGACCTCGAGGTACCTGC-3' (SEQ ID NO: 15) to amplify the target region (product ~500 bp). Confirm the D1371A mutation by Sanger sequencing (sequencing primer Cad-Seq: 5'-CAGGTGCTGAAGATGGACCT-3', SEQ ID NO: 16). If there is no mutation, the corresponding Cad + / + mice are obtained. Meanwhile, predict potential off-target sites through the CRISPOR software, and design primers (Off Target1-F: 5'-GACCTGCAAGATGTCAACGT-3', SEQ ID NO: 17 and OffTarget1-R: 5'-CACAAAATGATTCTGACCTG-3', SEQ ID NO: 18) to amplify and sequence to exclude off-target effects.

[0075] Breeding and verification of homozygous mice

[0076] Mate F0 generation chimeras with wild-type C57BL / 6 to obtain F1 generation heterozygotes (Cad + / D1371A ), and further obtain homozygotes (Cad D1371A / D1371A ) by intercrossing heterozygotes. Use primers Cad-F: 5'-CAGGTGCTGAAGATGGACCT-3' (SEQ ID NO: 19) and Cad-R: 5'-GTCGACCTCGAGGTACCTGC-3(SEQ ID NO: 20)' to amplify the target region (product ~500 bp), and confirm the D1371A mutation by Sanger sequencing again, with the sequencing primer Cad-Seq: 5'-CAGGTGCTGAAGATGGACCT-3' (SEQ ID NO: 21) Figure 1 C). Use anti-CAD antibody (Abcam#ab99313) in Western Blot to verify the protein expression difference and detect the sensitivity difference of mutant mice to 5-FU chemotherapy.

[0077] III. Cldn18-ATK Cad D1371A / D1371A Breeding and identification of double gene-edited mice:

[0078] Cage the Cldn18-ATK mice with Cad D1371A / D1371A mice in a 1:1 ratio for mating to obtain F1 offspring. Screen the F1 offspring for those that carry both Cldn18-ATK and Cad + / D1371A mice for sibling mating. It is expected that the target genotype Cldn18-ATK; Cad will be obtained in the F2 generation D1371A / D1371A . Identify the double genotypes of the F2 generation mice using the same identification method as above.

[0079] The obtained target genotype Cldn18-ATK; Cad D1371A / D1371A mice are used for drug resistance experiments.

[0080] This application explores the effect of CAD proteolysis on the chemotherapy effect of the Cldn18-ATK mouse model. As Figure 1 shown in A, the results of sequence alignment analysis indicate that the D1371 site (marked in red) of the CAD protein and its flanking sequences are highly conserved in mice and humans. Therefore, the applicant constructed C57BL / 6 congenic Cad + / + and Cad D1371A / D1371A gene knock-in mice and hybridized them with Cldn18-ATK mice to obtain Cldn18-ATK Cad + / + and Cldn18-ATK Cad D1371A / D1371A mice ( Figure 1 B, C).

[0081] The results of this example show that the present invention successfully constructs a Cad point mutant mouse model with a pure genetic background through precise gene editing and multi-level verification, providing a reliable tool for studying the function of the CAD protein and the mechanism of chemotherapy drug resistance.

[0082] Example 2 Cldn18-ATK Cad D1371A / D1371A Drug resistance verification of double gene-edited mice

[0083] Take Cldn18-ATK Cad + / + and Cldn18-ATK Cad D1371A / D1371ASixteen male mice at 10 weeks of age were induced by a single intraperitoneal injection of 100 mg / kg tamoxifen (Catalog No. #T5648, Sigma), which was dissolved in corn oil (Catalog No. #HY-Y1888, MedChemExpress) to a final concentration of 25 mg / ml. Two weeks after tamoxifen treatment, the mice of the two genotypes were randomly divided into 2 groups (8 mice in each group). One group was intraperitoneally injected with 5-FU (Catalog No. #F6627, Sigma) at a dose of 25 mg / kg once a week. 5-FU was dissolved in DMSO (Catalog No. #D2650, Sigma) to a final concentration of 25 mg / ml for treatment. The other group was injected with 100 μl of DMSO simultaneously for 4 weeks. At the 7th week after induction (16 weeks of age), the mice were sacrificed en masse. Gastric tissues were taken to calculate tumor size for assessing growth, and histopathological sections were stained with HE to judge malignancy, and immunohistochemistry experiments were performed to detect and quantify Ki-67 positive tumor cells.

[0084] The HE staining and immunohistochemistry experiments of mouse gastric tissues mainly include three main steps: sample preparation, staining treatment, and result analysis. First, in the sample preparation stage, after sacrificing the mice, the intact gastric tissues were immediately taken out, rinsed with pre-cooled PBS buffer to remove residual blood and contents, and then the tissues were immersed in 4% paraformaldehyde fixative and placed in a 4°C refrigerator for 24 - 48 hours. After fixation, routine dehydration treatment was carried out, successively through 70%, 85%, 95%, and 100% ethanol gradients for dehydration, then cleared with xylene, and finally embedded in paraffin. The embedded tissue blocks were cut into 4 - 5 μm thick continuous sections using a microtome, mounted on polylysine-treated glass slides, and baked in a 60°C oven for 2 hours to ensure the sections were firmly attached.

[0085] For the HE staining experiment, dewaxing treatment was first required. The sections were successively immersed in xylene I and xylene II for 10 minutes each, then in absolute ethanol for 5 minutes, and finally hydrated through 95%, 85%, 70% ethanol gradients. The hydrated sections were stained with hematoxylin stain for 5 - 8 minutes, rinsed with running water for 10 minutes to turn blue, and then counterstained with eosin stain for 1 - 3 minutes for the cytoplasm. After staining, dehydration was carried out successively through 70%, 85%, 95%, and 100% ethanol gradients, cleared with xylene, and finally sealed with neutral gum. When observed under an optical microscope, the cell nuclei appeared blue and the cytoplasm appeared pink, and the tissue structure characteristics of each layer of the gastric mucosa could be clearly observed, including the integrity of structures such as the epithelial layer, lamina propria, and muscularis mucosa, as well as pathological changes such as the presence of inflammatory cell infiltration.

[0086] After dewaxing and rehydrating the sections in the immunohistochemistry experiment, antigen retrieval is required. Immerse the sections in sodium citrate buffer at pH 6.0, and place them in a water bath at 95 - 98 °C or a pressure cooker for heat retrieval for 20 minutes, then naturally cool to room temperature. After the retrieval is completed, incubate with 3% hydrogen peroxide solution at room temperature for 10 minutes to block the activity of endogenous peroxidase, and then block with 5% bovine serum albumin blocking solution at room temperature for 30 minutes to reduce non-specific binding. After discarding the blocking solution, add an appropriate amount of diluted primary antibody working solution and incubate overnight in a wet box at 4 °C. Take out the sections the next day and let them return to room temperature. After rinsing with PBS, add the corresponding HRP-labeled secondary antibody and incubate at room temperature for 30 - 60 minutes. When developing with DAB chromogenic solution, it is necessary to monitor in real time under the microscope. Immediately terminate the reaction when positive signals appear and the background is not colored. Counterstain the cell nuclei with hematoxylin for 1 minute, and rinse with running water to turn blue. Finally, after conventional dehydration and clearing, seal the sections with neutral balsam. When observing under the microscope, the positive signals appear brownish-yellow. The intensity and distribution of Ki-67 positive signals are mainly quantitatively analyzed by the image analysis software ImageJ.

[0087] It was found that Cad D1371A / D1371A The level of proliferative tumor formation in the stomach of gene knock-in mice was comparable to that of the control group. After treatment with 5-FU, Cad + / + The volume of proliferative tumors in the stomach of mice decreased significantly, but Cad D1371A / D1371A The sensitivity of gene knock-in mice to 5-FU treatment was significantly reduced ( Figure 2 ); the above findings could also be demonstrated by the proliferative activity (Ki-67 level) ( Figure 3 ). Moreover, the effect of 5-FU treatment on prolonging the survival of Cad D1371A / D1371A gene knock-in mice was significantly weakened ( Figure 4 A). These research results indicate that the D1371 mutation of CAD protein plays a key role in mediating the chemotherapy effect, and Cldn18-ATK Cad D1371A / D1371A mice are an ideal animal model of gastric cancer drug resistance for clinical chemotherapy resistance.

[0088] As described above, it is only a preferred embodiment of the present invention. Therefore, the scope of implementation of the present invention cannot be limited by this. That is, equivalent changes and modifications made according to the scope of the present invention patent and the content of the specification should still fall within the scope covered by the present invention.

Claims

1. A gastric cancer drug-resistant animal model with clinical chemotherapy resistance, characterized in that, The animal model is a gene-edited mouse with the following genotype: (1) Carrying the Cldn18-CreERT2 driver element to achieve gastric epithelial cell-specific Cre recombinase expression; (2) Homozygous floxed knockout of the Apc gene and the Trp53 gene; (3) Expression of the G12D mutant of the Kras gene; (4) Simultaneously carrying a homozygous point mutation at the D1371A site of the CAD protein. (5) The above gene editing combination results in the formation of proliferative tumors in the stomach of the mouse, and the sensitivity to chemotherapeutic drugs is significantly reduced, manifested as limited shrinkage of tumor volume, maintenance of proliferative activity, and weakened effect of extended survival.

2. The gastric cancer drug-resistant animal model with clinical chemotherapy resistance as described in claim 1, characterized in that, The chemotherapeutic drug is 5-FU.

3. Method for constructing gastric cancer drug-resistant animal model, characterized in that, It includes the following steps: (1) Obtain Cldn18-CreERT2; Apc fl / fl ; Trp53 fl / fl ; Kras G12D transgenic mice, namely Cldn18-ATK mice; (2) Construct homozygous knock-in mice at the D1371A site of the Cad gene, namely Cad D1371A / D1371A mice; (3) Hybridize the Cldn18-ATK mice in step (1) with the Cad D1371A / D1371A mice, and screen to obtain compound mutant mice with the genotype of Cldn18-CreERT2; Apc fl / fl ; Trp53 fl / fl ; Kras G12D ; Cad D1371A / D1371A ; (4) Conditional knockout of Apc and Trp53 and activation and expression of Kras in gastric epithelial cells were achieved by inducing the activity of CreERT2 recombinase with tamoxifen. G12D ​ (5) Verifying the model phenotype.

4. The method for constructing a gastric cancer drug-resistant animal model according to claim 3, characterized in that, In step (5), verifying the model phenotype includes: confirming the ability of the mouse to form proliferative tumors in the stomach and verifying its drug resistance through chemotherapy experiments.

5. The method for constructing a gastric cancer drug-resistant animal model according to claim 4, wherein In step (5), 5-FU chemotherapy is used, and the experiments include analysis of tumor volume change, Ki-67 proliferation level, and survival period.

6. A gastric cancer drug-resistant animal model obtained by the construction method according to any one of claims 3-5.

7. Application of the gastric cancer drug-resistant animal model according to any one of claims 1 or 6 in drug screening.

8. The application according to claim 7, characterized in that, The CAD gene of the gastric cancer drug-resistant animal model has mutated.

9. The application according to claim 8, characterized in that, Compared with the wild-type CAD gene, the gain-of-function mutation of the CAD gene of the gastric cancer drug-resistant animal model at codon 1371 of the aspartic acid cleavage site enhances chemoresistance.

10. Application of the gastric cancer drug-resistant animal model according to any one of claims 1 or 6 in the preparation of a chemoresistance detection product.

Images