Application of SS-31 in preparation of medicine for treating bronchial pulmonary dysplasia

By using SS-31 targeted polypeptide to improve mitochondrial function, the problems of alveolar development block and metabolic abnormalities in bronchial lung dysplasia were solved, and significant growth promotion and lung function improvement were achieved.

CN120285143APending Publication Date: 2025-07-11JIANGNAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510650162.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-20
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

Effective pharmacological treatment options are lacking in the prior art to alleviate and improve bronchial lung dysplasia (BPD), especially due to alveolar developmental block and metabolic abnormalities caused by mechanical ventilation and hyperoxygen exposure, and existing treatments are potentially at risk.

Method used

SS-31 is used as a mitochondrial targeting polypeptide, targeting the mitochondrial inner membrane through intraperitoneal injection or other pharmaceutically acceptable dosage forms, repairing the mitochondrial membrane structure, improving mitochondrial function, and promoting alveolar development and energy metabolism.

Benefits of technology

Significantly increase the weight of BPD mice, improve alveolar development block, reduce alveolar epithelial cell damage, reduce carbon dioxide emissions and oxygen consumption, promote the production of surfactants, and improve the growth and metabolism of BPD mice.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120285143A_ABST
    Figure CN120285143A_ABST
Patent Text Reader

Abstract

The invention discloses application of SS-31 in preparation of a medicine for treating bronchial pulmonary dysplasia, and belongs to the field of medicine. The result shows that the SS-31 can promote the growth of the BPD mouse and improve the pulmonary alveolar development retardation and metabolic disorder of the BPD mouse. A new treatment means is provided for preparing the medicine for treating the bronchial pulmonary dysplasia, SS-31 is applied to the development process of the medicine related to the bronchial pulmonary dysplasia, and a new means and way are provided for the bronchial pulmonary dysplasia.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to application of SS-31 in preparing a medicine for treating bronchopulmonary dysplasia, and belongs to the field of medicine. Background Art

[0002] Bronchopulmonary dysplasia (BPD) is the most common and most serious chronic respiratory disease in premature infants and the leading cause of death in premature infants, especially those with very low birth weight. In recent years, with the improvement of perinatal and neonatal medical technology in my country, the survival rate of newborns, especially premature infants, has increased year by year. The lungs of premature infants are usually in the late saccular to early alveolar stages at birth and require respiratory support. Necessary treatments such as mechanical ventilation, continuous positive airway pressure ventilation, and supplemental oxygen can cause inflammation and acute lung injury during the treatment process, leading to the occurrence of neonatal BPD. Premature infants with BPD have a high early mortality rate, and survivors are prone to complications such as retinopathy, poor neurodevelopmental outcomes, and long-term respiratory diseases that persist into adulthood, which seriously affect their quality of life. In clinical practice, there is still no specific, safe, and effective drug treatment for BPD. Although the early administration of steroids and glucocorticoids before delivery and surfactants after delivery can reduce the risk of BPD to a certain extent, they can cause adverse reactions and potential risks such as abnormalities of the nervous system and cerebral palsy. Therefore, finding new drug treatment targets and new treatment methods is a very urgent task.

[0003] SS-31 (also known as Elamipretide, MTP-131, RX-31) is a mitochondrial-targeted peptide composed of four amino acids. The drug easily penetrates the cell membrane and targets the inner membrane of the mitochondria. By binding to cardiolipin, the iconic phospholipid of the inner membrane of the mitochondria, it participates in a variety of biological processes in the mitochondria, including energy metabolism. SS-31 binds to cardiolipin to repair the loss of the inner membrane of the mitochondria, normalize the structure of the mitochondrial membrane, and thus improve mitochondrial function. Studies have found that SS-31 has good effects in a series of diseases such as primary mitochondrial myopathy, heart failure, dry age-related macular degeneration, Barth syndrome, Huntington's disease, acute kidney injury, heterochromic iridocyclitis, etc. However, the research and protective effects of this drug in bronchopulmonary dysplasia are unclear. Summary of the invention

[0004] To solve the above problems, the object of the present invention is to provide the application of SS-31 in the preparation of drugs for treating bronchopulmonary dysplasia. By injecting SS-31 into mice with bronchopulmonary dysplasia (BPD) constructed by continuous high-oxygen exposure, it is found that the use of SS-31 can significantly increase the body weight of BPD mice, promote the growth of BPD mice, improve alveolar development arrest and metabolic abnormalities in BPD mice; when SS-31 is given to alveolar epithelial cells (MLE-12) induced by continuous high-oxygen exposure, it is found that SS-31 reduces MLE-12 cell damage and promotes surfactant production. The above effects indicate that SS-31 has an obvious alleviating and improving effect on bronchopulmonary dysplasia; the present invention provides a new idea for the preparation of drugs for treating BPD, that is, applying SS-31 to the drug development process related to BPD in order to better treat BPD.

[0005] To achieve the above object, the following technical solutions are provided:

[0006] The present invention provides the application of SS-31 in the preparation of drugs for treating bronchopulmonary dysplasia.

[0007] In one embodiment, the chemical structural formula of the SS-31 is shown as follows:

[0008]

[0009] In one embodiment, the bronchopulmonary dysplasia refers to a complication that occurs in neonates, especially premature infants, during the process of respiratory support and treatment, and its characteristic manifestation is: alveolar development arrest.

[0010] In one embodiment, the drug is any pharmaceutically acceptable dosage form.

[0011] In one embodiment, the dosage form includes: tablets, oral liquids, injections, pills, powders or capsules.

[0012] In one embodiment, the drug further contains excipients.

[0013] In one embodiment, the excipient is a pharmaceutically acceptable excipient; optionally, the excipient includes: one or more of probiotics, lactose, maltose, microcrystalline cellulose, carboxymethyl cellulose, hydroxypropyl methylcellulose, starch, sucrose, glucose, aspartame, water, glycerol, whey protein powder, chitosan oligosaccharide, mannitol, calcium phosphate, polyvinylpyrrolidone, gelatin, cross-linked carboxymethylcellulose sodium, magnesium stearate, talc powder, silicon dioxide, polyethylene glycol, sodium hydroxide, citric acid, phosphate buffer solution.

[0014] In one embodiment, the drug further contains a drug carrier.

[0015] In one embodiment, the drug carrier includes any one of liposomes, nanoparticles, viral vectors, dendrimers, hydrogels, metal-organic frameworks, and exosomes.

[0016] The present invention also provides a drug for treating bronchopulmonary dysplasia, and the active ingredient of the drug includes SS-31.

[0017] In one embodiment, the drug can be used to improve alveolar development arrest and promote alveolar development.

[0018] The present invention also provides the use of SS-31 in the preparation of a drug for improving alveolar development arrest in lung tissue and improving dyspnea in bronchopulmonary dysplasia.

[0019] In one embodiment, the alveolar development arrest in the lung tissue is manifested as a decrease in the number of radial alveoli and an increase in the mean linear intercept.

[0020] Beneficial effects:

[0021] Regarding the use of SS-31 provided by the present invention in the preparation of a drug for treating bronchopulmonary dysplasia, it is found that using SS-31 can effectively alleviate and improve the weight loss, alveolar development arrest, and metabolic abnormalities induced by hyperoxia exposure in BPD mice, and reduce the alveolar epithelial cell damage induced by hyperoxia exposure. Specifically:

[0022] (1) Compared with the control group (CON) mice, the mice in the model group (HYP) were significantly smaller in size and had reduced body weight; the mice in the SS-31 treatment group (HYP+SS-31) had an increased body size and increased body weight.

[0023] (2) Compared with the control group (CON) mice, the mice in the model group (HYP) had alveolar development arrest in the lung tissue, manifested as a 74.6% decrease in the radial alveolar count and a 61.83% increase in the mean linear intercept; the alveolar development arrest in the mice in the SS-31 treatment group (HYP+SS-31) was significantly improved, with an 81.25% increase in the radial alveolar count and a 17.87% decrease in the mean linear intercept.

[0024] (3) Compared with the mice in the model group (HYP), the mice in the SS-31 treatment group (HYP+SS-31) showed a decrease in both carbon dioxide emissions and oxygen consumption during both day and night, with a 21.6% decrease in carbon dioxide emissions and a 16.6% decrease in oxygen consumption, indicating that SS-31 significantly improved the energy metabolism of BPD mice.

[0025] (4) The content of lactate dehydrogenase in the cell supernatant of the model group (HYP) increased by 85.79% compared with the control group (CON); the mRNA levels of the type II alveolar epithelial cell markers SPB and SPC decreased by 66.61% and 73.08% respectively; the content of lactate dehydrogenase in the cell supernatant of the SS-31 treatment group (HYP + SS-31) decreased by 43.33% compared with the model group (HYP); the mRNA levels of the type II alveolar epithelial cell markers SPB and SPC increased by 90.64% and 180.30% respectively, indicating that SS-31 alleviates hyperoxia-induced alveolar epithelial cell injury and promotes alveolar development.

[0026] The present invention provides a new idea for the preparation of drugs for the treatment of BPD, applies SS-31 to the process of drug development related to BPD, so as to better treat BPD; at the same time, it broadens the selection field of drugs for the treatment of BPD and also makes contributions to the development of this technical field. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Schematic diagram of SS-31 increasing the body weight of BPD mice; (A) General view of the mice; (B) Body weight of the mice;

[0028] Figure 2 Schematic diagram of SS-31 improving alveolar development arrest in BPD mice; (A) H&E staining of mouse lung tissue; (B) Quantitative analysis of the number of radial alveoli (RAC) in lung tissue; (C) Quantitative analysis of the mean linear intercept (MLI) in lung tissue;

[0029] Figure 3 Schematic diagram of SS-31 improving the metabolism of BPD mice; (A) Carbon dioxide emission of mice in 24 hours; (B) Oxygen consumption of mice in 24 hours;

[0030] Figure 4 Schematic diagram of SS-31 alleviating hyperoxia-induced alveolar epithelial cell (MLE-12) injury; (A) Content of LDH in the supernatant of alveolar epithelial cells; (B) mRNA level of surfactant protein C (SPC); (C) mRNA level of surfactant protein B (SPB). DETAILED DESCRIPTION OF THE EMBODIMENTS

[0031] The following will clearly and completely describe the concept and technical effects generated by the present invention in combination with the embodiments to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative efforts belong to the scope of protection of the present invention.

[0032] The raw materials involved in the present invention:

[0033] SS-31 was purchased from MedChemExpress (MCE);

[0034] C57BL / 6 mice were all from the Experimental Animal Center of Jiangnan University.

[0035] The test methods involved in the present invention:

[0036] 1. Hyperoxia-induced BPD mouse model

[0037] C57BL / 6 mice at 6 - 8 weeks old were used. Adult mice were caged at a male - female ratio of 2:1. The next morning, the vaginal plugs of female mice were checked as the standard for successful pregnancy. The mice gave birth naturally on the 21st day of pregnancy and were randomly divided into a control group (CON), an SS - 31 intervention group (CON + SS - 31), a model group (HYP), and an SS - 31 treatment group (HYP + SS - 31), with 8 mice in each group. Newborn mice in the model group and the SS - 31 treatment group were continuously exposed to hyperoxia (85% O2) for 14 days. Mice in the SS - 31 intervention group and the SS - 1 treatment group were intraperitoneally injected with SS - 31 (5 mg / Kg) for three consecutive days starting from the 12th day. Mice in the control group and the model group were intraperitoneally injected with the same volume of PBS every day for 3 days. All mice were maintained in a pathogen - free environment and had unrestricted access to standard mouse food and water. The control group (CON), the SS - 31 intervention group (CON + SS - 31), the model group (HYP), and the SS - 31 treatment group (HYP + SS - 31) were each fed by four female mice. First, two of the female mice fed for 24 h, and then the control group (CON), the SS - 31 intervention group (CON + SS - 31), the model group (HYP), and the SS - 31 treatment group (HYP + SS - 31) rotated to be fed by the other two female mice in their respective groups to prevent the female mice from suffering from oxygen poisoning. The rotation was carried out until the 14th day after the mice were born.

[0038] 2. Alveolar epithelial cell culture and hyperoxia modeling

[0039] The mouse alveolar epithelial cell line (MLE - 12) was purchased from the Cell Bank of the Chinese Academy of Sciences' Culture Collection. MLE - 12 is an adherent - dependent epithelial - like cell, and its growth medium is DMEM (containing 10% FBS). The adherent cells grew and proliferated to form a monolayer of cells. The MLE - 12 cells were divided into a control group (CON), an SS - 31 intervention group (CON + SS - 31), a model group (HYP), and an SS - 31 treatment group (HYP + SS - 31). After pretreating the MLE - 12 cells with 20 μmol / L of SS - 31 for 10 min, they were cultured in a three - gas incubator with normal oxygen (21% O2) and hyperoxia (70% O2) respectively.

[0040] 3. Body weight measurement

[0041] From the 0th day after the mice were born, the body weights of the mice were measured at the same time every day and recorded until the 28th day after the mice were born.

[0042] 4. Detection of histopathological injury

[0043] First, the lung tissues of the mice were fixed by soaking in 4% paraformaldehyde, dehydrated with gradient alcohol with concentrations from 70% to 100%, made transparent with 100% xylene after dehydration, then immersed in wax in a wax bath, embedded, and finally paraffin sections were made. After staining with an H&E staining kit (Nanjing Jiancheng Company, D006-1-4), observations and photographs were taken under a microscope.

[0044] 5. Respiratory metabolism cage

[0045] Four-week-old mice were randomly placed in a metabolism cage and their body weights were recorded. With a constant temperature, humidity, and light cycle (usually 12 hours of light and 12 hours of darkness), they were allowed to eat and drink freely for 24 hours, and the data of their 24-hour carbon dioxide emissions and oxygen consumption were recorded.

[0046] 6. Detection of biochemical indicators

[0047] The content of LDH in the culture supernatant of MLE-12 cells was detected using a lactate dehydrogenase kit (Nanjing Jiancheng Biotech Company, A020-2-2);

[0048] 7. RT-qPCR experiment

[0049] (1) Total RNA extraction: 1 ml of Trizol was added to each well of a 6-well cell culture plate. After extracting total RNA by the Trizol method, the concentration and purity were measured with a microplate reader, and the absorbance ratio A260 / 280 was preferably between 1.8 and 2.0.

[0050] (2) Reverse transcription: 1 μg of RNA and 4 μl of 5×RT Master Mix were taken to form a 20 μl reverse transcription system, and the remaining volume was made up with RNase Free ddH20. The reverse transcription program was: ① 37°C, 15 min; ② 85°C, 5 s; ③ 4°C, hold. The cDNA obtained after reverse transcription was diluted to 100 μl as needed and stored at -20°C;

[0051] (3) Real-time fluorescence quantitative PCR (qPCR): The reaction system in each well of the special 96-well plate is 20 μl, including: 10 μl of 2×SYBR green Mix, 0.4 μl each of the upstream and downstream primers (10 μM), 2 μl of cDNA, and 7.2 μl of ddH20. After centrifugation, it is loaded onto the machine (β-actin upstream primer: GGCTGTATTCCCCTCCATCG, downstream primer: CCAGTTGGTAACAAT GCCATGT; SPB upstream primer: CTGCTTCCTACCCTCTGCTG, downstream primer: CTTGGCACAGGT CATTAGCTC; SPC upstream primer: ATGGACATGAGTAGCAAAGAGGT, downstream primer: CACGATG AGAAGGCGTTTGAG).

[0052] Example 1 Application of SS-31 in the treatment of BPD

[0053] The therapeutic effect of SS-31 on BPD was detected through animal and cell experiments. The specific methods are as follows:

[0054] 1. Animal experiment

[0055] C57BL / 6 mice at 6-8 weeks old were used. The mice were caged according to the male-female ratio of 2:1. The vaginal plugs of female mice were checked the next morning as the standard for successful pregnancy.

[0056] Newborn C57BL / 6 mice within five hours after birth were randomly divided into a control group (CON), an SS-31 intervention group (CON+SS-31), a model group (HYP), and an SS-31 treatment group (HYP+SS-31), with 8 mice in each group. Newborn mice in the model group and the SS-31 treatment group were continuously exposed to high oxygen (85% O2) for 14 days. Mice in the SS-31 intervention group and the SS-1 treatment group were intraperitoneally injected with SS-31 (5 mg / Kg) for three consecutive days starting from the 12th day. Mice in the control group and the model group were gavaged with the same volume of normal saline every day for 3 days. On the 15th day, the lung tissues of the mice were collected. The left lung was used for H&E staining, and the rest were used for biochemical tests and molecular biology experiments.

[0057] 2. Detection of therapeutic effect

[0058] (1) Body shape and weight

[0059] The results are as Figure 1As shown in A and B. The body size of the mice in the model group (HYP) was smaller and the body weight was lower compared with those in the control group (CON). The body size of the mice in the SS-31 treatment group (HYP+SS-31) increased and the body weight increased compared with those in the model group (HYP). Among them, * indicates the comparison between the model group (HYP) and the control group (CON), and # indicates the comparison between the SS-31 treatment group (HYP+SS-31) and the model group (HYP).

[0060] (2) H&E staining

[0061] The results are as Figure 2 shown in A, B, C and Table 1: The alveolar development of the mice in the model group (HYP) was significantly blocked compared with that in the control group (CON), manifested as a 74.6% decrease in the Radial Alveolar Count (RAC) and a 61.83% increase in the Mean Linear Intercept (MLI); there was no significant difference between the SS-31 intervention group (CON+SS-31) and the control group (CON), indicating that SS-31 had no drug toxicity; the alveolar simplification of the mice in the SS-31 treatment group (HYP+SS-31) was significantly improved compared with that in the model group (HYP), with an 81.25% increase in RAC and a 17.87% decrease in MLI.

[0062] Table 1. Quantitative H&E staining of mouse lung tissue

[0063] Radial Alveolar Count Mean Linear Intercept CON group 12.6±1.14 52.02±4.16 CON + SS-31 group 11.8±1.31 52.19±3.97 HYP group 3.2±0.84 84.18±5.36 HYP + SS-31 group 5.8±0.84 69.13±6.04

[0064] (3) Metabolic cage monitoring

[0065] The results are as Figure 3 shown in A, B and Table 2: The mice in the model group (HYP) showed an increase in carbon dioxide emissions and oxygen consumption both during the day and at night compared with those in the control group (CON), with a 90.4% increase in carbon dioxide emissions and a 69.1% increase in oxygen consumption; there was no significant difference in carbon dioxide emissions and oxygen consumption between the SS-31 intervention group (CON+SS-31) and the control group (CON); the mice in the SS-31 treatment group (HYP+SS-31) showed a certain degree of decrease in carbon dioxide emissions and oxygen consumption both during the day and at night compared with those in the model group (HYP), with a 21.6% decrease in carbon dioxide emissions and a 16.6% decrease in oxygen consumption.

[0066] Table 2. 24-hour metabolic data of mice

[0067]

[0068]

[0069] (4) Biochemical index detection

[0070] The MLE-12 cells were divided into a control group (CON), an SS-31 intervention group (CON+SS-31), a model group (HYP), and an SS-31 treatment group (HYP+SS-31). The SS-31 intervention group (CON+SS-31) and the SS-31 treatment group (HYP+SS-31) were pretreated with 20 μM SS-31 10 min in advance, and then the model group (HYP) and the SS-31 treatment group (HYP+SS-31) were cultured in a three-gas incubator containing high oxygen (70% O2), while the control group (CON) and the SS-31 intervention group (CON+SS-31) were cultured in a normal three-gas incubator. After 24 h, the cell culture supernatant was aspirated and the content of lactate dehydrogenase (LDH) was detected according to the kit instructions.

[0071] The results are as Figure 4 shown in Figure A and Table 3: The content of lactate dehydrogenase (LDH) in the cell culture supernatant of the model group (HYP) increased by 85.79% compared with that of the control group (CON); there was no significant difference in the LDH content between the SS-31 intervention group (CON+SS-31) and the control group (CON); the LDH content in the SS-31 treatment group (HYP+SS-31) decreased by 43.33% compared with that of the model group (HYP).

[0072] Table 3. Content of lactate dehydrogenase in the supernatant of MLE-12 cells

[0073] LDH (U / L) CON group 288.10±74.10 CON + SS-31 group 286.19±45.41 HYP group 535.24±29.70 HYP + SS-31 group 303.33±71.23

[0074] (5) RT-qPCR experiment

[0075] The results are as Figure 4 shown in Figure B, C and Table 4: The mRNA levels of surfactant SPB and SPC in the MLE-12 cells of the model group (HYP) decreased by 66.61% and 73.08% respectively compared with those of the control group (CON); the mRNA levels of surfactant SPB and SPC in the MLE-12 cells of the SS-31 treatment group (HYP+SS-31) increased by 90.64% and 180.30% respectively compared with those of the model group (HYP). It shows that SS-31 promotes the production of surfactant in alveolar epithelial cells induced by high oxygen and promotes alveolar development.

[0076] Table 4. mRNA levels in MLE-12 cells

[0077]

[0078] Although the present invention has been disclosed above in the preferred embodiments, it is not intended to limit the present invention. Any person skilled in this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. Use of SS-31 in the preparation of a medicament for treating bronchopulmonary dysplasia.

2. The application according to claim 1, characterized in that The chemical structural formula of the SS-31 is as follows:

3. The application according to claim 1, characterized in that, The bronchopulmonary dysplasia refers to a complication that occurs during the respiratory support treatment of a neonate, and its characteristic manifestation is: alveolar development arrest.

4. The application according to claim 1, wherein The medicament is any pharmaceutically acceptable dosage form.

5. The application according to claim 1, wherein The dosage form includes: tablets, oral liquids, injections, pills, powders or capsules.

6. The application according to claim 1, wherein The medicament further contains excipients.

7. The application according to claim 1, characterized in that The medicament further contains a drug carrier.

8. The application according to claim 7, characterized in that, The drug carrier includes any one of liposomes, nanoparticles, viral vectors, dendrimers, hydrogels, metal-organic frameworks and exosomes.

9. A drug for treating bronchopulmonary dysplasia, characterized in that, The active ingredient of the medicament includes SS-31.

10. Use of SS-31 in the preparation of a medicament for improving alveolar development arrest in lung tissue and dyspnea in bronchopulmonary dysplasia.