Oligonucleotide conjugates for inhibiting viral infection, pharmaceutical compositions and uses thereof

Abstract

The invention provides an oligonucleotide conjugate for inhibiting virus infection, a pharmaceutical composition and application of the oligonucleotide conjugate and the pharmaceutical composition, and belongs to the technical field of small nucleic acid drug delivery. The oligonucleotide conjugates provided by the present disclosure comprise a double-stranded oligonucleotide and a targeting ligand moiety chimeric with one or more antiviral nucleoside analogs, the targeting ligand moiety for targeted delivery of the oligonucleotide to the liver. The oligonucleotide conjugate and the pharmaceutical composition thereof provided by the invention can be used for treating HBV infection in a subject, and have relatively high in-vivo liver tissue delivery efficiency and relatively high antiviral effect.

Description

Technical Field

[0001] The present disclosure relates to the technical field of small nucleic acid drug delivery, and particularly relates to an oligonucleotide conjugate for inhibiting virus infection, a pharmaceutical composition comprising the oligonucleotide conjugate, and a preparation method and use thereof. Background Art

[0002] Oligonucleotides such as siRNA can be used to silence specific gene expression, thereby playing a role in treating diseases. In recent years, the affinity ligand N-acetylgalactosamine (GalNAc) of asialoglycoprotein receptor (ASGPR) is usually used as a targeting molecule for liver-targeted delivery of nucleic acid drugs. When siRNA contacts diseased cells (such as cells infected with hepatitis B virus), siRNA can be used as a therapeutic agent for anti-viral infection.

[0003] In the prior art, molecular anti-viral drugs for viral diseases such as hepatitis B have been developed, such as unnatural nucleoside analogs and nucleotide analogs, which can replace nucleosides to play an anti-infection role by terminating the synthesis of viral nucleic acid chains. Summary of the Invention

[0004] The present disclosure provides an oligonucleotide conjugate incorporating an anti-viral nucleoside analog, a pharmaceutical composition and uses thereof, belonging to the technical field of small nucleic acid drug delivery. The oligonucleotide conjugate provided by the present disclosure comprises a double-stranded oligonucleotide and a targeting ligand moiety incorporating one or more anti-viral nucleoside analogs, and the targeting ligand moiety is used to target and deliver the oligonucleotide to the liver. The oligonucleotide conjugate and the pharmaceutical composition provided by the present disclosure can be used to treat HBV infection in a subject, and have both a high in vivo liver tissue delivery efficiency and a high anti-viral effect.

[0005] In the present disclosure, by way of example, the monomer molecule of the anti-viral nucleoside analog is ETV

[0006] In particular, although one or more anti-viral nucleoside analogs in the oligonucleotide conjugate molecule provided by the present disclosure are located at the ends of the oligonucleotide molecule, but not restrictively, the nucleoside analogs can also be present within the oligonucleotide molecule.

[0007] In a first aspect of the present disclosure, the present disclosure provides an oligonucleotide conjugate having a structure represented by the following formula (I), or an isomer thereof, or a pharmaceutically acceptable salt thereof:

[0008]

[0009] Wherein, represents a double-stranded oligonucleotide (siRNA), AS represents the antisense strand of the double-stranded oligonucleotide molecule; SS represents the sense strand of the double-stranded oligonucleotide molecule;

[0010] M1 and M2 are independently selected from targeting ligand molecules capable of binding to liver cell surface receptors;

[0011] m1 and m2 are independently selected from integers from 0 to 6, and m1 and m2 are not both 0;

[0012] n1 and n2 are independently selected from integers from 0 to 6, and n1 and n2 are not both 0;

[0013] Each Z is independently selected from a hydroxyl group or a mercapto group;

[0014] Optionally, both M1 and M2 comprise an asialoglycoprotein receptor ligand moiety;

[0015] Optionally, the asialoglycoprotein receptor ligand moiety comprises a galactose or its derivative unit;

[0016] Optionally, the galactose or its derivative unit includes, but is not limited to, galactose, galactosamine, N-formylgalactosamine, N-acetylgalactosamine (GalNAc), N-propionylgalactosamine, N-n-butyrylgalactosamine, or N-isobutyrylgalactosamine;

[0017] Optionally, the asialoglycoprotein receptor ligand moiety comprises an N-acetylgalactosamine unit.

[0018] In a second aspect of the present disclosure, the present disclosure provides a composition comprising the oligonucleotide conjugate described in the first aspect of the present disclosure.

[0019] In some alternative embodiments of the present disclosure, the composition further comprises a physiologically acceptable excipient.

[0020] In a third aspect of the present disclosure, the present disclosure provides the use of the oligonucleotide conjugate described in the first aspect of the present disclosure or the composition described in the second aspect of the present disclosure in the preparation of a medicament for treating and / or preventing a pathological condition or disease caused by HBV virus in liver cells.

[0021] In a fourth aspect of the present disclosure, the present disclosure provides a method for inhibiting HBV gene expression in liver cells, the method comprising contacting a liver cell with an effective amount of the oligonucleotide conjugate described in the first aspect of the present disclosure or the composition described in the second aspect of the present disclosure.

[0022] In a fifth aspect of the present disclosure, the present disclosure provides a kit comprising the oligonucleotide conjugate described in the first aspect of the present disclosure or the composition described in the second aspect of the present disclosure.

[0023] The oligonucleotide conjugates, pharmaceutical compositions and kits provided by the present disclosure can be used for treating and / or preventing pathological conditions or diseases caused by HBV virus in hepatocytes, and have high in vivo liver tissue delivery efficiency and good antiviral effects. Description of the Drawings

[0024] Figure 1 Results of the effect of administering the siRNA conjugate on the relative expression level of HBV DNA in HepG2.25 cells.

[0025] Figure 2 Results of the effect of administering the siRNA conjugate on the relative expression level of HBV mRNA in HepG2.25 cells. Detailed Embodiments

[0026] The present disclosure discloses an oligonucleotide conjugate, a pharmaceutical composition for treating viral infections, and their uses. Those skilled in the art can draw on the content of this article and appropriately improve the process parameters to achieve. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all regarded as included in the present disclosure. The methods and applications of the present disclosure have been described through preferred embodiments, and those skilled in the art can obviously make changes or appropriate modifications and combinations to the methods and applications described herein without departing from the content, spirit and scope of the present disclosure to implement and apply the technology of the present disclosure.

[0027] Glossary of Terms

[0028] In the present disclosure, the term "comprising" or "including" is an open expression, that is, it includes the content specified in the present disclosure, but does not exclude other aspects of the content.

[0029] In the present disclosure, the terms "optionally", "optional" or "option" generally mean that the subsequent events or conditions may or may not occur, and this description includes the cases where the events or conditions occur and the cases where the events or conditions do not occur.

[0030] In the present disclosure, the term "optionally substituted" is used to define a variable, which may be unsubstituted or substituted.

[0031] In the present disclosure, the term "unsubstituted" means that the specified group does not carry a substituent.

[0032] In the present disclosure, the terms "substituted", "substituted with" and "substitution" are used interchangeably, indicating that any one or more hydrogen atoms in the given structure are replaced by specific substituents (for example: C 1-3 alkyl, C 1-3is replaced by an alkoxy group or a halogen, provided that the normal valence of the specified atom is not exceeded and the substitution results in a stable compound. Unless otherwise indicated, a substituted group may have a substituent at each substitutable position of the group. When more than one position in the given structural formula can be substituted by one or more substituents selected from a specific group, then the substituents may be the same or different at each substitutable position.

[0033] In the present disclosure, the terms "each... independently selected from", "... each independently selected from", and "... independently selected from" are interchangeable and should be understood in a broad sense. It can either mean that among different groups, the specific options expressed between the same symbols do not affect each other, or it can also mean that within the same group, the specific options expressed between the same symbols do not affect each other.

[0034] In the present disclosure, the term "isomer" includes stereoisomers and tautomers.

[0035] In the present disclosure, the term "stereoisomer" refers to a compound having the same chemical structure but different spatial arrangements of atoms or groups. Stereoisomers include enantiomers, diastereomers, conformational isomers (rotational isomers), geometric isomers (cis / trans isomers), atropisomers, and so on.

[0036] In the present disclosure, the term "chiral" refers to a molecule that has the property of not being able to overlap with its mirror image; while "achiral" refers to a molecule that can overlap with its mirror image.

[0037] In the present disclosure, the term "enantiomer" refers to two isomers of a compound that cannot overlap but are mirror images of each other.

[0038] In the present disclosure, the term "diastereomer" refers to stereoisomers that have two or more chiral centers and whose molecules are not mirror images of each other. Diastereomers have different physical properties, such as melting point, boiling point, spectral properties, and reactivity. A mixture of diastereomers can be separated by high-resolution analytical operations such as electrophoresis and chromatography, such as HPLC.

[0039] In the present disclosure, the term "tautomer" refers to functional group isomers resulting from the rapid movement of a certain atom in a molecule between two positions. For example, a compound containing a carbonyl group, if there is a hydrogen atom at the adjacent position (α-position) of the carbonyl carbon, exhibits keto-enol tautomerism.

[0040] In the present disclosure, the term "pharmaceutically acceptable salt" includes pharmaceutically acceptable acid addition salts and pharmaceutically acceptable base addition salts.

[0041] In the present disclosure, the term "double-stranded oligonucleotide" refers to a double-stranded structure formed by two oligonucleotides through partial or complete base complementary pairing. The two oligonucleotides include a sense strand and an antisense strand. The lengths of the sense strand and the antisense strand can be the same or different, as long as there is at least a partial base complementary pairing region to form a duplex region. The oligonucleotide with a double-stranded structure belongs to the double-stranded oligonucleotide described in the present disclosure. The nucleotides constituting the double-stranded oligonucleotide in the present disclosure can be modified or unmodified nucleotides. When referring to modified nucleotides, unless otherwise specified, the modifications described in the present disclosure do not specifically refer to the modification sites. In the present disclosure, in addition to the modification of nucleotides in the double-stranded oligonucleotide, the linking bonds between nucleotides can also be modified. The double-stranded oligonucleotide containing the linking bonds between modified nucleotides also belongs to the double-stranded oligonucleotide described in the present invention. In the present disclosure, in addition to the nucleotide part, the double-stranded oligonucleotide can also contain acceptable compound molecules or modifiers in the art to improve the properties of the double-stranded oligonucleotide, such as forming a conjugate by linking a ligand.

[0042] In the present disclosure, the term "ligand" or "conjugating group" refers to an atom or atomic group that binds to an oligonucleotide or other oligomer. Generally speaking, the conjugating group modifies one or more properties of the compound to which it is attached, including but not limited to pharmacodynamic, pharmacokinetic, binding, absorption, cellular distribution, cellular uptake, charge, and / or clearance properties. When referring to the connection between two molecules, the term "link" used herein means that the two molecules are directly or indirectly connected by a covalent bond, or the two molecules are associated by a non-covalent bond (e.g., hydrogen bond or ionic bond).

[0043] In the present disclosure, the term "pharmaceutical composition" or "composition" can refer to the treatment of diseases and can also be used in in vitro cell culture experiments. When used for the treatment of diseases, the term "pharmaceutical composition" usually refers to a unit dosage form and can be prepared by any of the methods well known in the pharmaceutical field. All methods include the step of combining the active ingredient with excipients constituting one or more accessory ingredients. Generally, the composition is prepared by uniformly and sufficiently combining the active siRNA with liquid excipients, finely divided solid excipients, or both.

[0044] In the present disclosure, the term "pharmaceutically acceptable" means that a substance or composition must be chemically and / or toxicologically compatible with other components of the formulation and / or the mammal being treated therewith. Preferably, the "pharmaceutically acceptable" described in the present disclosure refers to those approved by federal regulatory agencies or national governments or listed in the United States Pharmacopeia or other generally recognized pharmacopeias for use in animals, especially in humans.

[0045] In the present disclosure, the term "physiologically acceptable excipient" may include any solvent, solid excipient, diluent, or other liquid excipient, etc., suitable for a particular target dosage form. Their use is also contemplated in the present disclosure, except to the extent that any conventional excipients are incompatible with the siRNA of the present disclosure, such as any adverse biological effects produced or interactions with any other component of the pharmaceutically acceptable composition in a harmful manner.

[0046] In the present disclosure, the term "Small interfering RNA (siRNA)" refers to a double-stranded RNA that is 17 to 25 nucleotides in length and contains a sense strand and an antisense strand. siRNA mediates the targeted cleavage of RNA transcripts in the RISC pathway by forming the RNA-induced silencing complex (RISC). Specifically, siRNA directs the specific degradation of mRNA sequences through the known process of RNA interference (RNAi), inhibiting the translation of mRNA into amino acids and the conversion into proteins.

[0047] In the present disclosure, the term "complementary" means that a nucleic acid can form hydrogen bonds with another nucleic acid sequence through conventional Watson-Crick or other non-conventional types. "Complementary" or fully complementary means that all consecutive residues of a nucleic acid sequence will form hydrogen bonds with the same number of consecutive residues in a second nucleic acid sequence. Incomplete complementarity refers to the situation where some (but not all) nucleoside units of the two strands can hydrogen bond to each other. "At least partially complementary" means that a polynucleotide chain exhibits complementarity with no more than three nucleotide differences, excluding regions of the polynucleotide chain that are selected to be non-complementary, such as overhangs.

[0048] In the present disclosure, the terms "treat", "alleviate", or "ameliorate" may be used interchangeably herein. These terms refer to methods of obtaining a beneficial or desired result, including but not limited to a therapeutic benefit. A "therapeutic benefit" means eradicating or ameliorating the underlying disorder being treated. Here, a therapeutic benefit is obtained by eradicating or ameliorating one or more physiological symptoms associated with the underlying disorder, such that an improvement is observed in the subject, although the subject may still be afflicted with the underlying disorder.

[0049] In the present disclosure, the terms "prevent" and "preclude" may be used interchangeably, and refer to methods of obtaining a beneficial or desired result, including but not limited to a prophylactic benefit. To obtain a "prophylactic benefit", the conjugate, RNAi reagent, or composition may be administered to a subject at risk of developing a particular disease, or to a subject reporting one or more physiological symptoms of a disease, even if a diagnosis of the disease may not have been made.

[0050] In the present disclosure, the term "administer" generally refers to introducing a pharmaceutical preparation of the present disclosure into the body of a subject by any route of introduction or delivery. Any method known to those skilled in the art for bringing a cell, organ, or tissue into contact with the drug can be employed. The administration can include, but is not limited to, intravenous, intraarterial, intranasal, intraperitoneal, intramuscular, subcutaneous, or oral. The daily dose can be divided into one, two, or more appropriate forms of doses for administration at one, two, or more times during a certain period.

[0051] As used in the present disclosure, the term "regulate gene expression" means that the expression of a gene, or the level of an RNA molecule or an equivalent RNA molecule encoding one or more proteins or protein subunits, is upregulated or downregulated such that the expression level or activity is greater than or less than that observed in the absence of the regulator. For example, the term "regulate" can mean "inhibit", but the use of the word "regulate" is not limited to this definition.

[0052] In addition to any conventional excipients, the scope of incompatibility with the siRNA of the present disclosure, such as any adverse biological effects produced or interactions with any other components of the pharmaceutically acceptable composition in a harmful manner, their uses are also within the scope contemplated by the present disclosure.

[0053] Oligonucleotide Conjugate

[0054] In a first aspect, the present disclosure provides an oligonucleotide conjugate having a structure represented by the following formula (I), or an isomer thereof, or a pharmaceutically acceptable salt thereof:

[0055]

[0056] Wherein, represents a double-stranded oligonucleotide (siRNA), AS represents the antisense strand of the double-stranded oligonucleotide molecule; SS represents the sense strand of the double-stranded oligonucleotide molecule;

[0057] M1 and M2 are independently selected from targeting ligand molecules capable of binding to hepatocyte surface receptors;

[0058] m1 and m2 are independently selected from integers from 0 to 6, and m1 and m2 are not both 0;

[0059] n1 and n2 are independently selected from integers from 0 to 6, and n1 and n2 are not both 0;

[0060] Each Z is independently selected from a hydroxyl group or a mercapto group;

[0061] In some alternative embodiments of the present disclosure, both M1 and M2 comprise an asialoglycoprotein receptor ligand moiety;

[0062] In some alternative embodiments of the present disclosure, the asialoglycoprotein receptor ligand moiety comprises a galactose or its derivative unit;

[0063] In some alternative embodiments of the present disclosure, the galactose or its derivative unit includes but is not limited to galactose, galactosamine, N-formylgalactosamine, N-acetylgalactosamine (GalNAc), N-propionylgalactosamine, N-n-butyrylgalactosamine, or N-isobutyrylgalactosamine;

[0064] In a preferred embodiment of the present disclosure, the asialoglycoprotein receptor ligand moiety comprises an N-acetylgalactosamine unit.

[0065] In some alternative embodiments of the present disclosure, the conjugate has the structure shown in formula (II) or formula (III), or an isomer thereof, or a pharmaceutically acceptable salt thereof:

[0066]

[0067]

[0068] wherein each p is independently selected from 1, 2, or 3; each q is independently selected from 1, 2, or 3;

[0069] Each A is independently selected from an optionally substituted 4- to 10-membered ring, and the ring is selected from an alicyclic ring, an aromatic ring, or a heteroaromatic ring;

[0070] Each R is independently selected from H, an optionally substituted C1-C6 alkyl, or an optionally substituted C1-C6 alkoxy;

[0071] Each L is independently selected from an optionally substituted C2-C 20 alkylene or R La and R Lb are independently selected from an optionally substituted C1-C 10 alkylene, and i is selected from 1, 2, 3, 4, or 5;

[0072] Each Y is independently selected from O, S, or -NH-.

[0073] In some alternative embodiments of the present disclosure, Z is selected from a hydroxyl group;

[0074] In some alternative embodiments of the present disclosure, p is selected from 1;

[0075] In some alternative embodiments of the present disclosure, q is selected from 1;

[0076] In some alternative embodiments of the present disclosure, each A is independently selected from

[0077] In some alternative embodiments of the present disclosure, A is selected from

[0078] In some alternative embodiments of the present disclosure, R is selected from H;

[0079] In some alternative embodiments of the present disclosure, each of said Ls is independently selected from optionally substituted C2-C 10 alkylene or wherein, R La and R Lb are independently selected from optionally substituted C1-C 10 alkylene, and k is selected from 1, 2 or 3;

[0080] In some alternative embodiments of the present disclosure, k is selected from 1;

[0081] In some alternative embodiments of the present disclosure, each L is independently selected from

[0082] In some alternative embodiments of the present disclosure, L is selected from

[0083] In some alternative embodiments of the present disclosure, the conjugate has the structure shown in formula (IV) or formula (V), or an isomer thereof, or a pharmaceutically acceptable salt thereof:

[0084]

[0085] The definitions of the respective substituents are the same as above.

[0086] In some alternative embodiments of the present disclosure, the conjugate has the structure shown in formula (VI) or formula (VII), or an isomer thereof, or a pharmaceutically acceptable salt thereof:

[0087]

[0088] The definitions of the respective substituents are the same as above.

[0089] In some alternative embodiments of the present disclosure, the conjugate has any of the following structures, or an isomer thereof, or a pharmaceutically acceptable salt thereof:

[0090]

[0091] wherein, m1, n1, m2, n2 are each independently selected from integers from 0 to 3; and m1 and m2 are not both 0, and n1 and n2 are not both 0;

[0092] In some alternative embodiments of the present disclosure, the conjugate has the following structure:

[0093]

[0094] In some alternative embodiments of the present disclosure, the conjugate has the following structure:

[0095]

[0096] In some alternative embodiments of the present disclosure, n2 is 3, m2 is 3; Z is a hydroxyl group.

[0097] In some alternative embodiments of the present disclosure, the double-stranded oligonucleotide in the oligonucleotide conjugate targets the HBV viral gene and inhibits the abnormal expression of the mRNA of the HBV gene in hepatocytes;

[0098] The double-stranded oligonucleotide includes a sense strand and an antisense strand, and the antisense strand is at least partially complementary to the sense strand to form a duplex region; wherein, the antisense strand is complementary or at least partially complementary to the mRNA of the HBV gene;

[0099] In some alternative embodiments of the present disclosure, each of the sense strand and the antisense strand of the double-stranded oligonucleotide contains at least partially modified nucleotides;

[0100] In some alternative embodiments of the present disclosure, at least one phosphorothioate bond is included in the sense strand and / or the antisense strand;

[0101] In some alternative embodiments of the present disclosure, the sense strand and the antisense strand contain at least 15 consecutive nucleotides, wherein the antisense strand is complementary to the mRNA of the HBV gene;

[0102] In some alternative embodiments of the present disclosure, the conjugating group is connected to the end of the sense strand and / or the antisense strand of the double-stranded oligonucleotide;

[0103] In some alternative embodiments of the present disclosure, the conjugating group is connected to the 3'-end of the sense strand.

[0104] In some alternative embodiments of the present disclosure, the conjugating group is connected to the 3'-end of the antisense strand.

[0105] In some alternative embodiments of the present disclosure, the conjugating group is respectively and simultaneously connected to the 3'-ends of the sense strand and the antisense strand.

[0106] In some alternative embodiments of the present disclosure, each nucleotide in the duplex region formed by the sense strand and the antisense strand of the double-stranded oligonucleotide is independently a modified nucleotide, wherein the sense strand contains a nucleotide sequence in the mRNA of the HBV virus;

[0107] Wherein, the modified nucleotides are independently selected from abasic nucleotides, 2'-halo modifications, 2'-deoxy modifications, or 2'-O-(CH2) n -R modified nucleotides, or nucleotide analogs; optionally, the nucleotide analogs are selected from one or more of PNA, MNA, BNA, LNA, GNA, TNA, and UNA; wherein, n is selected from 0, 1, or 2, and R is selected from optionally substituted C 1-6 alkyl, optionally substituted C 1-6 alkoxy, and the substitution means that one or more hydrogen atoms on the alkyl or alkoxy are substituted by substituents; optionally, the 2'-O-(CH2) n -R is selected from 2'-O-CH3, 2'-O-CH2-CH3, 2'-O-CH2-O-CH2-CH3, 2'-O-CH2-O-CH2-CF3, or 2'-O-CH2-CH2-O-CH3;

[0108] In some alternative embodiments of the present disclosure, the sense strand has a length of 17-21 nucleotides, and the antisense strand has a length of 19-23 nucleotides;

[0109] In some alternative embodiments of the present disclosure, in the duplex region, in the direction from the 5'-end to the 3'-end, at least three nucleotides among the nucleotides at positions 7-10 of the nucleotide sequence in the sense strand are selected from 2'-fluoro-modified nucleotides, and the remaining nucleotides are selected from 2'-O-methyl-modified nucleotides or 2'-O-methoxyethyl-modified nucleotides; among the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence in the antisense strand, the nucleotides are selected from 2'-fluoro-modified nucleotides, and any one of the nucleotides at positions 9, 10, 11, and 12 is selected from 2'-fluoro-modified nucleotides, and the remaining nucleotides are selected from 2'-O-methyl-modified nucleotides or 2'-O-methoxyethyl-modified nucleotides;

[0110] In some alternative embodiments of the present disclosure, in the duplex region, in the direction from the 5'-end to the 3'-end, at least three nucleotides among the nucleotides at positions 7-10 of the nucleotide sequence in the sense strand are selected from 2'-fluoro-modified nucleotides, at most two nucleotides among the nucleotides at positions 5, 12, and 18 are selected from 2'-O-methoxyethyl-modified nucleotides, and the remaining nucleotides are selected from 2'-O-methyl-modified nucleotides; among the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence in the antisense strand, the nucleotides are selected from 2'-fluoro-modified nucleotides, any one of the nucleotides at positions 9-12 is selected from 2'-fluoro-modified nucleotides, the nucleotide at position 15 is selected from 2'-O-methoxyethyl-modified nucleotides, and the remaining nucleotides are selected from 2'-O-methyl-modified nucleotides;

[0111] In some alternative embodiments of the present disclosure, in the duplex region, the modification of the sense strand and / or the antisense strand is selected from any one of the following (1)-(8):

[0112] (1) In the direction from the 5'-end to the 3'-end, the nucleotides at positions 7-10 of the nucleotide sequence in the sense strand are selected from 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides; the nucleotides at positions 2, 6, 9, 14, and 16 of the nucleotide sequence in the antisense strand are selected from 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides;

[0113] (2) In the direction from the 5'-end to the 3'-end, the nucleotides at positions 7-10 of the nucleotide sequence in the sense strand are selected from 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides; the nucleotides at positions 2, 6, 12, 14, and 16 of the nucleotide sequence in the antisense strand are selected from 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides;

[0114] (3) In the direction from the 5'-end to the 3'-end, the nucleotides at positions 7-10 of the nucleotide sequence in the sense strand are selected from 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides; the nucleotides at positions 2, 6, 9, 14, and 16 of the nucleotide sequence in the antisense strand are selected from 2'-fluoro-modified nucleotides, the nucleotide at position 15 is selected from 2'-O-methoxyethyl-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides;

[0115] (4) In the direction from the 5'-end to the 3'-end, the nucleotides at positions 7-10 of the nucleotide sequence in the sense strand are selected from 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides; the nucleotides at positions 2, 6, 12, 14, and 16 of the nucleotide sequence in the antisense strand are selected from 2'-fluoro-modified nucleotides, the nucleotide at position 15 is selected from 2'-O-methoxyethyl-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides;

[0116] (5) In the 5'-terminal to 3'-terminal direction, the nucleotide at the 5th, or 12th, or 18th position of the nucleotide sequence in the sense strand is selected from 2'-O-methoxyethyl-modified nucleotides, the nucleotides at the 7th - 10th positions are selected from 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides; the nucleotides at the 2nd, 6th, 9th, 14th, and 16th positions of the nucleotide sequence in the antisense strand are selected from 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides;

[0117] (6) In the 5'-terminal to 3'-terminal direction, the nucleotide at the 5th, or 12th, or 18th position of the nucleotide sequence in the sense strand is selected from 2'-O-methoxyethyl-modified nucleotides, the nucleotides at the 7th - 10th positions are selected from 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides; the nucleotides at the 2nd, 6th, 12th, 14th, and 16th positions of the nucleotide sequence in the antisense strand are selected from 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides;

[0118] (7) In the 5'-terminal to 3'-terminal direction, the nucleotide at the 5th, or 12th, or 18th position of the nucleotide sequence in the sense strand is selected from 2'-O-methoxyethyl-modified nucleotides, the nucleotides at the 7th - 10th positions are selected from 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides; the nucleotides at the 2nd, 6th, 9th, 14th, and 16th positions of the nucleotide sequence in the antisense strand are selected from 2'-fluoro-modified nucleotides, the nucleotide at the 15th position is selected from 2'-O-methoxyethyl-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides;

[0119] (8) In the 5'-terminal to 3'-terminal direction, the nucleotide at the 5th, or 12th, or 18th position of the nucleotide sequence in the sense strand is selected from 2'-O-methoxyethyl-modified nucleotides, the nucleotides at the 7th - 10th positions are selected from 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides; the nucleotides at the 2nd, 6th, 12th, 14th, and 16th positions of the nucleotide sequence in the antisense strand are selected from 2'-fluoro-modified nucleotides, the nucleotide at the 15th position is selected from 2'-O-methoxyethyl-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides.

[0120] In some alternative embodiments of the present disclosure, in the double-stranded oligonucleotide, in the direction from the 5'-end to the 3'-end, there are 1 or 2 consecutive phosphorothioate bonds between the terminal nucleotides at the 5'-end of the sense strand; and / or, the 5'-end and the 3'-end of the antisense strand each independently contain 1 or 2 consecutive phosphorothioate bonds;

[0121] In some alternative embodiments of the present disclosure, the double-stranded oligonucleotide further contains an overhang sequence with a length of 1 to 3 nucleotides; optionally, the overhang is connected to the 3'-end of the antisense strand, thereby forming an antisense strand 3'-overhang;

[0122] In some alternative embodiments of the present disclosure, the nucleotide sequence of the double-stranded oligonucleotide is selected from any one of those in Table 1, or a sequence that differs from it by no more than three nucleotide differences.

[0123] Composition

[0124] In a second aspect, the present disclosure provides a composition, which comprises the oligonucleotide conjugate described in the first aspect of the present disclosure and a physiologically acceptable excipient.

[0125] Use

[0126] In a third aspect, the present disclosure provides the use of the oligonucleotide conjugate described in the first aspect of the present disclosure or the composition described in the second aspect of the present disclosure in the preparation of a drug for treating and / or preventing a pathological condition or disease caused by HBV virus in hepatocytes.

[0127] Method for Inhibiting HBV Gene Expression in Hepatocytes

[0128] In a fourth aspect, the present disclosure provides a method for inhibiting HBV gene expression in hepatocytes, wherein the method comprises contacting an effective amount of the oligonucleotide conjugate described in the first aspect of the present disclosure or the composition described in the second aspect of the present disclosure with the hepatocytes.

[0129] Kit

[0130] In a fifth aspect, the present disclosure provides a kit, which comprises the oligonucleotide conjugate described in the first aspect of the present disclosure or the composition described in the second aspect of the present disclosure

[0131] The oligonucleotide conjugate, pharmaceutical composition and kit provided by the present disclosure can be used for treating and / or preventing a pathological condition or disease caused by HBV virus in hepatocytes. The oligonucleotide conjugate comprises a double-stranded oligonucleotide and a ligand incorporating one or more antiviral nucleoside analogs, which is used to target the delivery of the oligonucleotide to the liver, and has a high in vivo liver tissue delivery efficiency and a good antiviral effect.

[0132] To make the objectives, technical solutions, and advantages of the present disclosure clearer, the following will further describe the implementation solutions of the present disclosure in detail in conjunction with examples.

[0133] Preparation of Compounds

[0134] Preparation Example 1: Synthesis of Compound ETV

[0135] In this preparation example, the synthesis route of compound ETV is as follows:

[0136] Synthesis of Compound ETV-02

[0137] Dissolve compound ETV-01 (5.0 g, 18.03 mmol, 1 eq, entecavir, CAS No. 142217-69-4) in pyridine (50 ml), cool the temperature to 0 °C in an ice bath, and dropwise add isobutyryl chloride (4.42 g, 41.47 mmol, 2.3 eq, CAS No. 79-30-1) at 0 °C, and stir and react for 2 hours at 25 °C. After the reaction is completed, rotate and dry the reaction solution to remove pyridine, add saturated ammonium bicarbonate aqueous solution (100 mL), extract with ethyl acetate three times (100 ml each time), combine the organic phases, wash the organic phases twice with saturated sodium chloride aqueous solution (50 ml each time), dry with anhydrous sodium sulfate, filter, concentrate, and purify by reverse-phase column chromatography (eluent: water / acetonitrile = 78 / 22, v / v), to obtain compound ETV-02 in the form of a white solid (4.0 g, yield 63.9%). MS-ESI (m / z) = 348.2 [M+H] + .

[0138] (1-2) Synthesis of Compound ETV-03

[0139] Dissolve compound ETV-02 (4.0 g, 11.53 mmol, 1.0 eq) in pyridine (40 ml), cool the temperature to 0 °C in an ice bath, and add 4,4'-dimethoxytriphenylmethyl chloride (4,4'-dimethoxytriphenylmethyl chloride, 5.86 g, 17.3 mmol, 1.5 eq, CAS No. 40615-36-9, abbreviated as DMTrCl) in batches at 0 °C, and stir for 1 hour at 0 °C. After the reaction is completed, quench the reaction solution with methanol, concentrate to remove pyridine, add saturated ammonium chloride aqueous solution (50 mL), extract twice with ethyl acetate (50 ml each time), combine the organic phases, wash the organic phase once with saturated sodium chloride aqueous solution (50 ml each time), dry over anhydrous sodium sulfate, filter, concentrate, and purify by normal-phase column chromatography (eluent: petroleum ether / ethyl acetate = 1 / 2, v / v) to obtain compound ETV-03 in the form of a yellow solid (5.4 g, yield 72.2%). MS-ESI (m / z) = 650.8 [M+H] + 。

[0140] (1-3) Synthesis of compound ETV

[0141] Dissolve compound ETV-03 (5.4 g, 8.31 mmol, 1.0 eq) in anhydrous dichloromethane (50 ml), add 4,5-dicyanoimidazole (785 mg, 6.65 mmol, 0.8 eq, CAS No. 1122-28-7, abbreviated as DCI) and bis(diisopropylamino)(2-cyanoethoxy)phosphine (2.63 g, 8.73 mmol, 1.05 eq, CAS No. 102691-36-1) respectively, displace with nitrogen 3 times, and stir the reaction system at 25 °C for 1 hour in a nitrogen atmosphere. After the reaction is completed, wash the reaction solution twice with saturated sodium bicarbonate aqueous solution (30 ml each time) and once with saturated sodium chloride aqueous solution (10 ml each time), separate the organic phase, dry the organic phase over anhydrous sodium sulfate, filter, concentrate, and purify by reverse-phase column chromatography (eluent: water / acetonitrile = 10 / 90, v / v) to obtain compound ETV in the form of a white solid (5.01 g, yield 71.0%). MS-ESI (m / z) = 850.9 [M+H] + 。

[0142] Preparation Example 2: Synthesis of compound CR01008 and compound CR01008Z

[0143] (2-1) Synthesis of Compound CR01008

[0144] In this preparation example, the synthesis route of compound CR01008 is as follows:

[0145]

[0146] (2-1-1) Synthesis of Compound CR01008-02

[0147] Dissolve Compound CR01008-01 (trans-4-(Boc-amino)cyclohexanecarbaldehyde, 10.0 g, 1.0 eq) and aqueous formaldehyde solution (8.9 g, 37 wt%, 2.4 eq) in 33 ml of methanol. Dropwise add 13 ml of an aqueous KOH solution with a concentration of 45.3 wt%. After the addition is complete, stir the reaction at 25 °C for 30 minutes, then heat to 60 °C and reflux the reaction at 60 °C for 2 hours. After the reaction is completed, allow the reaction solution to cool to room temperature and then evaporate the reaction solution to dryness under reduced pressure to obtain a crude product in the form of a white solid. Add a small amount of water to the crude product for pulping, filter, and obtain Compound CR01008-02 in the form of a white solid (9 g, yield 78.9%). MS-ESI (m / z) = 260 [M+H] + .

[0148] (2-1-2) Synthesis of Compound CR01008-03

[0149] Dissolve Compound CR01008-02 (9 g, 1 eq) in 70 ml of 1,4-dioxane, add a 1,4-dioxane solution of hydrogen chloride (45 ml, 4 M), and stir the reaction at 25 °C for 1 hour. After the reaction is completed, evaporate the reaction solution to dryness under reduced pressure to obtain Compound CR01008-03 in the form of a white solid (6.8 g, yield 100%).

[0150] (2-1-3) Synthesis of Compound CR01008-05

[0151] Dissolve Compound CR01008-03 (1.8 g, 2.0 eq), Compound CR01008-04 (5-[[(2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)-2-tetrahydropyranyl]oxy]pentanoic acid, 2.1 g, 1.0 eq), and N,N-diisopropylethylamine (3.5 g, 6.0 eq, abbreviated as DIEA) in 15 ml of DMF. Add HBTU (1.9 g, 1.1 eq) and stir the reaction at 25 °C for 3 hours under a nitrogen atmosphere. After the reaction is completed, evaporate the reaction solution to dryness under reduced pressure and purify by reverse-phase column chromatography (eluent: acetonitrile / water = 22 / 78, v / v) to obtain Compound 5 in the form of a white solid (1.78 g, yield 64.4%). MS-ESI (m / z) = 589 [M+H] + .

[0152] (2-1-4) Synthesis of Compound CR01008-06

[0153] Dissolve compound CR01008-05 (1.54 g, 1.0 eq) in 15 ml of pyridine. Cool the reaction system to 0 °C in an ice-water bath and add 4,4'-dimethoxytriphenylchloromethane (1.32 g, 1.5 eq, abbreviated as DMTrCl, CAS No. 40615-36-9) at 0 °C. React at 25 °C for 3 hours, and add 15 ml of methanol to the reaction solution to quench the reaction. After the reaction is completed, evaporate the reaction solution to dryness under reduced pressure, and purify by reverse-phase column chromatography (eluent: acetonitrile / water = 60 / 40, v / v) to obtain compound CR01008-06 in the form of a yellow solid (1 g, yield 42.7%). MS-ESI (m / z) = 891 [M+H] + .

[0154] (2-1-5) Synthesis of compound CR01008

[0155] Dissolve compound CR01008-06 (1.08 g, 1.0 eq) in 20 ml of anhydrous dichloromethane. Add DCI (115 mg, 0.8 eq) and bis(diisopropylamino)(2-cyanoethoxy)phosphine (732 mg, 2.1 eq) respectively. Replace the gas with nitrogen 3 times and stir and react at 25 °C for 2 hours. After the reaction is completed, add 20 ml of saturated sodium bicarbonate aqueous solution to the reaction solution, extract with 20 ml of dichloromethane 3 times (3×20 ml), combine the organic phases, evaporate the organic phases to dryness under reduced pressure, and purify by reverse-phase column chromatography (eluent: acetonitrile / water = 72 / 28, v / v) to obtain compound CR01008 in the form of a white powder (1 g, yield 76.0%). MS-ESI (m / z) = 1091 [M+Na] + .

[0156] 11H NMR (400 MHz, DMSO-d6) δ 1.05 (d, J = 6.7 Hz, 6H), 1.14 (d, J = 6.7 Hz, 6H), 1.37 - 1.17 (m, 5H), 1.60 - 1.40 (m, 6H), 1.68 - 1.62 (m, 1H), 1.80 (s, 3H), 1.80 (s, 3H), 1.92 (s, 3H), 2.02 (s, 5H), 2.13 (s, 3H), 2.71 (t, J = 5.9 Hz, 2H), 2.79 (d, J = 8.4 Hz, 1H), 2.87 (d, J = 8.4 Hz, 1H), 3.36 (s, 1H), 3.58 - 3.39 (m, 3H), 3.69 - 3.60 (m, 2H), 3.75 (s, 7H), 3.90 (dt, J = 11.2, 8.8 Hz, 1H), 4.05 (s, 3H), 4.51 (d, J = 8.4 Hz, 1H), 4.99 (dd, J = 11.3, 3.4 Hz, 1H), 5.24 (d, J = 3.4 Hz, 1H), 5.78 (s, 1H), 6.93 - 6.87 (m, 4H), 7.35 - 7.21 (m, 7H), 7.44 - 7.37 (m, 2H), 7.66 (d, J = 7.8 Hz, 1H), 7.84 (d, J = 9.2 Hz, 1H).

[0157] (2 - 2) Synthesis of Compound CR01008Z

[0158] In this preparation example, the synthesis route of compound CR01008Z is as follows:

[0159]

[0160] Among them, represents amino CPG, purchased from Beijing Coupling Technology Co., Ltd. CPG represents Controlled Pore Glass carrier.

[0161] (2 - 2 - 1) Synthesis of Compound CR01008 - 07

[0162] Dissolve compound CR01008 - 06 (500 mg) in 10 ml of dichloromethane, add succinic anhydride (112 mg), DMAP (6.8 mg) and triethylamine (226.2 mg), displace with nitrogen 3 times, stir and react at 25 °C for 16 hours, and purify by flash to obtain compound CR01008 - 07 (300 mg, yield 53.6%). MS - ESI (m / z) = 1013 [M + Na]+.

[0163] (2 - 2 - 2) Synthesis of Compound CR01008Z

[0164] Add compound CR01008-07 (50 mg), amino CPG (1.25 g, 80 μmol / g, 0.1 mmol, English name Aminoalkyl-CPG, model C3006-1000), benzotriazol-N,N,N',N'-tetramethyluronium hexafluorophosphate (27 mg, abbreviated as HBTU, CAS number 94790-37-1), and N,N-diisopropylethylamine (12 mg, abbreviated as DIEA, CAS number 7087-68-5) into a 20 ml sample vial, and react on a shaker for 16 hours. After the reaction is completed, filter the reaction solution to obtain a filter cake. Wash the filter cake once with 10 ml of acetonitrile (1×10 ml) and then dry it under vacuum. Add the dried filter cake, DMAP (3 mg), Cap1 (10 ml, 200V), and Cap2 (1 ml, 20V) into a 20 ml sample vial, and react on a shaker for 6 hours. After the reaction is completed, filter the reaction solution to obtain a filter cake. Wash the filter cake once with 10 ml of acetonitrile (1×10 ml) and then dry it under vacuum to obtain compound CR01008Z (1.03 g, loading amount 20 - 30 μmol / g).

[0165] Among them, Cap1 and Cap2 are capping reagents. Cap1 is a pyridine / acetonitrile mixed solution of 20 vol% N-methylimidazole, and the volume ratio of pyridine to acetonitrile is 3:5; Cap2 is an acetonitrile solution of 20 vol% acetic anhydride.

[0166] Preparation Example 3: Preparation of oligonucleotide (siRNA) conjugate

[0167] (3-1) Synthesis of sense strand (SS)

[0168] By the method of phosphoramidite nucleic acid solid-phase synthesis, nucleoside monomers are connected one by one in the 3'-5' direction. Each connection of a nucleoside monomer includes four steps of deprotection, coupling, capping, and oxidation or sulfurization (regard compound CR01008, compound CR01008Z, and compound ETV as one nucleoside monomer respectively). The synthesis conditions are given as follows:

[0169] Prepare a solution of nucleoside monomer in acetonitrile with a concentration of 0.1 M.

[0170] The conditions of each deprotection reaction are the same. The conditions of the deprotection reaction: temperature is 25 °C, reaction time is 70 seconds, the deprotection reagent is a dichloromethane solution of dichloroacetic acid (3 vol%), and the molar ratio of dichloroacetic acid to the 4,4'-dimethoxytriphenylmethyl protecting group on the solid support is 5:1.

[0171] The conditions for each coupling reaction are the same. The conditions for the coupling reaction are as follows: the temperature is 25 °C, the molar ratio of the nucleic acid sequence linked to the solid support to the nucleoside monomer is 1:10, the molar ratio of the nucleic acid sequence linked to the solid support to the coupling reagent is 1:65, the reaction time is 600 seconds, the coupling reagent is an acetonitrile solution of 5-ethylthio-1H-tetrazole with a concentration of 0.5 M, and the sulfurizing reagent is an acetonitrile / pyridine mixed solution (the volume ratio of acetonitrile to pyridine is 1:1) of hydrogenthioxanthate with a concentration of 0.2 M.

[0172] The conditions for each capping reaction are the same. The conditions for the capping reaction are as follows: the temperature is 25 °C; the reaction time is 2 minutes; the capping reagent solution is a mixed solution of Cap1 and Cap2 with a molar ratio of 1:1, Cap1 is a pyridine / acetonitrile mixed solution of N-methylimidazole with a concentration of 20 vol%, the volume ratio of pyridine to acetonitrile is 3:5, Cap2 is an acetonitrile solution of acetic anhydride with a concentration of 20 vol%; the molar ratio of N-methylimidazole in Cap1 capping reagent, acetic anhydride in Cap2 capping reagent to the nucleic acid sequence linked to the solid support is 1:1:1.

[0173] The conditions for each oxidation reaction are the same. The conditions for the oxidation reaction are as follows: the temperature is 25 °C; the reaction time is 3 seconds; the concentration of the oxidation reagent is iodine water with a concentration of 0.05 M, and the molar ratio of iodine to the nucleic acid sequence linked to the solid support in the coupling reaction is 30:1; the oxidation reaction is carried out in a water / pyridine mixed solvent (the volume ratio of water to pyridine is 1:9). The conditions for the sulfurization reaction are as follows: the temperature is 25 °C; the reaction time is 360 seconds; the concentration of the sulfurizing reagent is a pyridine solution of hydrogenthioxanthate with a concentration of 0.2 M, and the molar ratio of the sulfurizing reagent to the nucleic acid sequence linked to the solid support in the coupling reaction is 4:1; the sulfurization reaction is carried out in a water / pyridine mixed solvent (the volume ratio of water to pyridine is 1:9).

[0174] After the last nucleoside monomer is connected, the nucleic acid sequence linked to the solid support is successively subjected to cleavage, deprotection, purification, desalting, and then freeze-dried to obtain the sense strand, where:

[0175] The cleavage and deprotection conditions are as follows: The synthesized nucleotide sequence linked to the solid support is added to ammonia water with a concentration of 25 mass%, the amount of ammonia water used is 0.5 ml / μmol, and the reaction is carried out at 55 °C for 16 hours. The solvent is removed and vacuum concentrated to dryness. After the ammonia treatment, the product is dissolved in 0.4 ml / μmol N-methylpyrrolidone relative to the amount of single-stranded nucleic acid, and then 0.3 ml / μmol triethylamine and 0.6 ml / μmol triethylamine trihydrofluoride are added to remove the 2'-O-TBDMS protection on the ribose.

[0176] Purification and desalting conditions: The nucleic acid was purified by gradient elution of NaCl using a preparative ion chromatography purification column (Source 15Q). Specifically, eluent 1 was 20 mM sodium phosphate (pH = 8.1), and the solvent was a water / acetonitrile mixed solution (volume ratio of water to acetonitrile was 9:1); eluent 2 was 1.5 M sodium chloride, 20 mM sodium phosphate (pH = 8.1), and the solvent was a water / acetonitrile mixed solution (volume ratio of water to acetonitrile was 9:1); the elution gradient was eluent 1:eluent 2 = (100:0)-(50:50). After collecting and combining the product eluate, reverse chromatography purification column was used for desalting. The desalting conditions included using a Sephadex column for desalting, with the packing material being Sephadex G25, and eluting with deionized water.

[0177] Detection: Ion exchange chromatography (IEX-HPLC) was used for purity detection; liquid chromatography-mass spectrometry (LC-MS) was used for molecular weight detection. The measured value of the molecular weight was compared with the theoretical value. If the measured value and the theoretical value were consistent, it indicated that the sense strand of siRNA was obtained.

[0178] (3-2) Synthesis of antisense strand (AS)

[0179] The antisense strand was synthesized using a universal solid support. The deprotection, coupling, capping, oxidation or sulfidation reaction conditions, cleavage and deprotection conditions, purification and desalting conditions in the solid-phase synthesis method of the antisense strand were the same as those in step (3-1) for synthesizing the sense strand.

[0180] Detection: Ion exchange chromatography (IEX-HPLC) was used for purity detection; liquid chromatography-mass spectrometry (LC-MS) was used for molecular weight detection. The measured value of the molecular weight was compared with the theoretical value. If the measured value and the theoretical value were consistent, it indicated that the antisense strand of siRNA was obtained.

[0181] (3-3) Synthesis of siRNA double strand

[0182] The sense strand synthesized in step (3-1) and the antisense strand synthesized in step (3-2) were mixed in an equimolar ratio, dissolved in injection water and heated to 95 °C, then slowly cooled to room temperature and maintained at room temperature for 10 minutes, so that the sense strand and the antisense strand formed a double-stranded structure through hydrogen bonds, thereby obtaining siRNA with the sense strand and antisense strand shown in Table 1.

[0183] The siRNA conjugate shown in Table 1 was prepared according to the method provided by the present disclosure. Among them, the information of the unmodified nucleotide sequence forming the siRNA conjugate is shown in Table 2.

[0184] Table 1 siRNA conjugate sequence information

[0185]

[0186]

[0187] Among them, the above siRNA conjugates are all obtained by modifying and / or conjugating ligands on the basis of the nucleotide sequences shown in the following table.

[0188] Table 2 Information on Unmodified siRNA Sequences

[0189] Number Sense Strand (5‘-3’) SEQ ID Antisense Strand (5‘-3’) SEQ ID RZ009001 CCUUGAGGCAUACUUCAAA NO.1 UUUGAAGUAUGCCUCAAGGUC NO.2 RZ009002 CCUUGAGGCAUACUUCAAA NO.1 UUUGAAGUAUGCCUCAAGGUC NO.2 RZ009003 CCUUGAGGCAUACUUCAAA NO.1 UUUGAAGUAUGCCUCAAGGUC NO.2 RZ009004 CCUUGAGGCAUACUUCAAA NO.1 UUUGAAGUAUGCCUCAAGGUC NO.2 RZ009005 CCUUGAGGCAUACUUCAAA NO.1 UUUGAAGUAUGCCUCAAGGUC NO.2 RZ009006 CCUUGAGGCAUACUUCAAA NO.1 UUUGAAGUAUGCCUCAAGGUC NO.2 RZ009008 CCUUGAGGCAUACUUCAAA NO.1 UUUGAAGUAUGCCUCAAGGUC NO.2 RZ009009 CCUUGAGGCAUACUUCAAA NO.1 UUUGAAGUAUGCCUCAAGG NO.3

[0190] Unless otherwise specified, the base compositions and modification meanings described in the embodiments of the present disclosure are as follows: the capital letters A, U, G, C, and T represent the base compositions of nucleotides, the lowercase letter m indicates that the nucleotide represented by the letter before it is a methoxy-modified nucleotide; the lowercase letter f indicates that the nucleotide represented by the letter before it is a fluoro-modified nucleotide; the lowercase letter s indicates that there is a phosphorothioate bond connection between the nucleotides represented by the two letters before and after it, and moe indicates that the nucleotide represented by the letter before it is a 2'-O-methoxyethyl-modified nucleotide.

[0191] Among them, ETV is entecavir, and its structural formula is:

[0192] CR01008 and CR01008Z are GalNAc carriers, and the structural formulas are as follows:

[0193]

[0194] VP indicates that the structural formula of the nucleotide at this site is

[0195] Unless otherwise specified, the siRNA sequences used in the present disclosure are all synthesized by Suzhou Beixin Biotechnology Co., Ltd.; the synthesis of the PCR primers used in the present disclosure is all completed by Beijing Tsingke Biotechnology Co., Ltd., and the detection results of the siRNA conjugates are shown in the following table.

[0196] Table 3 Detection Results of siRNA Conjugates

[0197]

[0198]

[0199] The information on the control conjugates designed in the present disclosure is shown in Table 4.

[0200] Table 4 Information on ETV Control Conjugates

[0201] Compound Number Compound Information RZ009011 (ETV)(CR01008Z) RZ009012 (ETV)(ETV)(ETV)(CR01008)(CR01008)(CR01008Z)

[0202] The detection results of the control conjugates are shown in Table 5.

[0203] Table 5 Detection Results of ETV Control Conjugates

[0204] Control Compound Number Theoretical Molecular Weight Actual Molecular Weight Purity % RZ009011 799.23 801.50 96.30 RZ009012 2527.63 2529.70 90.10

[0205] Biological Detection Experiment

[0206] Unless otherwise specified, the reagents, reagent consumables, and instruments used in this disclosure are all commercially available. Among them, the main reagent consumables are shown in Table 6, and the main instruments are shown in Table 7.

[0207] Table 6 Main Reagent Consumables

[0208] Name Manufacturer HepG2.25 Cells Guangzhou Geneo Biotechnology Co., Ltd. MEM Medium Zhongke Maichen (Beijing) Technology Co., Ltd. Fetal Bovine Serum (FBS) Merck Trypsin Zhongke Maichen (Beijing) Technology Co., Ltd. Dual Antibody BBI Lipofectamine RNAiMAX Invitrogen Opti-MEM Gibco 1×PBS Zhongke Maichen (Beijing) Technology Co., Ltd. Nucleic Acid Extraction Reagent Shanghai Kehua Bio-Engineering Co., Ltd. Hepatitis B Virus Nucleic Acid Detection Kit Shanghai Kehua Bio-Engineering Co., Ltd. Reverse Transcription System Promega Corporation SYBR Select Master Mix ABI

[0209] Table 7 Main Instruments

[0210]

[0211]

[0212] Example 1 Evaluation of the Inhibitory Activity of siRNA Conjugates on HBV DNA and mRNA in HepG2.25 Cells

[0213] In this example, the inhibitory effects of the siRNA conjugates RZ009002 to RZ009009 conjugated with siRNA and ETV, the reference conjugate RZ009001 without ETV conjugation, and the ETV control conjugates RZ009011 and RZ009012 on the expression of hepatitis B DNA and mRNA were evaluated using the HepG2.25 cell line inhibition test. The differences in the above sequences lie in the different combinations of ETV and the CR01008 vector, and the different positions of the conjugated ETV on the siRNA duplex.

[0214] Preparation of Test Samples:

[0215] After centrifugation of the test samples of the siRNA conjugates RZ009001 to RZ009009, an appropriate amount of PBS was added for dissolution according to the specifications of each tube to prepare a 200 μM stock solution (calculated based on siRNA). RZ009011 was prepared into a 600 μM ETV solution based on molecular weight, and RZ009012 was prepared into a 200 μM ETV solution based on molecular weight.

[0216] Cell Transfection:

[0217] Trypsin was used to digest HepG2.25 cells grown to near confluence, and the cells were washed to prepare a cell suspension. 1 mL of cell suspension was added to each well of a 12-well plate, and the number of cells per well was 15,000 cells. The cells were cultured in a 37°C, 5% CO2 incubator. When the cells adhered to the wall for 24 hours, the MEM medium in the well plate was discarded, and 900 μL of Opti-MEM was added to each well. TM Culture medium, then place the well plate in an incubator for continued culture; take 1 μL of the above siRNA and ETV stock solution and disperse it in 49 μL Opti-MEM to form a mixture, 1.5 μL RNAiMAX is dispersed in 48.5 μL Opti-MEM, and mixed with each of the above mixtures to form a test group transfection complex. At the same time, 1.5 μL RNAiMAX is dispersed in 50 μL Opti-MEM, and then mixed with 50 μL Opti-MEM to form a control group (Mock) transfection complex. Incubate the transfection complex at room temperature for 10 minutes, and then add the transfection complex to the well plate, 100 μL / well. After 4 hours of culture, each well is supplemented with 1 mL of MEM culture medium containing 20% ​​FBS and placed in an incubator for continued culture for 48 hours.

[0218] DNA content detection

[0219] The 12-well plate was taken out, and the total cellular nucleic acid was extracted using a fully automatic nucleic acid extractor (purchased from Zhejiang Hanwei Technology Co., Ltd.) and a hepatitis B virus nucleic acid assay kit (purchased from Shanghai Kehua Bioengineering Co., Ltd.) according to the standard operating procedures for nucleic acid extraction. The in vitro amplification and quantitative detection of HBV DNA were performed according to the real-time fluorescence PCR detection method in the "Hepatitis B Virus Nucleic Acid Assay Kit (Magnetic Beads / PCR-Fluorescent Probe Method) Instructions". The specific operation steps were to add 25 μL of HBV PCR reaction solution to each PCR reaction plate, and then add 25 μL of the extracted HBV DNA template according to the experimental layout. The configured reaction system was placed on an ABI StepOnePlus PCR instrument, and a three-step method was used for Real-time PCR amplification. The amplification program was 50°C UNG enzyme reaction for 2 min, 95°C denaturation for 2 min, then 95°C denaturation for 10 s, 60°C annealing, extension for 40 s, and repeating the denaturation, annealing, and extension process for 45 cycles. The kit uses the working calibrator method for quantitative analysis. The PCR cycle number (Ct) during the exponential growth of the amplification curve is linearly related to the logarithm of the starting template concentration (LogC). By testing a series of working calibrators of known concentrations, the instrument can automatically fit the standard curve and equation for Ct and LogC. The software automatically obtains the starting concentration of the sample to be tested based on the Ct value detected. The obtained DNA concentration is used to calculate the relative expression of DNA according to the following formula:

[0220] Relative expression level of DNA in the test group = C (DNA concentration in the test group) / C (DNA concentration in the control group) × 100%. Based on the control group, the expression level of the target DNA in the test group was normalized, and the expression level of the target DNA in the control group was defined as 100%. The relative expression level of DNA in each group was expressed as and the experimental data were graphed and analyzed using GraphPad prism 8.0 software.

[0221] Detection of mRNA expression level:

[0222] For each sample of the total cellular nucleic acid extracted above using an automatic nucleic acid extractor (purchased from Zhejiang Hanwei Technology Co., Ltd.) and a hepatitis B virus nucleic acid detection kit (purchased from Shanghai Kehua Bio-Engineering Co., Ltd.), 9.5 μL was taken and used with a reverse transcription kit (Reverse Transcription System, A3500) from Promega Corporation and an Oligo(dT)15 reverse transcription primer. A 20-μL reverse transcription system was prepared according to the method described in the kit instructions and the reverse transcription reaction was completed. After the reaction ended, 80 μL of RNase-Free water was added to the reverse transcription system to obtain a cDNA solution for Real-time PCR detection. Real-time PCR detection: Using SYBR TM Select Master Mix (4472908) reagent from ABI, a 20-μL Real-time PCR reaction system was prepared for each PCR detection well according to the method described in the kit instructions. Each detection system contained 5 μL of the cDNA template obtained from the above reverse transcription reaction, 10 μL of SYBR TM Select Master Mix, 0.5 μL of 10 μM upstream primer, 0.5 μL of 10 μM downstream primer, and 4 μL of RNase-Free H2O. The prepared reaction system was placed on an ABI StepOnePlus PCR instrument and Real-time PCR amplification was performed using the three-step method. The amplification program was pre-denaturation at 95°C for 10 min, then denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, and the process of denaturation, annealing, and extension was repeated 40 cycles. After the program was completed, the gene expression difference was calculated by the ΔΔCt method.

[0223] In the above real-time fluorescence quantitative PCR method, the ΔΔCt method was used to relatively quantitatively calculate the expression level and inhibition rate of the target gene mRNA in each test group. The calculation method was as follows:

[0224] ΔCt (test group) = Ct (target gene in the test group) - Ct (reference gene in the test group)

[0225] ΔCt (control group) = Ct (target gene in control group) - Ct (housekeeping gene in control group)

[0226] ΔΔCt (test group) = ΔCt (test group) - ΔCt (average of control group)

[0227] ΔΔCt (control group) = ΔCt (control group) - ΔCt (average of control group)

[0228] Among them, in cell experiments, ΔCt (average of control group) is the arithmetic mean of ΔCt (control group) of several replicate wells in the control group. Therefore, each cell well in the test group and the control group corresponds to a ΔΔCt value.

[0229] Relative expression level of target gene mRNA in test group = 2 -ΔΔCt( (test group) × 100%

[0230] Based on the relative expression level of target gene mRNA in the control group, the relative expression level of target gene mRNA in the test group is normalized, and the relative expression level of target gene mRNA in the control group is defined as 100%.

[0231] Inhibition rate of target gene mRNA expression in test group = (1 - relative expression level of target gene mRNA in test group) × 100%

[0232] Unless otherwise specified, all activity experimental data are presented as and all experimental data are graphed and analyzed using GraphPad Prism 8.0 software.

[0233] Table 8 Primer sequence information in Example 1

[0234]

[0235] The inhibition activity results of siRNA conjugates on HBV DNA and mRNA in HepG2.25 cells are shown in Tables 9 - 10 respectively Figure 1-2 as shown below.

[0236] Table 9 Expression level and inhibition rate of HBV DNA in HepG2.25 cells by siRNA conjugates

[0237]

[0238] Table 10 Inhibition rate of HBV mRNA in HepG2.25 cells by siRNA conjugates

[0239] Group Average Inhibition Rate % STDEV Mock 100.00 1.09 RZ009001 22.51 11.51 RZ009002 12.69 2.26 RZ009003 15.58 4.35 RZ009004 26.24 2.72 RZ009005 37.78 23.44 RZ009006 20.07 0.54 RZ009008 16.62 5.43 RZ009009 25.45 2.36 RZ009011 100.73 13.58 RZ009012 109.54 25.78

[0240] The results of Example 1 showed that compared with the ETV control conjugates RZ009011 and RZ009012, the siRNA conjugate RZ009002 with three ETVs consecutively conjugated to the 3'-end of the sense strand and the siRNA conjugate RZ009003 with three ETVs consecutively conjugated to the 5'-end of the sense strand had a better inhibitory effect on DNA expression at 48 h, while the control conjugate RZ009001 without ETV had no inhibitory effect on DNA expression; at the same time, RZ009002 and RZ009003 had a better inhibitory effect on mRNA expression level than the reference conjugate RZ009001, while the conjugates RZ009011 and RZ009012 with only ETV had no inhibitory effect at the mRNA level. It was shown that the conjugate of ETV conjugated with siRNA could exert a better dual inhibitory effect at the DNA and mRNA levels.

[0241] The above specific embodiments are only illustrative descriptions of the content of the present invention and do not represent limitations on the content of the present invention. For those of ordinary skill in the art, various modifications and improvements can be made without departing from the spirit and essence of the present disclosure, and these modifications and improvements are also regarded as the protection scope of the present disclosure.

Claims

1. An oligonucleotide conjugate having a structure represented by the following formula (I), or an isomer thereof, or a pharmaceutically acceptable salt thereof: Among them, ds represents double-stranded oligonucleotides (siRNA), AS represents the antisense strand of the double-stranded oligonucleotide molecule; SS represents the sense strand of the double-stranded oligonucleotide molecule; M1 and M2 are independently selected from targeting ligand molecules capable of binding to hepatocyte surface receptors; m1 and m2 are independently selected from integers from 0 to 6, and m1 and m2 are not both 0; n1 and n2 are independently selected from integers from 0 to 6, and n1 and n2 are not both 0; Each Z is independently selected from a hydroxyl group or a mercapto group; Optionally, both M1 and M2 contain an asialoglycoprotein receptor ligand moiety; Optionally, the asialoglycoprotein receptor ligand moiety contains a galactose or its derivative unit; Optionally, the galactose or its derivative unit includes but is not limited to galactose, galactosamine, N-formylgalactosamine, N-acetylgalactosamine (GalNAc), N-propionylgalactosamine, N-n-butyrylgalactosamine or N-isobutyrylgalactosamine; Optionally, the asialoglycoprotein receptor ligand moiety contains an N-acetylgalactosamine unit.

2. The oligonucleotide conjugate according to claim 1, wherein The conjugate has a structure represented by formula (II) or formula (III), or an isomer thereof, or a pharmaceutically acceptable salt thereof: Wherein each p is independently selected from 1, 2 or 3; each q is independently selected from 1, 2 or 3; Each A is independently selected from an optionally substituted 4- to 10-membered ring, which is selected from an alicyclic ring, an aromatic ring or a heteroaromatic ring; Each R is independently selected from H, an optionally substituted C1-C6 alkyl group or an optionally substituted C1-C6 alkoxy group; Each L is independently selected from optionally substituted C2-C 20 alkylene or R La and R Lb are independently selected from optionally substituted C1-C 10 alkylene, and i is selected from 1, 2, 3, 4 or 5; Each Y is independently selected from O, S or -NH-; 3. The oligonucleotide conjugate according to claim 2, characterized in that, Z is selected from a hydroxyl group; Optionally, p is selected from 1; Optionally, q is selected from 1; Optionally, each A is independently selected from Optionally, A is selected from Optionally, R is selected from H; Optionally, each said L is independently selected from optionally substituted C2-C 10 alkylene or wherein, R La and R Lb are independently selected from optionally substituted C1-C 10 alkylene, and k is selected from 1, 2 or 3; Optionally, k is selected from 1; Optionally, each L is independently selected from Optionally, L is selected from 4. The oligonucleotide conjugate according to claim 3, wherein The conjugate has a structure represented by formula (IV) or formula (V), or an isomer thereof, or a pharmaceutically acceptable salt thereof: The definitions of each substituent are the same as those in claim 3.

5. The oligonucleotide conjugate according to claim 4, wherein The conjugate has a structure represented by formula (VI) or formula (VII), or an isomer thereof, or a pharmaceutically acceptable salt thereof: The definitions of each substituent are the same as those in claim 3.

6. The oligonucleotide conjugate according to claim 5, wherein, The conjugate has any of the following structures, or an isomer thereof, or a pharmaceutically acceptable salt thereof: Wherein, m1, n1, m2, and n2 are each independently selected from integers from 0 to 3; and m1 and m2 are not both 0, and n1 and n2 are not both 0; Preferably, the conjugate has the following structure: More preferably, the conjugate has the following structure: Even more preferably, n2 is 3, m2 is 3; Z is a hydroxyl group.

7. The oligonucleotide conjugate according to any one of claims 1-6, wherein The double-stranded oligonucleotide targets the HBV viral gene and inhibits the abnormal expression of the mRNA of the HBV gene in hepatocytes; The double-stranded oligonucleotide includes a sense strand and an antisense strand, and the antisense strand is at least partially complementary to the sense strand to form a duplex region; wherein, the antisense strand is complementary or at least partially complementary to the mRNA of the HBV gene; Optionally, the sense strand and the antisense strand of the double-stranded oligonucleotide each contain at least partially modified nucleotides; Optionally, at least one phosphorothioate bond is included in the sense strand and / or the antisense strand; Optionally, the sense strand and the antisense strand contain at least 15 consecutive nucleotides, wherein the antisense strand is complementary to the mRNA of the HBV gene; Optionally, the conjugating group is linked to the end of the sense strand of the double-stranded oligonucleotide; alternatively, the conjugating group is linked to the 3'-end of the sense strand.

8. The oligonucleotide conjugate according to claim 7, wherein Each nucleotide in the double-stranded region formed by the sense strand and the antisense strand of the siRNA is independently a modified nucleotide, wherein the sense strand contains a nucleotide sequence segment in the mRNA of the HBV virus; Wherein, the modified nucleotides are independently selected from abasic nucleotides, 2'-halo modifications, 2'-deoxy modifications or 2'-O-(CH2) n -R modified nucleotides, or nucleotide analogs; optionally, the nucleotide analogs are selected from one or more of PNA, MNA, BNA, LNA, GNA, TNA and UNA; wherein, n is selected from 0, 1 or 2, and R is selected from optionally substituted C 1-6 alkyl, optionally substituted C 1-6 alkoxy, and the substitution means that one or more hydrogen atoms on the alkyl or alkoxy are substituted by substituents; optionally, the 2'-O-(CH2) n -R is selected from 2'-O-CH3, 2'-O-CH2-CH3, 2'-O-CH2-O-CH2-CH3, 2'-O-CH2-O-CH2-CF3 or 2'-O-CH2-CH2-O-CH3; Optionally, the sense strand is 17-21 nucleotides in length and the antisense strand is 19-23 nucleotides in length; Optionally, in the double-stranded region, in the direction from the 5'-end to the 3'-end, at least three nucleotides among the nucleotides at positions 7-10 of the nucleotide sequence in the sense strand are selected from 2'-fluoro-modified nucleotides, and the remaining nucleotides are selected from 2'-O-methyl-modified nucleotides or 2'-O-methoxyethyl-modified nucleotides; among the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence in the antisense strand, the nucleotides are selected from 2'-fluoro-modified nucleotides, any one of the nucleotides at positions 9, 10, 11, and 12 is selected from 2'-fluoro-modified nucleotides, and the remaining nucleotides are selected from 2'-O-methyl-modified nucleotides or 2'-O-methoxyethyl-modified nucleotides; Optionally, in the double-stranded region, in the direction from the 5'-end to the 3'-end, at least three nucleotides among the nucleotides at positions 7-10 of the nucleotide sequence in the sense strand are selected from 2'-fluoro-modified nucleotides, at most two nucleotides among the nucleotides at positions 5, 12, and 18 are selected from 2'-O-methoxyethyl-modified nucleotides, and the remaining nucleotides are selected from 2'-O-methyl-modified nucleotides; among the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence in the antisense strand, the nucleotides are selected from 2'-fluoro-modified nucleotides, any one of the nucleotides at positions 9-12 is selected from 2'-fluoro-modified nucleotides, the nucleotide at position 15 is selected from 2'-O-methoxyethyl-modified nucleotides, and the remaining nucleotides are selected from 2'-O-methyl-modified nucleotides; Preferably, in the double-stranded region, the modification of the sense strand and / or the antisense strand is selected from any one of the following (1)-(8): (1) In the direction from the 5'-end to the 3'-end, the nucleotides at positions 7-10 of the nucleotide sequence in the sense strand are selected from 2'-fluoro-modified nucleotides, and the remaining nucleotides are selected from 2'-O-methyl-modified nucleotides; among the nucleotides at positions 2, 6, 9, 14, and 16 of the nucleotide sequence in the antisense strand, the nucleotides are selected from 2'-fluoro-modified nucleotides, and the remaining nucleotides are selected from 2'-O-methyl-modified nucleotides; (2) In the direction from the 5'-end to the 3'-end, the nucleotides at positions 7-10 of the nucleotide sequence in the sense strand are selected from 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides; the nucleotides at positions 2, 6, 12, 14, and 16 of the nucleotide sequence in the antisense strand are selected from 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides; (3) In the direction from the 5'-end to the 3'-end, the nucleotides at positions 7-10 of the nucleotide sequence in the sense strand are selected from 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides; the nucleotides at positions 2, 6, 9, 14, and 16 of the nucleotide sequence in the antisense strand are selected from 2'-fluoro-modified nucleotides, the nucleotide at position 15 is selected from 2'-O-methoxyethyl-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides; (4) In the direction from the 5'-end to the 3'-end, the nucleotides at positions 7-10 of the nucleotide sequence in the sense strand are selected from 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides; the nucleotides at positions 2, 6, 12, 14, and 16 of the nucleotide sequence in the antisense strand are selected from 2'-fluoro-modified nucleotides, the nucleotide at position 15 is selected from 2'-O-methoxyethyl-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides; (5) In the direction from the 5'-end to the 3'-end, the nucleotide at position 5, or position 12, or position 18 of the nucleotide sequence in the sense strand is selected from 2'-O-methoxyethyl-modified nucleotides, the nucleotides at positions 7-10 are selected from 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides; the nucleotides at positions 2, 6, 9, 14, and 16 of the nucleotide sequence in the antisense strand are selected from 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides; (6) In the direction from the 5'-end to the 3'-end, the nucleotide at position 5, or position 12, or position 18 of the nucleotide sequence in the sense strand is selected from 2'-O-methoxyethyl-modified nucleotides, the nucleotides at positions 7-10 are selected from 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides; the nucleotides at positions 2, 6, 12, 14, and 16 of the nucleotide sequence in the antisense strand are selected from 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides; (7) In the 5'-terminal to 3'-terminal direction, the nucleotide at the 5th, or 12th, or 18th position of the nucleotide sequence in the sense strand is selected from 2'-O-methoxyethyl-modified nucleotides, the nucleotides at the 7th - 10th positions are selected from 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides; in the antisense strand, the nucleotides at the 2nd, 6th, 9th, 14th, 16th positions of the nucleotide sequence are selected from 2'-fluoro-modified nucleotides, the nucleotide at the 15th position is selected from 2'-O-methoxyethyl-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides; (8) In the 5'-terminal to 3'-terminal direction, the nucleotide at the 5th, or 12th, or 18th position of the nucleotide sequence in the sense strand is selected from 2'-O-methoxyethyl-modified nucleotides, the nucleotides at the 7th - 10th positions are selected from 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides; in the antisense strand, the nucleotides at the 2nd, 6th, 12th, 14th, 16th positions of the nucleotide sequence are selected from 2'-fluoro-modified nucleotides, the nucleotide at the 15th position is selected from 2'-O-methoxyethyl-modified nucleotides, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides.

9. The oligonucleotide conjugate according to claim 8, wherein In the double-stranded oligonucleotide, in the 5'-terminal to 3'-terminal direction, 1 or 2 consecutive phosphorothioate bonds are included between the terminal nucleotides at the 5'-end of the sense strand; and / or, the 5'-end and 3'-end of the antisense strand each independently include 1 or 2 consecutive phosphorothioate bonds; Optionally, the double-stranded oligonucleotide further contains an overhang sequence with a length of 1 to 3 nucleotides; optionally, the overhang is linked to the 3'-end of the antisense strand, thereby forming a 3'-overhang of the antisense strand.

10. A composition comprising the oligonucleotide conjugate according to any one of claims 1 - 9 and a physiologically acceptable excipient.

11. Use of the oligonucleotide conjugate according to any one of claims 1 - 9 or the composition according to claim 10 in the preparation of a medicament for treating and / or preventing a pathological condition or disease caused by HBV virus in hepatocytes.

12. A method for inhibiting HBV gene expression in hepatocytes, wherein, The method includes contacting the hepatocytes with an effective amount of the oligonucleotide conjugate according to any one of claims 1 - 9 or the composition according to claim 10.

13. A kit comprising the oligonucleotide conjugate according to any one of claims 1 - 9 or the composition according to claim 10.

Images