Triboelectricity response DNA hydrogel dressing for promoting wound healing and preparation method and application thereof
By introducing silver nanoclusters and VEGF into DNA hydrogel dressings, the triboelectric response DNA hydrogel was constructed, which solved the shortcomings of existing DNA hydrogels in antibacterial, mechanical properties and electrical response characteristics, achieved multifunctional integration and intelligent controlled release, and promoted the rapid healing of diabetic wounds.
Patent Information
- Application Number
- CN202510532117.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-25
- Publication Date
- 2025-07-11
AI Technical Summary
The existing DNA hydrogel dressings have shortcomings in antibacterial activity, mechanical properties and electrical response characteristics, which are difficult to effectively inhibit bacterial growth in diabetic wounds and adapt to skin deformation, and lack the intelligent response ability to external electric field stimulation.
By growing silver nanoclusters on DNA tee junction structures and assembled with linking strands and VEGF to form a DNA hydrogel, loading the drug diclofenac sodium, a triboelectric response DNA hydrogel dressing is constructed, and a conductive network is constructed using polypyrrole to achieve an efficient response to triboelectric stimulation.
It provides a multifunctional integrated DNA hydrogel dressing, which has antibacterial, promotes angiogenesis and controlled drug release capabilities, and can collaborate with electrotherapy devices to accelerate the healing of diabetic wounds caused by bacterial infection, solving the problems of single functions and insufficient electrical response of existing dressings.
Smart Images

Figure CN120285280A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the fields of biotechnology and biomaterials, and particularly relates to a triboelectric-responsive DNA hydrogel dressing for promoting wound healing, a preparation method thereof, and an application thereof. Background Art
[0002] As a natural biopolymer, DNA has received extensive attention in the field of biomaterials in recent years due to its unique biocompatibility, good chemical stability, programmability, and molecular recognition ability. DNA hydrogel is a three-dimensional network structure formed by physical or chemical cross-linking of DNA strands, showing characteristics similar to those of natural extracellular matrix, and thus can provide a physical scaffold for cells and tissues. At the same time, DNA hydrogel has excellent biodegradability, adjustable mechanical properties, and the potential for multifunctionalization, showing great application prospects in the fields of drug delivery, tissue engineering, and wound healing. Compared with traditional polymer hydrogels, the advantage of DNA hydrogel lies in the high designability of its molecular structure. By reasonably designing and precisely synthesizing four nucleobases (adenine, thymine, cytosine, and guanine), the intelligent response of DNA hydrogel materials to light, heat, magnetism, and pH can be satisfied.
[0003] Among many dressings used for wound treatment, DNA hydrogel is considered an ideal material. DNA hydrogel can maintain biosecurity, wettability, and breathability, which is beneficial to cell adhesion and proliferation, and has biodegradability, injectability, non-immunogenicity, and customizable functions. However, existing DNA hydrogel dressings still have deficiencies in antibacterial activity, mechanical properties, and electrical response characteristics. Diabetic wounds are prone to bacterial growth due to the hyperglycemic environment, and traditional DNA hydrogels cannot effectively inhibit bacterial growth, resulting in an increased risk of wound infection and thus delaying the healing process. At the same time, the mechanical properties of DNA hydrogel are weak and it is difficult to adapt to the deformation brought about by skin contraction or movement. In a dynamic wound environment, the dressing needs to have a certain strength and elasticity to withstand external stress, while the mechanical properties of traditional DNA hydrogels are often insufficient to cope with these challenges. In addition, traditional DNA hydrogels lack the intelligent response ability to external electric field stimulation, which limits their application in a dynamic wound environment. In recent years, researchers have tried to improve the performance of DNA hydrogel through functional modification. For example, enhancing its antibacterial activity by introducing antibacterial agents, improving its mechanical properties by compounding with high-strength polymers, or achieving multifunctional synergistic therapy by loading drugs. Despite these improvements, many functions of DNA hydrogel are still in the exploration stage, and existing research mostly focuses on the realization of single functions, lacking a systematic design for the multifunctional integration and electrical responsiveness of DNA hydrogel. Summary of the Invention
[0004] The technical problem to be solved by the present invention is to provide a triboelectric response DNA hydrogel dressing for promoting wound healing, a preparation method thereof and an application, aiming at the deficiencies in the above-mentioned prior art.
[0005] To solve the above technical problems, the technical solution adopted by the present invention is: In the first aspect of the present invention, a preparation method of a triboelectric response DNA hydrogel dressing for promoting wound healing is provided, including the following steps:
[0006] S1. Synthesize a DNA three-way junction structure, and then grow silver nanoclusters on the DNA three-way junction structure to obtain a DNA three-way junction structure containing silver nanoclusters;
[0007] S2. Synthesize DNA linker chains: linker chain L1 and linker chain L2;
[0008] S3. Assemble the DNA three-way junction structure containing silver nanoclusters, linker chain L1, linker chain L2 and VEGF to form a DNA hydrogel;
[0009] S4. In-situ deposit polypyrrole on the DNA hydrogel, and then load the drug diclofenac sodium to obtain a triboelectric response DNA hydrogel dressing.
[0010] Preferably, the DNA three-way junction structure is composed of three oligonucleotide chains S1, S2 and S3 with partial base complementary pairing;
[0011] Linker chain L1 is composed of oligonucleotide chains H1 and H2, and linker chain L2 is composed of acrylamide-modified oligonucleotide chains H3 and H4. Among them, both H2 and H4 contain an aptamer sequence of VEGF.
[0012] Preferably, the sequence of S1 is:
[0013] TATCATGTTGACTTCTAGACGCTATCCTAGATCCTAAGTTAGTA;
[0014] The sequence of S2 is:
[0015] TATCATGTTGACTTTACTAACTTAGGATCCACTAGACAGACGCTAGA T;
[0016] The sequence of S3 is:
[0017] TATCATGTTGACTTATCTAGCACCCACCCCCCTCCCAGTCTGTCTAG TGTAGGATAGCGTCTAG;
[0018] The sequence of H1 is: AAGTCAACATGATACATTCCTACGAAGCT;
[0019] The sequence of H2 is as follows:
[0020] AAGTCAACATGATAAGCTTCGTAGGAATGAGGGTGTGGGGGTGGA CGGGCCGGGTAGA;
[0021] The sequence of H3 is: Acrydite-AAGTCAACATGATACATTCCTACGAAGCT;
[0022] The sequence of H4 is as follows:
[0023] Acrydite-AAGTCAACATGATAAGCTTCGTAGGAATGAGGGTGTGGGG GTGGACGGGCCGGGTAGA.
[0024] Preferably, the preparation method of the triboelectric response DNA hydrogel dressing for promoting wound healing comprises the following steps:
[0025] S1. Mix three oligonucleotide chains S1, S2 and S3 in phosphate buffer, anneal to form a DNA three-way junction structure; then add an AgNO3 solution to the product, and then add NaBH4 for reduction to obtain a DNA three-way junction structure containing silver nanoclusters;
[0026] S2. Mix oligonucleotide chains H1 and H2 in phosphate buffer, anneal to form a linking chain L1;
[0027] Prepare a reaction solution by mixing Tris-acetic acid, ethylenediaminetetraacetic acid, and acrylamide. Add acrylamide group-modified oligonucleotide chains H3 and H4 to the reaction solution, anneal to form a duplex, and then add ammonium persulfate and TEMED to the obtained product, and react to obtain a linking chain L2;
[0028] S3. Mix the DNA three-way junction structure containing silver nanoclusters, the linking chain L1, the linking chain L2 and VEGF, and react to obtain a DNA hydrogel;
[0029] S4. Immerse the DNA hydrogel prepared in step S3 in a hydrochloric acid solution containing pyrrole, then immerse it in a hydrochloric acid solution containing ammonium persulfate, stir, and finally immerse it in a diclofenac sodium solution, take it out, and obtain the triboelectric response DNA hydrogel dressing.
[0030] Preferably, the preparation method of the triboelectric response DNA hydrogel dressing for promoting wound healing comprises the following steps:
[0031] S1. Mix three oligonucleotide strands S1, S2, and S3 in a phosphate buffer solution with a pH of 7.4, and anneal at 95 °C for 2 - 10 min to form a DNA three-way junction structure; subsequently, add an AgNO3 solution to the product, and then add NaBH4 to reduce for 2 - 10 h to obtain a DNA three-way junction structure containing silver nanoclusters;
[0032] S2. Mix oligonucleotide strands H1 and H2 in a phosphate buffer solution with a pH of 7.4, anneal at 95 °C for 2 - 10 min, and cool to obtain a connecting strand L1;
[0033] Prepare a reaction solution by mixing Tris-acetate, ethylenediaminetetraacetic acid, and acrylamide. Add acrylamide group-modified oligonucleotide strands H3 and H4 to the reaction solution, anneal to form a duplex, and then add ammonium persulfate and TEMED to the obtained product and react to obtain a connecting strand L2;
[0034] S3. Mix the DNA three-way junction structure containing silver nanoclusters, connecting strand L1, connecting strand L2, and VEGF, react at 37 °C for 10 - 40 min, and cool to obtain a DNA hydrogel;
[0035] S4. Immerse the DNA hydrogel prepared in step S3 in a hydrochloric acid solution containing pyrrole for 1 - 4 h, then immerse it in a hydrochloric acid solution containing ammonium persulfate, stir for 2 - 8 h, and finally immerse it in a diclofenac sodium solution, take it out to obtain a triboelectric response DNA hydrogel dressing.
[0036] Preferably, in step S1, the molar ratio of the DNA three-way junction structure, AgNO3, and NaBH4 is 6:1:1;
[0037] In step S3, the concentration ratio of the DNA three-way junction structure, duplex L1, and duplex L2 is 2:3:1.
[0038] Preferably, the preparation method of the triboelectric response DNA hydrogel dressing for promoting wound healing includes the following steps:
[0039] S1. Mix three oligonucleotide strands S1, S2, and S3 with a concentration of 600 μM each in a phosphate buffer solution with a pH of 7.4, anneal at 95 °C for 5 min, and naturally cool to room temperature to form a DNA three-way junction structure; subsequently, add a 100 μM AgNO3 solution to the product, and then add 100 μM NaBH4 to reduce for 5 h to obtain a DNA three-way junction structure containing silver nanoclusters;
[0040] S2. Mix oligonucleotide strands H1 and H2 with a concentration of 900 μM each in a phosphate buffer solution with a pH of 7.4, anneal at 95 °C for 5 min, and naturally cool to room temperature to obtain a connecting strand L1;
[0041] Prepare the reaction solution according to the following formula: Tris-acetate 40 mmol / L, ethylenediaminetetraacetic acid 2 mmol / L, acrylamide 4 wt%, pH 8.0; add acrylamide-modified oligonucleotide chains H3 and H4 with a concentration of 300 μM to the reaction solution, anneal at 95 °C for 5 min, and naturally cool to room temperature to form a duplex. Subsequently, add ammonium persulfate and TEMED to the obtained product so that the mass concentrations of ammonium persulfate and TEMED are both 1.4%, and react for 20 min to obtain the linking chain L2;
[0042] S3. Mix the DNA three-way junction structure containing silver nanoclusters obtained in step S1, the linking chain L1 and the linking chain L2 obtained in step S2 with VEGF at 100 ng / mL, react at 37 °C for 20 min, and naturally cool to room temperature to obtain a DNA hydrogel;
[0043] S4. Immerse the DNA hydrogel prepared in step S3 in a hydrochloric acid solution containing 0.05 M pyrrole for 2 h, then immerse it in a hydrochloric acid solution containing 0.05 M ammonium persulfate, stir in an ice bath for 4 h, take it out, wash it clean with distilled water, and finally immerse it in a diclofenac sodium solution at 250 μg / mL for 12 h, take it out to obtain a triboelectric-responsive DNA hydrogel dressing.
[0044] In the second aspect of the present invention, there is provided a triboelectric-responsive DNA hydrogel dressing for promoting wound healing, which is characterized in that it is prepared by the method described above.
[0045] In the third aspect of the present invention, there is provided an application of the triboelectric-responsive DNA hydrogel dressing described above in realizing drug release control by using a triboelectric nanogenerator for power supply.
[0046] In the fourth aspect of the present invention, there is provided an application of the triboelectric-responsive DNA hydrogel dressing described above in the preparation of a drug-controlled release material.
[0047] In the fifth aspect of the present invention, there is provided an application of the triboelectric-responsive DNA hydrogel dressing described above in the preparation of a drug for treating diabetic wounds infected with bacteria.
[0048] In the sixth aspect of the present invention, there is provided an application of the triboelectric-responsive DNA hydrogel dressing described above in the preparation of an antibacterial and / or anti-inflammatory material.
[0049] The beneficial effects of the present invention are as follows:
[0050] 1. The DNA hydrogel dressing provided by the present invention has excellent biocompatibility and multifunctional integration. Through functional modification, it endows additional functions on the basis of not affecting biocompatibility, including antibacterial, promoting angiogenesis, and drug controlled release, etc.
[0051] 2. The DNA hydrogel dressing provided by the present invention constructs a conductive network through polypyrrole and DNA base complementary pairing, ensuring the efficient response of the dressing to triboelectric stimulation to achieve intelligent regulation, filling the gap of DNA hydrogels in the field of electrical response.
[0052] 3. The DNA hydrogel dressing provided by the present invention can comprehensively accelerate the healing of diabetic wounds infected with bacteria in cooperation with electrotherapy devices, helping to solve problems such as poor antibacterial effect of existing clinical electrotherapy devices, lack of matching flexible electrode dressings, and difficulty in dealing with acute infection events of chronic wounds, providing a useful tool for the treatment of easily infected chronic wounds.
[0053] 4. The DNA hydrogel dressing provided by the present invention is simple to prepare and convenient to use, only requiring a short preparation and modification process, avoiding complex experimental steps, and the operator does not need special training. Brief Description of the Drawings
[0054] Figure 1 It is the preparation flow chart of the triboelectric response DNA hydrogel dressing;
[0055] Figure 2 It is the cryo-electron microscopy characterization of the triboelectric response DNA hydrogel dressing;
[0056] Figure 3 It is the biodegradation test chart of the enzyme-induced triboelectric response DNA hydrogel dressing; the inset is the gel picture corresponding to different degradation times;
[0057] Figure 4 It is the release rate of the embedded substances at different time points of the DNA hydrogel dressing under triboelectric stimulation; among them, (a) is the silver ion release rate; (b) is the VEGF release rate; (c) is the diclofenac sodium release rate;
[0058] Figure 5 It is the antibacterial effect diagram of the DNA hydrogel dressing under triboelectric stimulation; among them, (a) is Escherichia coli; (b) is Staphylococcus aureus;
[0059] Figure 6 It is the effect diagram of promoting wound healing of mice by the DNA hydrogel dressing under triboelectric stimulation; among them, (a) is the image of the full-thickness skin wound on the back of the mouse; (b) is the superimposed diagram of the full-thickness skin wound area on the back of the mouse; (c) is the column chart of the wound healing rate of the full-thickness skin wound on the back of the mouse;
[0060] Figure 7 It is the anti-inflammatory effect diagram of the DNA hydrogel dressing; among them, (a) is the column chart of qPCR of interleukin 1; (b) is the column chart of qPCR of NOS2. Detailed Embodiments
[0061] The following further elaborates on the present invention in conjunction with embodiments, so that those skilled in the art can implement it with reference to the text of the specification.
[0062] It should be understood that terms such as "having", "comprising", and "including" used herein do not exclude the presence or addition of one or more other elements or their combinations.
[0063] Unless otherwise specified, the test methods used in the following examples are all conventional methods. The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified. For those not specifying specific conditions in the following examples, they are carried out under conventional conditions or the conditions recommended by the manufacturer. For reagents or instruments without indicating the manufacturer, they are all conventional products that can be purchased commercially.
[0064] The present invention discloses a triboelectric-responsive DNA hydrogel dressing for promoting wound healing, its preparation method and application. The DNA hydrogel dressing mainly comprises the following components: a DNA triple-junction structure containing silver nanoclusters, linker strands L1 and L2, VEGF (vascular endothelial growth factor), and the drug diclofenac sodium.
[0065] Refer to Figure 1 , which is the schematic diagram for the construction of the triboelectric-responsive DNA hydrogel dressing of the present invention. The preparation steps of the triboelectric-responsive DNA hydrogel dressing are as follows: First, synthesize the DNA triple-junction structure, grow DNA-templated silver nanoclusters on its polycytosine ring, then synthesize DNA linker strands L1 and L2, and assemble the DNA triple-junction structure, DNA linker strand L1, DNA linker strand L2, and VEGF to form a DNA hydrogel. Subsequently, deposit polypyrrole in situ, and finally load the drug diclofenac sodium.
[0066] In a preferred embodiment, the preparation method of the DNA hydrogel dressing comprises the following steps:
[0067] S1. Mix three oligonucleotide strands S1, S2, and S3 in phosphate buffer, and anneal to form a DNA triple-junction structure; subsequently, add an AgNO3 solution to the product, and then add NaBH4 for reduction to obtain a DNA triple-junction structure containing silver nanoclusters;
[0068] S2. Mix oligonucleotide strands H1 and H2 in phosphate buffer, and anneal to form linker strand L1;
[0069] Prepare a reaction solution by mixing Tris-acetate, ethylenediaminetetraacetic acid, and acrylamide. Add acrylamide-modified oligonucleotide strands H3 and H4 to the reaction solution, anneal to form a duplex, and then add ammonium persulfate and TEMED to the resulting product for reaction to obtain linker strand L2;
[0070] S3. Mix the DNA three-way junction structure containing silver nanoclusters, linker L1, linker L2, and VEGF, and react to obtain a DNA hydrogel;
[0071] S4. Immerse the DNA hydrogel prepared in step S3 into a hydrochloric acid solution containing pyrrole, then into a hydrochloric acid solution containing ammonium persulfate, stir, and finally immerse it into a diclofenac sodium solution, and take it out to obtain a triboelectric-responsive DNA hydrogel dressing.
[0072] The present invention utilizes a DNA substrate to achieve good biocompatibility and multi-functional integration to promote the healing of chronic wounds infected with bacteria: The cytosine-rich hairpin structure on the DNA three-way junction structure can serve as a template for the growth of silver nanoclusters. DNA-templated silver nanoclusters have a broad-spectrum antibacterial function, can effectively kill microorganisms and are non-toxic to mammalian cells, avoiding bacterial infection at the wound site; The linker contains an aptamer sequence of VEGF, can target and bind VEGF, and is released on demand under triboelectric drive. The released VEGF can promote the proliferation, migration of endothelial cells and the formation of new capillaries, which is crucial for the later stage of wound healing; The DNA hydrogel has excellent swelling properties and can effectively remove metabolic wastes at the wound site; The unique biocompatibility and degradability of DNA avoid additional inflammatory reactions and secondary injuries during dressing changes.
[0073] The present invention constructs a well-connected circuit path in the gel network through chemically polymerized polypyrrole and complementary base pairing to ensure its excellent electrical response performance, thereby realizing on-demand drug delivery controlled by a triboelectric nanogenerator. When the triboelectric potential is negative, the anionic drug diclofenac sodium in the DNA hydrogel dressing is released to the edge of the hydrogel through electrostatic repulsion and leaves the hydrogel through diffusion and hydration exchange; When the triboelectric potential is positive, the silver nanoclusters in the DNA three-way junction structure are electro-oxidized into positively charged silver ions and are released from the DNA hydrogel dressing by electro-migration; In addition, the continuously changing potential can also change the pore size of the DNA hydrogel, causing the main chain skeleton of the DNA hydrogel to expand, reducing the affinity between VEGF and the linker, and thus releasing VEGF (vascular endothelial growth factor).
[0074] The triboelectric-responsive DNA hydrogel dressing prepared by the present invention can achieve on-demand drug delivery based on the power supply system of a triboelectric nanogenerator and exhibits excellent antibacterial effects. At the same time, it can reduce inflammatory cell infiltration, promote angiogenesis, enhance collagen deposition, and comprehensively accelerate the healing of diabetic wounds infected with bacteria.
[0075] The above is the overall concept of the present invention. The following provides detailed examples and comparative examples on this basis to further illustrate the present invention.
[0076] Example 1
[0077] A preparation method of a triboelectric response DNA hydrogel dressing for promoting wound healing, comprising the following steps:
[0078] S1. Mix three oligonucleotide strands S1, S2, and S3 with a concentration of 600 μM each in a phosphate buffer solution with a pH of 7.4, anneal at 95 °C for 5 min, and naturally cool to room temperature to form a DNA triple junction structure; subsequently, add a 100 μM AgNO3 solution to the product, and then add 100 μM NaBH4 to reduce for 5 h to obtain a DNA triple junction structure containing silver nanoclusters;
[0079] S2. Mix oligonucleotide strands H1 and H2 with a concentration of 900 μM each in a phosphate buffer solution with a pH of 7.4, anneal at 95 °C for 5 min, and naturally cool to room temperature to obtain a connecting strand L1;
[0080] Prepare a reaction solution according to the following formula: Tris-acetate 40 mmol / L, ethylenediaminetetraacetic acid 2 mmol / L, acrylamide 4 wt%, pH 8.0; add acrylamide group-modified oligonucleotide strands H3 and H4 with a concentration of 300 μM each to the reaction solution, anneal at 95 °C for 5 min, and naturally cool to room temperature to form a duplex, and then add ammonium persulfate and TEMED to the obtained product so that the mass concentrations of ammonium persulfate and TEMED are both 1.4%, and react for 20 min to obtain a connecting strand L2;
[0081] S3. Mix the DNA triple junction structure containing silver nanoclusters obtained in step S1, the connecting strand L1 and the connecting strand L2 obtained in step S2 with 100 ng / mL of VEGF, react at 37 °C for 20 min, and naturally cool to room temperature to obtain a DNA hydrogel;
[0082] S4. Immerse the DNA hydrogel prepared in step S3 in a hydrochloric acid (0.01 M) solution containing 0.05 M pyrrole for 2 h, then immerse it in a hydrochloric acid (0.01 M) solution containing 0.05 M ammonium persulfate, stir in an ice bath for 4 h, take it out and wash it clean with distilled water, and finally immerse it in a 250 μg / mL diclofenac sodium solution for 12 h to load the drug, and take it out to obtain a triboelectric response DNA hydrogel dressing.
[0083] In this example, the sequence of S1 is SEQ ID NO: 1:
[0084] TATCATGTTGACTTCTAGACGCTATCCTAGATCCTAAGTTAGTA;
[0085] The sequence of S2 is SEQ ID NO: 2:
[0086] TATCATGTTGACTTTACTAACTTAGGATCCACTAGACAGACGCTAGA T;
[0087] The sequence of S3 is SEQ ID NO: 3:
[0088] TATCATGTTGACTTATCTAGCACCCACCCCCCTCCCAGTCTGTCTAG TGTAGGATAGCGTCTAG;
[0089] The sequence of H1 is SEQ ID NO: 4:
[0090] AAGTCAACATGATACATTCCTACGAAGCT;
[0091] The sequence of H2 is SEQ ID NO: 5:
[0092] AAGTCAACATGATAAGCTTCGTAGGAATGAGGGTGTGGGGGTGGA CGGGCCGGGTAGA;
[0093] The sequence of H3 is SEQ ID NO: 6:
[0094] Acrydite - AAGTCAACATGATACATTCCTACGAAGCT;
[0095] The sequence of H4 is SEQ ID NO: 7:
[0096] Acrydite - AAGTCAACATGATAAGCTTCGTAGGAATGAGGGTGTGGGG GTGGACGGGCCGGGTAGA。
[0097] Example 2 Rotating Disk Triboelectric Nanogenerator Stimulates the Release of Silver Ions from DNA Hydrogel Dressing
[0098] The DNA hydrogel dressing prepared in Example 1 contains silver nanoclusters, which can be oxidized to positively charged silver ions at a positive potential and released from the DNA hydrogel dressing by electromigration.
[0099] Place the DNA hydrogel dressing prepared in Example 1 in the upper chamber of the Transwell. Connect the DNA hydrogel dressing and the rotary triboelectric nanogenerator with wires, and apply electrical stimulation to the DNA hydrogel dressing by the rotary triboelectric nanogenerator at a rotational speed of 60 rpm. Subsequently, add 100 μL of 1×PBS solution to the lower chamber of the Transwell and incubate it with shaking at 37°C. Finally, collect the solution in the lower chamber of the Transwell at different time points (0, 20, 40, 60, 80, 100, 120 min) as the experimental group (TENG).
[0100] Place the DNA hydrogel dressing prepared in Example 1 in the upper chamber of the Transwell. Subsequently, add 100 μL of 1×PBS solution to the lower chamber of the Transwell and incubate it with shaking at 37°C. Finally, collect the solution in the lower chamber of the Transwell at different time points (0, 20, 40, 60, 80, 100, 120 min) as the control group (Control).
[0101] Example 3: Release of VEGF from the DNA hydrogel dressing stimulated by the rotary triboelectric nanogenerator
[0102] The DNA hydrogel dressing prepared in Example 1 contains VEGF. The continuously changing potential of the triboelectricity can change the pore size of the DNA hydrogel, causing the backbone of the DNA hydrogel to swell, reducing the affinity between VEGF and the linker chain containing the VEGF aptamer sequence, and thus releasing VEGF.
[0103] Place the DNA hydrogel dressing prepared in Example 1 in the upper chamber of the Transwell. Connect the DNA hydrogel dressing and the rotary triboelectric nanogenerator with wires, and apply electrical stimulation to the DNA hydrogel dressing by the rotary triboelectric nanogenerator at a rotational speed of 60 rpm. Subsequently, add 100 μL of 1×PBS solution to the lower chamber of the Transwell and incubate it with shaking at 37°C. Finally, collect the solution in the lower chamber of the Transwell at different time points (0, 20, 40, 60, 80, 100, 120 min) as the experimental group (TENG).
[0104] Place the DNA hydrogel dressing prepared in Example 1 in the upper chamber of the Transwell. Subsequently, add 100 μL of 1×PBS solution to the lower chamber of the Transwell and incubate it with shaking at 37°C. Finally, collect the solution in the lower chamber of the Transwell at different time points (0, 20, 40, 60, 80, 100, 120 min) as the control group (Control).
[0105] Example 4 Rotating Disk Triboelectric Nanogenerator Stimulates the Release of Diclofenac Sodium from DNA Hydrogel Dressing
[0106] The DNA hydrogel dressing prepared in Example 1 contains diclofenac sodium. When the triboelectric potential is negative, the anionic drug diclofenac sodium in the DNA hydrogel dressing is released to the edge of the hydrogel through electrostatic repulsion and leaves the hydrogel through diffusion and hydration exchange.
[0107] Place the DNA hydrogel dressing prepared in Example 1 in the upper chamber of a Transwell. Connect the DNA hydrogel dressing and the rotating disk triboelectric nanogenerator with wires. Apply an electrical stimulation to the DNA hydrogel dressing for 30 minutes every 30 minutes at a rotational speed of 60 rpm by the rotating disk triboelectric nanogenerator. Subsequently, add 100 μL of 1×PBS solution to the lower chamber of the Transwell and incubate it with shaking at 37°C. Finally, collect the solution in the lower chamber of the Transwell at different time points (30, 60, 90, 120, 150, 150, 210, 240 min) as the experimental group (TENG).
[0108] In addition, place the DNA hydrogel dressing prepared in Example 1 in the upper chamber of a Transwell. Connect the DNA hydrogel dressing and the electrochemical workstation CHI 660D with wires. Apply an electrical stimulation to the DNA hydrogel dressing for 30 minutes every 30 minutes at voltages of -0.5 V and -1 V respectively by the electrochemical workstation CHI 660D. Subsequently, add 100 μL of 1×PBS solution to the lower chamber of the Transwell and incubate it with shaking at 37°C. Finally, collect the solution in the lower chamber of the Transwell at different time points (30, 60, 90, 120, 150, 150, 210, 240 min) as another experimental group (-0.5 V, -1 V).
[0109] Example 5
[0110] Application of a triboelectric-responsive DNA hydrogel dressing prepared in Example 1 in the treatment of diabetic wounds infected with bacteria, including the following steps:
[0111] 1. Dissolve streptozotocin at a dose of 50 mg / kg in citrate buffer and intraperitoneally inject 8-week-old C57BL / 6 mice for 5 consecutive days. Subsequently, regularly monitor the non-fasting blood glucose level using a blood glucose monitoring system. Mice with a blood glucose level exceeding 16.7 mmol / L are regarded as diabetic mice.
[0112] 2. Anesthetize the diabetic mice with pentobarbital and shave the hair on the back. Cut a circular full-thickness skin wound with a diameter of 8 mm in the center of the back of each mouse and apply 10 μL of bacterial suspension to the wound.
[0113] 3. Divide the mice in Step 2 into two groups. The wounds of one group are not treated otherwise and serve as the control group. The other group serves as the experimental group. Apply the DNA hydrogel dressing to the wound surface to completely cover the wound. Insert the wire into the DNA hydrogel dressing and connect it to the rotary triboelectric nanogenerator through the electrode. Perform 10 min of electrical stimulation at a rotational speed of 60 rpm through the rotary triboelectric nanogenerator every day. The mice are individually housed in a disinfected cage and provided with equal amounts of food and water at a constant temperature.
[0114] Test Example 1
[0115] This test example is used to illustrate the morphological characteristics of the DNA hydrogel dressing prepared in Example 1.
[0116] Test method: Apply conductive carbon paste on the sample stage. Pick up the sample with forceps and stick it on the conductive carbon paste. After the sample stage with the sample is quickly frozen in liquid nitrogen slush for 30 s, transfer it to the sample preparation chamber in a vacuum state using a cryogenic freezing preparation transfer system for sublimation gold plating treatment. After the sample sublimates at -90 °C for 10 min, sputter gold plate it with a current of 10 mA for 60 s and send it to the scanning electron microscope sample chamber for observation. The cold stage temperature is -140 °C and the acceleration voltage is 5 kv.
[0117] Test results: The DNA hydrogel dressing shows a uniform, porous and interconnected internal grid structure. Uniformly dispersed polypyrrole nanoparticles can be clearly observed between the grids, as Figure 2 shown. This structure is conducive to the exchange of nutrients and metabolites and provides a suitable environment for cell growth.
[0118] Test Example 2
[0119] This test example is used to illustrate the degradable characteristics of the DNA hydrogel dressing prepared in Example 1.
[0120] Test method: Evaluate the degradation process by measuring the DNA mass loss. Place the DNA hydrogel dressing in a DNase I solution of 1 U / μL and incubate it with continuous shaking at 37 °C. Take out the sample every 10 min, rinse it with distilled water, freeze-dry it and weigh it.
[0121] Test results: When DNase I is added, the ssDNA and dsDNA in the hydrogel are cleaved, resulting in a phase change of the DNA hydrogel, which switches from the gel state to the solution state approximately after 80 min, as Figure 3 shown. This degradable characteristic helps the hydrogel dressing to benignly detach from the wound site, avoiding secondary damage caused by adhesion during dressing removal.
[0122] Test Example 3
[0123] This test example is used to illustrate the ability of the DNA hydrogel dressing prepared in Example 1 to respond to triboelectric stimulation and release silver ions.
[0124] Test method: Use a silver ion detection kit to detect the silver ion content in the solution collected in Example 2. Take a clean colorimetric tube and add the solution to be tested. Add 1 packet of silver (I) reagent, shake well and then add 1 packet of silver (II) reagent, shake well to dissolve. Subsequently, add 1 ml of silver (III) reagent, slowly shake well to dissolve, and let it stand for reaction for 15 min. Raise the colorimetric tube to a blank area about 1 cm above the colorimetric card and visually compare the color from top to bottom with the standard color scale. The color scale with the same color tone as the solution is the silver ion content in the water sample.
[0125] Test results: The silver ions released from the DNA hydrogel dressing in the control group within 120 min were negligible, while under the stimulation of the triboelectric nanogenerator within 120 min, about 54.06% of the silver ions were released from the DNA hydrogel dressing in the experimental group, as Figure 4 shown in a.
[0126] Test Example 4
[0127] This test example is used to illustrate the ability of the DNA hydrogel dressing prepared in Example 1 to respond to triboelectric stimulation and release VEGF.
[0128] Test method: Use a VEGF enzyme-linked immunosorbent assay kit to detect the VEGF content in the solution collected in Example 3. The pre-coated antibody is a VEGF monoclonal antibody. The detection phase antibody is a VEGF polyclonal antibody, which is biotin-labeled. After the sample and the biotin-labeled antibody are added to the enzyme-linked immunosorbent assay plate wells for reaction in sequence, wash with PBS. Subsequently, add peroxidase-labeled avidin for reaction; after thorough washing with PBS, develop color with the substrate TMB. TMB is converted into blue under the catalysis of peroxidase and into the final yellow under the action of acid. The intensity of the color is positively correlated with the VEGF in the sample.
[0129] Test results: After 120 min of stimulation by the triboelectric nanogenerator, the VEGF release rate increased from 2.9% to 49.8%, as Figure 4 shown in b.
[0130] Test Example 5
[0131] This test example is used to illustrate the ability of the DNA hydrogel dressing prepared in Example 1 to respond to triboelectric stimulation and release diclofenac sodium.
[0132] Test method: Use an ultraviolet spectrophotometer to detect the diclofenac sodium content in the solution collected in Example 4. Diclofenac sodium has a specific ultraviolet absorption peak at 276 nm.
[0133] Test results: During the electrostimulation phase, the release rate of diclofenac sodium increased significantly. Even after the power supply was removed, diclofenac sodium still exhibited the property of slow release. By increasing the voltage from -0.5 V to -1 V using an electrochemical workstation, after 240 minutes, the release rate of diclofenac sodium increased from 67.1% to 81.6%. After connecting the rotary triboelectric nanogenerator, the release rate of DS2 was further increased to 96.2%, as shown in Figure 4 Figure c
[0134] Test Example 6
[0135] This test example is used to illustrate the antibacterial performance of the triboelectric-responsive DNA hydrogel dressing prepared in Example 1.
[0136] Bacterial species selection: Staphylococcus aureus and Escherichia coli were used as model bacterial species for testing.
[0137] Test method: One colony was selected from each strain's petri dish and inoculated into LB medium. The culture was incubated overnight at 37°C and 200 rpm on a shaker. The bacterial culture was harvested during the logarithmic growth phase and centrifuged at 9000 rpm for 2 min. Then the bacteria were diluted to approximately 10 8 CFU / mL for the antibacterial experiment. Each type of bacteria was divided into a control group and an experimental group. The bacteria in the experimental group were co-cultured with the DNA hydrogel dressing for 30 min. The hydrogel was connected to the rotary triboelectric nanogenerator through a wire and received 10 min of electrostimulation. After treatment, the bacteria were cultured on the shaker for 12 h, and the absorbance was measured every 1 h during this period.
[0138] Test results: As shown in Figure 5 , compared with the control group, the bacteria in the experimental group stopped growing within 12 h.
[0139] Figures 5 - 7 In the figure, the "TENG" curve represents treatment only by triboelectrification, the "Gel" curve represents treatment only by the hydrogel, and the "Gel-TENG" curve represents treatment by the combination of triboelectrification and the hydrogel.
[0140] Test Example 7
[0141] This test example is used to illustrate the ability of the triboelectric-responsive DNA hydrogel dressing prepared in Example 1 to promote the healing of diabetic wounds infected with bacteria.
[0142] Test method: The wound images of the mice in Example 5 were recorded using a camera on days 0, 3, 7, 10, and 14. The wound area was measured using Image J software, and the corresponding wound area ratio was calculated and plotted to analyze the wound healing situation. The definition of the wound area ratio is the ratio of the wound area after treatment to the original wound area.
[0143] Test results: As shown in Figure 6, by the 14th day, the wounds in the experimental group were almost completely closed. The wound healing rate exceeded 80% at 7 days and reached 99.8% at 14 days.
[0144] Test Example 8
[0145] This test example is used to illustrate the anti-inflammatory effect of the triboelectric-responsive DNA hydrogel dressing prepared in Example 1.
[0146] Test method: On the 3rd, 7th, 10th, and 14th days after treatment of the mice in Example 5, one mouse was selected from each group for euthanasia, and the skin tissue around the wound was excised. Total RNA was extracted from the wound tissue, reverse transcribed into cDNA using a qPCR reverse transcription kit, and then qRT-PCR was performed using SYBR Green real-time PCR premix to analyze the relative changes in interleukin 1 (IL-1) and nitric oxide synthase 2 (NOS2). Interleukin 1 and nitric oxide synthase 2 have pro-inflammatory functions, and their relative changes are related to the anti-inflammatory effect of the DNA hydrogel dressing.
[0147] Test results: As Figure 7 shown, on the 3rd day, IL-1 in the control group remained at a high level, while the expression of IL-1 in the treatment group was low. As the treatment time continued, the expression level of IL-1 in the experimental group continued to decrease, which means the improvement of inflammatory symptoms. NOS2 showed a similar trend to IL-1, and the expression level of NOS2 in the experimental group decreased significantly on different days.
[0148] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and embodiments. It can be fully applied to various fields suitable for the present invention. For those skilled in the art, additional modifications can be easily made. Therefore, without departing from the general concept defined by the claims and the equivalent scope, the present invention is not limited to specific details.
Claims
1. A preparation method of a triboelectric response DNA hydrogel dressing for promoting wound healing, characterized in that, It includes the following steps: S1. Synthesize a DNA three-way junction structure, and then grow silver nanoclusters on the DNA three-way junction structure to obtain a DNA three-way junction structure containing silver nanoclusters; S2. Synthesize DNA linker chains: linker chain L1 and linker chain L2; S3. Assemble the DNA three-way junction structure containing silver nanoclusters, linker chain L1, linker chain L2 and VEGF to form a DNA hydrogel; S4. In-situ deposit polypyrrole on the DNA hydrogel, and then load the drug diclofenac sodium to obtain a triboelectric response DNA hydrogel dressing.
2. The preparation method of the triboelectric response DNA hydrogel dressing for promoting wound healing according to claim 1, characterized in that The DNA three-way junction structure is composed of three oligonucleotide chains S1, S2 and S3 with partial base complementary pairing; Linker chain L1 is composed of oligonucleotide chains H1 and H2, and linker chain L2 is composed of acrylamide-modified oligonucleotide chains H3 and H4. Among them, both H2 and H4 contain an aptamer sequence of VEGF.
3. The preparation method of the triboelectric-responsive DNA hydrogel dressing for promoting wound healing according to claim 2, wherein The sequence of S1 is: TATCATGTTGACTTCTAGACGCTATCCTAGATCCTAAGTTAGTA; The sequence of S2 is: TATCATGTTGACTTTACTAACTTAGGATCCACTAGACAGACGCTAGAT; The sequence of S3 is: TATCATGTTGACTTATCTAGCACCCACCCCCCTCCCAGTCTGTCTAGTGTAGGATAGCGTCTAG; The sequence of H1 is: AAGTCAACATGATACATTCCTACGAAGCT; The sequence of H2 is: AAGTCAACATGATAAGCTTCGTAGGAATGAGGGTGTGGGGGTGGACGGGCCGGGTAGA; The sequence of H3 is: Acrydite-AAGTCAACATGATACATTCCTACGAAGCT; The sequence of H4 is: Acrydite-AAGTCAACATGATAAGCTTCGTAGGAATGAGGGTGTGGGGGTGGACGGGCCGGGTAGA.
4. The preparation method of the triboelectric-responsive DNA hydrogel dressing for promoting wound healing according to claim 1, characterized in that, It includes the following steps: S1. Mix the three oligonucleotide chains S1, S2 and S3 in phosphate buffer, anneal to form a DNA three-way junction structure; then add AgNO3 solution to the product, and then add NaBH4 for reduction to obtain a DNA three-way junction structure containing silver nanoclusters; S2. Mix the oligonucleotide chains H1 and H2 in phosphate buffer, anneal to form linker chain L1; Prepare a reaction solution by mixing Tris-acetic acid, ethylenediaminetetraacetic acid and acrylamide. Add acrylamide-modified oligonucleotide chains H3 and H4 to the reaction solution, anneal to form a duplex, and then add ammonium persulfate and TEMED to the obtained product for reaction to obtain linker chain L2; S3. Mix the DNA three-way junction structure containing silver nanoclusters, linker chain L1, linker chain L2 and VEGF, and react to obtain a DNA hydrogel; S4. Immerse the DNA hydrogel prepared in step S3 into a hydrochloric acid solution containing pyrrole, then immerse it into a hydrochloric acid solution containing ammonium persulfate, stir, and finally immerse it into a diclofenac sodium solution, and take it out to obtain a triboelectric response DNA hydrogel dressing.
5. The preparation method of the triboelectric response DNA hydrogel dressing for promoting wound healing according to claim 4, characterized in that, It includes the following steps: S1. Mix three oligonucleotide strands S1, S2, and S3 in a phosphate buffer solution with a pH of 7.4, and anneal at 95 °C for 2 - 10 min to form a DNA three-way junction structure; then add an AgNO3 solution to the product, and then add NaBH4 to reduce for 2 - 10 h to obtain a DNA three-way junction structure containing silver nanoclusters; S2. Mix oligonucleotide strands H1 and H2 in a phosphate buffer solution with a pH of 7.4, anneal at 95 °C for 2 - 10 min, and cool to obtain the connecting strand L1; Prepare a reaction solution by mixing Tris-acetate, ethylenediaminetetraacetic acid, and acrylamide. Add acrylamide group-modified oligonucleotide strands H3 and H4 to the reaction solution, anneal to form a duplex, and then add ammonium persulfate and TEMED to the obtained product, and react to obtain the connecting strand L2; S3. Mix the DNA three-way junction structure containing silver nanoclusters, the connecting strand L1, the connecting strand L2, and VEGF, react at 37 °C for 10 - 40 min, and cool to obtain a DNA hydrogel; S4. Immerse the DNA hydrogel prepared in step S3 into a hydrochloric acid solution containing pyrrole for 1 - 4 h, then immerse it into a hydrochloric acid solution containing ammonium persulfate, stir for 2 - 8 h, and finally immerse it into a diclofenac sodium solution, and take it out to obtain a triboelectric response DNA hydrogel dressing.
6. The preparation method of the triboelectric response DNA hydrogel dressing for promoting wound healing according to claim 5, characterized in that, In step S1, the molar ratio of the DNA three-way junction structure, AgNO3, and NaBH4 is 6:1:1; In step S3, the concentration ratio of the DNA three-way junction structure, the duplex L1, and the duplex L2 is 2:3:
1.
7. The preparation method of the triboelectric response DNA hydrogel dressing for promoting wound healing according to claim 6, wherein It includes the following steps: S1. Mix three oligonucleotide strands S1, S2, and S3 with a concentration of 600 μM each in a phosphate buffer solution with a pH of 7.4, anneal at 95 °C for 5 min, and naturally cool to room temperature to form a DNA three-way junction structure; then add a 100 μM AgNO3 solution to the product, and then add 100 μM NaBH4 to reduce for 5 h to obtain a DNA three-way junction structure containing silver nanoclusters; S2. Mix oligonucleotide strands H1 and H2 with a concentration of 900 μM each in a phosphate buffer solution with a pH of 7.4, anneal at 95 °C for 5 min, and naturally cool to room temperature to obtain the connecting strand L1; Prepare a reaction solution according to the following formula: Tris-acetate 40 mmol / L, ethylenediaminetetraacetic acid 2 mmol / L, acrylamide 4 wt%, pH 8.0; add acrylamide group-modified oligonucleotide strands H3 and H4 with a concentration of 300 μM each to the reaction solution, anneal at 95 °C for 5 min, and naturally cool to room temperature to form a duplex. Then add ammonium persulfate and TEMED to the obtained product, and make the mass concentration of ammonium persulfate and TEMED both 1.4%, and react for 20 min to obtain the connecting strand L2; S3. Mix the DNA three-way junction structure containing silver nanoclusters obtained in step S1, the linker L1 and the linker L2 obtained in step S2 with 100 ng / mL of VEGF, react at 37 °C for 20 min, and naturally cool to room temperature to obtain a DNA hydrogel; S4. Immerse the DNA hydrogel prepared in step S3 in a hydrochloric acid solution containing 0.05 M pyrrole for 2 h, then immerse it in a hydrochloric acid solution containing 0.05 M ammonium persulfate, stir in an ice bath for 4 h, take it out and wash it clean with distilled water, and finally immerse it in a 250 μg / mL diclofenac sodium solution for 12 h, take it out to obtain a triboelectric-responsive DNA hydrogel dressing.
8. A triboelectric-responsive DNA hydrogel dressing for promoting wound healing, characterized in that, It is prepared by the method described in any one of claims 1-7.
9. Use of a triboelectric-responsive DNA hydrogel dressing as described in claim 8 in the control of drug release by using a triboelectric nanogenerator for power supply.
10. Use of a triboelectric-responsive DNA hydrogel dressing as described in claim 8 in the preparation of a drug-controlled release material.
11. Use of a triboelectric-responsive DNA hydrogel dressing as described in claim 8 in the preparation of a drug for treating diabetic wounds infected with bacteria.
12. Use of a triboelectric-responsive DNA hydrogel dressing as described in claim 8 in the preparation of an antibacterial and / or anti-inflammatory material.