Protein related to rice nitrogen utilization as well as coding gene and application thereof

Abstract

The invention discloses a protein related to rice nitrogen utilization as well as a coding gene and application thereof, and belongs to the technical field of plant genetic engineering. The amino acid sequence of the protein comprises an amino acid sequence as shown in SEQ ID NO.2, or a derivative amino acid sequence which is obtained by substituting and / or deleting and / or adding one or more amino acid residues on the amino acid sequence as shown in SEQ ID NO.2 and has the same activity as the protein composed of the amino acid sequence as shown in SEQ ID NO.2, and the like. The coding gene of the protein is reversely knocked out through a transgenic technology, transgenic rice with obviously weakened nitrogen utilization is obtained, the gene can effectively regulate and control the nitrogen utilization rate of the rice, it is possible to adjust the nitrogen utilization rate of plants by applying the gene, and the yield and quality of crops under the low-nitrogen condition in unit area of cultivated land can be improved.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and specifically relates to a protein related to nitrogen utilization in rice, its encoding gene, and applications thereof. Background Art

[0002] Rice is one of the most important food crops globally, and its growth and yield are significantly affected by nitrogen supply. Nitrogen is an essential mineral nutrient for plant growth and development, and plays an important role in crop biomass accumulation, yield formation, and quality improvement. The application of nitrogen fertilizers has made a great contribution to crop yields and global food security, but it has also caused serious environmental problems, such as soil acidification and water eutrophication. Therefore, it is crucial to improve crop nitrogen use efficiency (NUE) to achieve high yields with low nitrogen input. However, modern breeding programs usually aim to obtain high yields under high nitrogen supply, which may lead to the prevalence of low nitrogen use efficiency varieties. Although nitrogen fertilizer use efficiency can be improved through field management, genetic improvement of high nitrogen fertilizer use efficiency varieties is a more fundamental strategy.

[0003] Ubiquitination is a very important post-translational modification process in eukaryotic cells. E3 ubiquitin ligases determine the specific recognition of target proteins and play an important role in the ubiquitin pathway. The SCF complex is one of the largest classes of E3 ligases. The SCF complex consists of SKP1, CUL1, RBX1, and F-box proteins. F-box proteins are responsible for substrate binding specificity and mediate the ubiquitination and degradation of target proteins. Currently, there are relatively few reports on the regulation of nitrogen use efficiency by F-box in rice. Summary of the Invention

[0004] Aiming at the deficiencies in the prior art, the object of the present invention is to provide a protein related to nitrogen utilization in rice, its encoding gene, and applications thereof.

[0005] The technical solution of the present invention to solve the above technical problems is as follows: Provide a protein related to nitrogen utilization in rice, and the amino acid sequence of the protein comprises one selected from the following amino acid sequences: (1) The amino acid sequence shown in SEQ ID NO.2; (2) A derivative amino acid sequence obtained by substituting and / or deleting and / or adding one or more amino acid residues to the amino acid sequence shown in SEQ ID NO.2, but having the same activity as the protein composed of the amino acid sequence shown in SEQ ID NO.2; (3) An amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology with the amino acid sequence shown in SEQ ID NO.2, and having the same activity as the protein composed of the amino acid sequence shown in SEQ ID NO.2; (4) An active fragment containing any one of the amino acid sequences in (1)-(3).

[0006] The present invention also provides a gene encoding the above-mentioned protein related to nitrogen utilization in rice.

[0007] Furthermore, the nucleotide sequence of the gene includes one selected from the following: (1) The nucleotide sequence shown in SEQ ID NO.1; (2) A derivative amino acid sequence obtained by substituting and / or deleting and / or adding one or more nucleotide sequences to the nucleotide sequence shown in SEQ ID NO.1, but the encoded protein still has the same function as the protein encoded by the nucleotide sequence shown in SEQ ID NO.1; (3) An amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology with the nucleotide sequence shown in SEQ ID NO.1, and the encoded protein still has the same function as the protein encoded by the nucleotide sequence shown in SEQ ID NO.1; (4) An active fragment containing any one of the nucleotide sequences in (1)-(3).

[0008] The present invention also provides a recombinant construct containing the above-mentioned gene, and the recombinant construct is an expression cassette, a recombinant vector, a transgenic cell line or a recombinant bacterium.

[0009] The present invention also provides a method for cultivating transgenic plants, specifically by inhibiting the expression of the gene of the protein related to nitrogen utilization in rice in the target plant as described above to obtain a transgenic plant with a reduced nitrogen content in vivo.

[0010] Furthermore, the method for inhibiting the expression of the gene of the protein related to nitrogen utilization in rice in the target plant is: inserting a specific DNA fragment into the AarI recognition site of the pCLCSGHSRL2-2 vector to obtain a recombinant vector, and then introducing the recombinant vector into the target plant to obtain a transgenic plant; The nucleotide sequence of the specific DNA fragment is nucleotides 1465 - 1483 from the 5'-end of SEQ ID NO.1, as shown in SEQ ID NO.3; The nucleotide sequence of the pCLCSGHSRL2-2 vector is as shown in SEQ ID NO.4.

[0011] Furthermore, the method for inhibiting the expression of the gene of the protein related to rice nitrogen utilization in the target plant as described above is: reverse knockout or weakening of the gene of the protein related to rice nitrogen utilization in the target plant to obtain a transgenic plant.

[0012] Furthermore, the target plant is a dicotyledonous or monocotyledonous plant.

[0013] Furthermore, the monocotyledonous plant is rice.

[0014] The present invention has the following beneficial effects: The present invention provides an RCN128 protein, which belongs to the F-box protein. Experiments of the present invention prove that by reverse knockout of the coding gene of the above protein through transgenic technology to inactivate the protein, a transgenic rice with significantly weakened nitrogen utilization is obtained, proving that the gene can effectively regulate the nitrogen utilization rate of rice, making it possible to apply the gene to adjust plant nitrogen utilization, and capable of improving the yield and quality of crops under low nitrogen conditions per unit area of cultivated land. Description of the Drawings

[0015] Figure 1 It is a phenotypic control diagram of wild-type Nipponbare plants and T1-generation mutant plants. Among them, NIP is the wild-type Nipponbare plant, and rcn128-1 and rcn128-2 are the progeny of two different editing methods of T0-generation RCN128 transgenic rice; Figure 2 It is the total nitrogen content of wild-type Nipponbare plants and T1-generation mutant plants. Among them, NIP is the wild-type Nipponbare plant, and rcn128-1 and rcn128-2 are the progeny of two different editing methods of T0-generation RCN128 transgenic rice; Figure 3 It is the sequencing result peak diagram of the T0-generation RCN128 transgenic rice and the wild-type Nipponbare NIP reference sequence at the position shown in SEQ ID NO.3. Among them, T0-rcn128-1 and T0-rcn128-2 are two different editing methods of T0-generation RCN128 transgenic rice. Detailed Embodiments

[0016] The principles and features of the present invention will be described below in conjunction with embodiments. The examples cited are only for explaining the present invention and are not intended to limit the scope of the present invention. For those conditions not specified in the examples, they shall be carried out according to conventional conditions or the conditions recommended by the manufacturer. For reagents or instruments without indicating the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0017] Agrobacterium tumefaciens EHA105 is described in New Agrobacterium helper plasmids for gene transfer to plants. Hood, Elizabeth E; Gelvin, Stanton B; Melchers, Leo S; Hoekema, Andre. Transgenic Research, 2(4): p. 208 - 218 - 218 (1993). The public can obtain it from the Institute of Crop Science, Chinese Academy of Agricultural Sciences.

[0018] Cultivation conditions of rice materials: Soak rice seeds in water for 3 days, and then sow them on the seedbed. Rice seedlings at the four - leaf stage are transplanted into paddy fields, and transplanted individually.

[0019] Example 1, RCN128 protein and its encoding gene In the reverse knockout progeny of the japonica rice variety Nipponbare, a phenotypic change of plant dwarfing and yellowish leaves was found due to the loss of function of a target gene. In this rice mutant, through sequencing, it was found that a specific DNA molecular fragment in the target gene had a base deletion or insertion, resulting in premature termination of translation, indicating that the reduction of nitrogen in the mutant body was caused by the mutation of this target gene. This target gene was named RCN128, and the protein encoded by this target gene was named RCN128 protein. Among them, the amino acid sequence of RCN128 protein is shown in SEQ ID NO.2; the nucleotide sequence of its coding sequence is shown in SEQ ID NO.1; the nucleotide sequence of this specific DNA molecular fragment is the 1462 - 1483rd nucleotides from the 5' end of SEQ ID NO.1, as shown in SEQ ID NO.3.

[0020] SEQ ID NO.1: SEQ ID NO.2: SEQ ID NO.3: Example 2. Construction of knockout vector 1. Obtaining of recombinant expression vector Replace the small fragment between the AarI recognition sequences of the pCLCSGHSRL2-2 vector shown in SEQ ID NO.4 with the specific DNA molecular fragment shown in SEQ ID NO.3 to obtain a recombinant vector. The recombinant vector with correct sequencing is labeled as pCLCSGHSRLL2-2-RCN128.

[0021] Specific operation method: Cut the pCLCSGHSRL2-2 vector with Aar1 enzyme, and add the linker sequence AGATGATCCGTGGCA…N19…GTTTTAGAGCTATGC before and after the specific DNA molecular fragment shown in SEQ ID NO.3 as the F primer; reverse complement the obtained F primer to obtain the R primer for synthesis; add 1 μl of each of the F and R primers (the primer mother solution is 100 p) to a 10 μl system, incubate at 94°C for 10 min, anneal at 0.1°C / s to 15°C, and maintain at 15°C for 10 min to complete annealing; take 1 μl of the annealed product and perform infusion with the digested pCLCSGHSRL2-2 vector (1 μl of vector, 1 μl of annealed product, 0.5 μl of recombinase, 2.5 μl system), incubate at 50°C for 20 min, transfer to DH5α, and spread on kana solid medium; after determining that the fragment is correct by sequencing, return the plasmid to obtain the recombinant vector pCLCSGHSRLL2-2-RCN128.

[0022] 2. Obtaining of RCN128 rice (Nipponbare) Transfer the obtained pCLCSGHSRLL2-2-RCN128 into Agrobacterium tumefaciens EHA105 by heat shock method to obtain a recombinant bacterium, and name the recombinant bacterium containing this plasmid as EHA105 / pCLCSGHSRLL2-2-RCN128.

[0023] Husk and sterilize the mature seeds of rice (Oryza sativa) Nipponbare, and inoculate them into the medium for inducing callus. After culturing for 3 weeks, callus grows from the scutellum. Select the embryogenic callus with strong growth, light yellow color, and relatively loose texture as the receptor for transformation.

[0024] The embryogenic calli were infected with the obtained EHA105 / pCLCSGHSRLL2-2-RCN128, cultured at 25°C in the dark for 3 days, and then screened for resistant calli and transgenic plants on a selection medium containing 50 mg / L hygromycin. The hygromycin-resistant plants were acclimatized in the shade and transplanted to paddy fields after a few days to obtain T0 generation RCN128 transgenic rice (Nipponbare).

[0025] Using Hyg-Phe (5′-ATGACGACGGTCTGGCCGCCG′) and Hyg-R (5′-ATGTGTGCTCCTCCCAGCGAAT-3′) as primers, PCR amplification was performed on the T0 generation RCN128 transgenic rice to obtain a target fragment of 338 bp in size, and sequencing was performed using the primer Hyg-R (ATGTGTGCTCCTCCCAGCGAAT). It was found that there were Indel differences compared with the wild-type Nipponbare sequence, indicating that the RCN128 gene was edited, and positive T0 generation RCN128 transgenic rice was obtained. Figure 3 It is a comparison result diagram of the differences at the position shown in SEQ ID NO.3 between the T0 generation RCN128 transgenic rice of two different editing methods (T0-rcn128-1 and T0-rcn128-2, where rcn128 is the mutant, and 1 and 2 are two different editing methods of the same batch of T0 generation RCN128 transgenic rice) and the wild-type Nipponbare NIP reference sequence.

[0026] 3. Functional verification of RCN128 in regulating nitrogen utilization in rice Seeds were harvested from the above-obtained positive T0 generation RCN128 transgenic rice and sown to obtain T1 generation mutant seeds. The T1 generation mutants and wild-type Nipponbare were planted under high-nitrogen and low-nitrogen conditions to observe the phenotypes of the transgenic plants. The results are as Figure 1 shown (rcn128-1 and rcn128-2 are the family descendants of T0-rcn128-1 and T0-rcn128-2 respectively). It can be seen from the figure that compared with the wild-type Nipponbare plants, the plant heights of rcn128-1 and rcn128-2 decreased. The total nitrogen content of rice plants was measured using a Kjeltec TM 9 fully automatic Kjeldahl nitrogen analyzer. The results are shown as Figure 2 shown. It can be seen from Figure 2 that compared with the wild-type Nipponbare plants, the nitrogen absorption ability of the T1 generation mutants decreased. The above results indicate that the RCN128 gene can regulate the growth and development of rice and the absorption and utilization of nitrogen.

[0027] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims

1. A protein related to nitrogen utilization in rice, characterized in that, The amino acid sequence of the said protein comprises one selected from the following amino acid sequences: (1) The amino acid sequence shown as SEQ ID NO.2; (2) A derivative amino acid sequence obtained by substituting and / or deleting and / or adding one or more amino acid residues to the amino acid sequence shown as SEQ ID NO.2, but having the same activity as the protein composed of the amino acid sequence shown as SEQ ID NO.2; (3) An amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology with the amino acid sequence shown as SEQ ID NO.2, and having the same activity as the protein composed of the amino acid sequence shown as SEQ ID NO.2; (4) An active fragment containing any one of the amino acid sequences in (1)-(3).

2. A gene encoding the protein according to claim 1.

3. The gene according to claim 2, wherein The nucleotide sequence of the said gene comprises one selected from the following: (1) The nucleotide sequence shown as SEQ ID NO.1; (2) A derivative amino acid sequence obtained by substituting and / or deleting and / or adding one or more nucleotide sequences to the nucleotide sequence shown as SEQ ID NO.1, but the protein encoded thereby still having the same function as the protein encoded by the nucleotide sequence shown as SEQ ID NO.1; (3) An amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology with the nucleotide sequence shown as SEQ ID NO.1, and the protein encoded thereby still having the same function as the protein encoded by the nucleotide sequence shown as SEQ ID NO.1; (4) An active fragment containing any one of the nucleotide sequences in (1)-(3).

4. A recombinant construct comprising the gene according to claim 2 or 3, characterized in that The said recombinant construct is an expression cassette, a recombinant vector, a transgenic cell line or a recombinant bacterium.

5. A method for cultivating transgenic plants, characterized in that, By inhibiting the expression of the gene as claimed in claim 2 or claim 3 in a target plant, a transgenic plant with a reduced nitrogen content in vivo is obtained.

6. The method according to claim 5, wherein The method for inhibiting the expression of the gene as claimed in claim 2 or claim 3 in a target plant is: inserting a specific DNA fragment into the AarI recognition site of the pCLCSGHSRL2-2 vector to obtain a recombinant vector, and then introducing the said recombinant vector into the said target plant to obtain the said transgenic plant; the nucleotide sequence of the said specific DNA fragment is the nucleotide at positions 1465-1483 from the 5'-end of SEQ ID NO.1, as shown in SEQ ID NO.3; The nucleotide sequence of the said pCLCSGHSRL2-2 vector is as shown in SEQ ID NO.

4.

7. The method according to claim 5, wherein The method for inhibiting the expression of the gene as described in claim 2 or claim 3 in the target plant is: reverse knockout or attenuation of the gene as described in claim 2 or claim 3 in the target plant to obtain the transgenic plant.

8. The method according to any one of claims 5 to 7, characterized in that The target plant is a dicotyledonous or monocotyledonous plant.

9. The method according to claim 8, characterized in that, The monocotyledonous plant is rice.

Images