Recombinant pigeon interferon alpha and application thereof in preparation of medicine for resisting pigeon paramyxovirus infection
Through the CHO cell expression system and Fc fusion technology, efficient and stable recombinant pigeon α interferon piINF-5 was prepared, which solved the problem of insufficient stability and activity of traditional pigeon interferons, achieved efficient treatment of pigeon paramyxovirus, and significantly improved antiviral activity and survival rate.
Patent Information
- Application Number
- CN202510461679.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-14
- Publication Date
- 2025-07-11
- Estimated Expiration
- 2045-04-14
AI Technical Summary
The existing anti-pigeon paramyxovirus drugs have limited effects, and there are problems with species differences and immune tolerance. Traditional pigeon interferon has short half-life, insufficient stability and activity, and lacks efficient treatment methods.
Using the CHO cell expression system, recombinant pigeon interferon piINF-5 was prepared by fusion of pigeon interferon with the Fc fragment of pigeon IgG and optimized codon combination, which enhanced its stability and half-life, and efficient expression of CHO cells to obtain high yield and high activity recombinant proteins.
The recombinant pigeon interferon piINF-5 significantly improved the antiviral activity and extended the half-life to 8.16 hours. It can effectively activate the host immune system, significantly reduce the pigeon paramyxovirus titer, improve the pigeon flock's disease resistance, reach 80%, and show efficient antiviral effects in the body.
Smart Images

Figure BDA0005357310250000061 
Figure BDA0005357310250000081 
Figure BDA0005357310250000091
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of interferon genetic engineering, and particularly relates to recombinant pigeon α - interferon and its application in the preparation of drugs for preventing pigeon paramyxovirus infection. The pigeon α - interferon provided by the present invention has the characteristics of high activity, good antiviral effect and long half - life. Background Art
[0002] Pigeon Paramyxovirus (PPMV) is one of the important pathogens in the pigeon - raising industry. It can cause respiratory diseases, digestive system problems and neurological symptoms in pigeon flocks, and even lead to the death of pigeons. The virus has strong infectivity, and due to its high variability, the current vaccines and drug treatments have limited effects. There is an urgent need to develop effective antiviral drugs. At present, there are no widely used drugs for the treatment of pigeon paramyxovirus. Conventional antiviral drugs have weak effects and are prone to drug resistance. Therefore, finding a treatment method that can significantly improve antiviral activity, especially an immunopreparation that can activate the host immune system and fight against the virus, has important scientific research and application values.
[0003] Interferons (IFNs) are a class of cytokines that can activate the host immune system and inhibit virus replication. Clinically, pigeon viral diseases occur frequently. As a natural, broad - spectrum and highly effective antiviral drug, pigeon interferon has a certain market demand. However, there are currently no commercially available products of pigeon interferon, and avian interferon is mostly used for treatment. Therefore, it is urgent to develop a pigeon interferon preparation that has both antiviral effects and immunomodulatory functions.
[0004] However, there are some problems in the existing interferon treatments, such as species differences, immune tolerance of drugs, limited short - term efficacy, etc. Among them, the research on pigeon interferon is relatively less. Therefore, improving the half - life, stability and activity of pigeon interferon has become an important research direction for pigeon interferon. The Fc - fusion protein technology can significantly extend the half - life of proteins and enhance their stability by fusing the target protein with the Fc fragment of immunoglobulin G (IgG). To further optimize the treatment effect of pigeon interferon, pigeon α - interferon is combined with Fc - fusion protein technology. This scheme not only enhances the efficacy of interferon but also extends its half - life in vivo, providing a more efficient and lasting solution for antiviral treatment.
[0005] CHO cells (Chinese hamster ovary cells), as a commonly used eukaryotic expression system, have the ability to efficiently and stably express foreign proteins. Compared with other expression systems, CHO cells can provide accurate glycosylation modification, which helps the correct folding of recombinant proteins and the retention of biological activity. CHO cells have become an ideal system for large-scale production of recombinant proteins and are widely used in the pharmaceutical industry. Therefore, the CHO system can provide recombinant pigeon interferon proteins with high yield, high purity, and biological activity. Summary of the Invention
[0006] The object of the present invention is to provide a synthetic recombinant pigeon α-interferon piINF-5, the amino acid sequence of the interferon is shown in SEQ ID NO.13, and one of the nucleotide sequences encoding it is shown in SEQ ID NO.14.
[0007] Another object of the present invention is to provide the application of recombinant pigeon α-interferon in the preparation of drugs for preventing pigeon paramyxovirus infection.
[0008] In order to achieve the above object, the present invention takes the following technical measures:
[0009] The applicant decomposes, combines, and simultaneously optimizes the codons of pigeon α-interferon and the Fc fragment of pigeon IgG, and finally screens out the optimal combination to obtain recombinant pigeon α-interferon piINF-5. The amino acid sequence of the interferon piINF-5 is shown in SEQ ID NO.13, and it is a recombinant protein.
[0010] The protection scope of the present invention also includes:
[0011] The coding gene of the recombinant protein shown in SEQ ID NO.13.
[0012] An expression cassette, recombinant vector, recombinant microorganism, or isolated recombinant cell having the above coding gene.
[0013] The application of the above recombinant protein, recombinant protein coding gene, or expression cassette, recombinant vector, recombinant microorganism, or isolated recombinant cell having the above coding gene in the preparation of recombinant pigeon interferon.
[0014] The application of the above recombinant protein, recombinant protein coding gene, or expression cassette, recombinant vector, recombinant microorganism, or isolated recombinant cell having the above coding gene in the preparation of drugs for treating or preventing pigeon virus infection.
[0015] For the above applications, preferably, the pigeon viruses include: pigeon paramyxovirus or vesicular stomatitis virus.
[0016] The isolated recombinant cell in the above application is an isolated recombinant CHO cell.
[0017] The encoded gene described above is preferably the one shown in SEQ ID NO. 14.
[0018] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0019] The present invention relates to a recombinant pigeon interferon with high efficiency, stability and high biological activity. Through the CHO cell expression system, the applicant has successfully overcome the problems of low efficiency and instability of traditional monomeric interferons, providing a new drug option for the treatment of pigeon paramyxovirus disease.
[0020] The recombinant pigeon interferon piINF-5 of the present application has the following characteristics: high yield, reaching 0.6 g / L; strong antiviral activity, reaching 3.5×10 6 IU / mg, and having no obvious cytotoxicity. This recombinant pigeon interferon can effectively stimulate cells to increase the transcriptional levels of multiple immune-related genes, including ISG15, Mx, IFIT5 and IFITM10, showing significant biological activity.
[0021] Further research shows that the recombinant pigeon interferon piINF-5 can significantly reduce the titer and hemagglutination titer of pigeon paramyxovirus in vitro, and improve the disease resistance of pigeon flocks.
[0022] The half-life of the recombinant pigeon interferon piINF-5 is 8.16 hours, having certain prevention and treatment characteristics.
[0023] Animal in-vivo challenge experiments show that the recombinant pigeon interferon piINF-5 can well protect pigeons from the attack of pigeon paramyxovirus, with a survival rate reaching 80%, and no virus excretion in the first five days after challenge, and only 20% of the animals have virus excretion in the later stage. Description of the Drawings
[0024] Figure 1 It is the SDS-PAGE diagram of purified recombinant pigeon interferon piINF-2.
[0025] Figure 2 It is the SDS-PAGE diagram of purified recombinant pigeon interferon piINF-3.
[0026] Figure 3 It is the SDS-PAGE diagram of purified recombinant pigeon interferon piINF-5.
[0027] Figure 4 It is the cytotoxicity determination of purified recombinant pigeon interferon piINF-5.
[0028] Figure 5Transcription levels of ISG15, Mx, IFIT5, and IFITM10 genes in Vero cells after inoculation with recombinant pigeon interferon piINF-5.
[0029] Figure 6 Copy number changes of pigeon paramyxovirus after inoculation of DF1 cells with recombinant pigeon interferon piINF-5.
[0030] Figure 7 Hemagglutination titer changes of pigeon paramyxovirus after inoculation of DF1 cells with recombinant pigeon interferon piINF-5.
[0031] Figure 8 Plasma concentration-time curve of recombinant pigeon interferon piINF-5 in pigeons.
[0032] Figure 9 Statistical chart of the survival of pigeons in each group after treatment with recombinant pigeon interferon piINF-5.
[0033] Figure 10 Schematic diagram of the mRNA expression of ISGs in the immune organs of pigeons in the blank group, virus challenge group, and high-dose treatment group after treatment with recombinant pigeon interferon piINF-5. Detailed implementation methods
[0034] The following will combine the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. The following specific implementation cases are intended to illustrate the content of the present invention, but do not limit the scope of the present invention. Without departing from the spirit and essence of the present invention, any modification or replacement of the methods, steps, or conditions of the present invention shall be regarded as a part of the present invention.
[0035] Unless otherwise specifically stated, the technical means adopted in the embodiments are conventional techniques well-known to those skilled in the art.
[0036] Example 1:
[0037] Screening and preparation of recombinant pigeon α-interferon
[0038] In order to enable the recombinant protein of pigeon α-interferon prepared to be efficiently and correctly expressed in eukaryotic cells, the applicant decomposed, combined, and simultaneously optimized the codons of pigeon α-interferon and the Fc fragment of pigeon IgG, and finally screened out the optimal combination. The specific steps are as follows:
[0039] Obtain the Fc fragment of pigeon IgG binding protein (the protein sequence is shown in SEQ ID NO.3, and the gene encoding it is shown in SEQ ID NO.4) in GenBank (accession number: PKK16796.1), and optimize and decompose the Fc fragment.
[0040] The pigeon interferon-alpha gene was obtained from GenBank (accession number: MG833835.1). The protein sequence is shown as SEQ ID NO.1, and the gene encoding it is shown as SEQ ID NO.2. According to the results of predicting the signal peptide region on the Uniprot website, the pigeon interferon-alpha was truncated and optimized in different ways, and an Fc fragment was added to the C-terminus or N-terminus. Finally, a Kozak sequence (5'-GCCACCAUGG-3') was added to the N-terminus of the obtained fusion protein.
[0041] The applicant takes the following six screening schemes as examples for illustration. The combinations tried in the experimental exploration stage of the present invention are not limited to the following six:
[0042] Scheme 1: The C-terminus of artificially optimized pigeon interferon-alpha1 is linked to the pigeon Fc1 fragment to form a recombinant protein piINF-1. The amino acid sequence is shown as SEQ ID NO.5, and the nucleotide sequence is shown as SEQ ID NO.6.
[0043] Scheme 2: The C-terminus of artificially optimized pigeon interferon-alpha1 is linked to the pigeon Fc2 fragment to form a recombinant protein piINF-2. The amino acid sequence is shown as SEQ ID NO.7, and the nucleotide sequence is shown as SEQ ID NO.8.
[0044] Scheme 3: The C-terminus of artificially optimized pigeon interferon-alpha1 is linked to the pigeon Fc3 fragment to form a recombinant protein piINF-3. The amino acid sequence is shown as SEQ ID NO.9, and the nucleotide sequence is shown as SEQ ID NO.10.
[0045] Scheme 4: The N-terminus of artificially optimized pigeon interferon-alpha1 is linked to the pigeon Fc1 fragment to form a recombinant protein piINF-4. The amino acid sequence is shown as SEQ ID NO.11, and the nucleotide sequence is shown as SEQ ID NO.12.
[0046] Scheme 5: The C-terminus of artificially optimized pigeon interferon-alpha2 is linked to the pigeon Fc1 fragment to form a recombinant protein piINF-5. The amino acid sequence is shown as SEQ ID NO.13, and the nucleotide sequence is shown as SEQ ID NO.14.
[0047] Scheme 6: The N-terminus of artificially optimized pigeon interferon-alpha2 is linked to the pigeon Fc1 fragment to form a recombinant protein piINF-6. The amino acid sequence is shown as SEQ ID NO.15, and the nucleotide sequence is shown as SEQ ID NO.16.
[0048] Example 2:
[0049] Electroporation and identification of CHO cells
[0050] The 6 polynucleotides to be expressed obtained in Example 1 were cloned into the eukaryotic expression vector PXC17.4 to obtain recombinant plasmids. The above recombinant plasmids were prepared by Wuhan Aoke Botai Biotechnology Co., Ltd.
[0051] Under sterile conditions, electroporation was performed using an Xcell gene pulser (Bio-Rad). Turn on the electroporator, select the electroporation cuvette mode, and set the experimental parameters. The electroporation parameters were as follows: the number of electroporations: 6 times, voltage: 200 V, interval: 1000 ms, pulse width: 1000 μs. Count the wild-type CHO cells, centrifuge to discard the culture medium, resuspend the CHO cells with PBS and count again. Distribute the cells into 1.5 mL EP tubes, with the number of cells in each tube being more than 1×10 7 to the power of. After centrifugation, discard the PBS. The electroporation cuvette can hold 200 μL. Add 150 μL of electroporation solution and 20 ng of plasmid by volume to each EP tube. After mixing, add it to the electroporation cuvette. Place the electroporation cuvette into the electroporator, start the program. After completion, transfer the cells in the electroporation cuvette into a shake flask, add 30 mL of basal culture medium, and culture in a shaker at 36 - 37 °C and 5% CO2 (shaking speed 135 rpm) for 24 h. Subsequently, centrifuge at low speed to collect the cells and replace them with glutamine-free basal culture medium containing 50 μM MSX. The cells were cultured in suspension, and samples were taken around 48 h for WB detection of whether the protein was secreted and expressed.
[0052] Among them, the recombinant proteins piINF-4 and piINF-6 were not expressed, the expression of the recombinant protein piINF-1 was low and degraded severely, and the recombinant proteins piINF-2, piINF-3, and piINF-5 could be secreted and expressed with relatively high expression levels. Therefore, three schemes of piINF-2, piINF-3, and piINF-5 were selected for the preparation of recombinant pigeon interferon and the subsequent determination of antiviral titer.
[0053] Example 3:
[0054] Preparation of recombinant pigeon α-interferon
[0055] The cells that were successfully secreted and expressed in Example 2 were cultured by gradually changing the medium until the cell viability recovered, and the volume was expanded for culture according to experimental needs until the cell density reached 4×10 6 or more. According to the total volume of cell culture, 2% of solution A and 0.2% of solution B were supplemented for fed-batch culture, and the cells were harvested when the cell viability dropped to about 80%. Cell debris was removed by centrifugation to obtain the supernatant containing recombinant pigeon interferon. Affinity chromatography was used for protein purification, and elution was performed using a suitable buffer (0.02 mol / L PB, 300 mmol / L imidazole, pH 7.4). After purification, the molecular weight and purity of the recombinant protein were verified by SDS-PAGE. The SDS-PAGE identification results were as Figure 1Shown as follows: The relative molecular mass of the obtained recombinant protein piINF-2 is 57 kDa; the results are as Figure 2 Shown as follows: The relative molecular mass of the recombinant protein piINF-3 is 52 kDa; the results are as Figure 3 Shown as follows: The relative molecular mass of the recombinant protein piINF-5 is 70 kDa, which is consistent with the expected value. The purified recombinant pigeon interferon was concentrated and stored by lyophilization.
[0056] After conversion, the yield of the recombinant protein piINF-2 is 0.5 g per liter of cell culture fluid, the yield of the recombinant protein piINF-3 is 0.53 g per liter of cell culture fluid, and the yield of the recombinant protein piINF-5 is 0.6 g per liter of cell culture fluid.
[0057] Example 4:
[0058] Potency and cytotoxicity detection of recombinant pigeon α-interferon
[0059] For the potency determination of recombinant pigeon interferon α, Vero cells were inoculated into 96-well plates and cultured overnight until 80% confluent; different concentrations (2.5 μg / ml to 100 μg / ml) of recombinant pigeon interferon α diluted in a series were added, 100 μl per well; after incubation for 24 hours, 100 TCID 50 of vesicular stomatitis virus (VSV-GFP virus), 100 μl per well, and the culture was continued for 24 hours. GFP-positive cells were observed through a fluorescence inverted microscope (cells with fluorescence number greater than 50% were considered diseased cells). The inhibition microassay based on CPE (cytopathic effect) was used. The reciprocal of the dilution at which the highest dilution of the interferon sample per ml could still protect half of the cells (50) from virus attack was defined as the interferon unit. Calculate the percentage of normal cells at different interferon dilutions, calculate the distance ratio = (percentage higher than 50% - 50) / (percentage higher than 50% - percentage lower than 50%), obtain the international unit of interferon (expressed in IU / mL), and then divide by the concentration of recombinant pigeon interferon α to obtain the potency of each recombinant protein.
[0060] The results showed that the potency of the recombinant protein piINF-2 was 9×10 5 IU / mg, the potency of the recombinant protein piINF-3 was 1.3×10 6 IU / mg, and the potency of the recombinant protein piINF-5 was 3.5×10 6 IU / mg. Among them, the potency of the recombinant protein piINF-5 was the highest, and the recombinant protein piINF-5 would be used for antiviral activity applications subsequently.
[0061] Vero and DF-1 cells were inoculated into 96-well plates, and the cell number was 1×10 4Cells were seeded and cultured overnight until 80% confluence. Different concentrations (2.5 μg / ml - 100 μg / ml) of the recombinant pigeon interferon piINF-5 to be tested were added in a serial dilution to each well, with 5 replicate wells set for each concentration. After 24 hours and 48 hours of treatment, 10 μL of CCK-8 reagent was added to each well and incubation continued for 1 - 4 hours. The OD value was read at a wavelength of 450 nm using an enzyme-linked immunosorbent assay (ELISA) reader, and the cell viability was calculated. Cell viability = (OD value of treatment group - OD value of blank group) / (OD value of control group - OD value of blank group) × 100%.
[0062] The cytotoxic effects of recombinant pigeon interferon piINF-5 on DF1 cells and Vero cells are as Figure 4 shown. The results indicate that recombinant pigeon interferon within the concentration range of 2.5 μg / ml - 100 μg / ml has no obvious cytotoxicity to Vero and DF1 cells.
[0063] Example 5:
[0064] Activation of downstream signaling molecules by recombinant pigeon α-interferon piINF-5
[0065] Vero cells were seeded in 24-well plates and cultured overnight until 80% confluence. 0.5 mL of medium (2% DMEM medium) was added to each well, and recombinant pigeon interferon piINF-5 was added to make the concentration 1000 IU / well. Blank control cells were set, and incubation was carried out for 0 h, 6 h, 12 h, 24 h, 36 h, and 48 h respectively. Total RNA was extracted from the collected cell lysates using trizol reagent (purchased from Beijing Tiangen Biochemical Technology Co., Ltd.), and cDNA was synthesized using a reverse transcription kit (purchased from Nanjing Novoprotein Biotechnology Co., Ltd.). Four interferon-stimulated genes (ISG15, MX, IFIT5, IFITM10) were selected, and qPCR reactions were carried out using the designed primers (as shown in Table 1). The SYBR Green fluorescence probe method was adopted, with 3 replicate wells set for each sample. The relative gene expression levels were calculated by the 2 -ΔΔCT method, and GAPDH was used as an internal reference gene for normalization.
[0066] The results are as Figure 5 shown. In the recombinant pigeon interferon treatment group, the expression peaks of ISG15 and MX occurred at 6 hours after cell treatment, while those of IFIT5 and IFITM10 occurred at 24 hours. Recombinant pigeon interferon can effectively activate the expression of these antiviral-related genes, initiate the antiviral immune response, and there are differences in the activation times of different genes, reflecting their different response mechanisms.
[0067] Table 1 Primers for real-time fluorescence quantitative PCR
[0068]
[0069] Example 6:
[0070] Effect of recombinant pigeon α-interferon piINF-5 against pigeon paramyxovirus
[0071] In the in vitro experiment of recombinant pigeon interferon against pigeon paramyxovirus, DF1 cells were inoculated into 6-well plates and cultured overnight until 80% confluence. Then, recombinant pigeon interferon piINF-5 was added to make the titer of each well show a concentration gradient. After incubation for 0 h, 3 h, 6 h, 12 h, 24 h, and 36 h, 20 μL of pigeon paramyxovirus (the virus was self-isolated and the virus titer was 10 7 TCID 50 / 0.1 mL) was inoculated, and the cells were continuously cultured until 80% cytopathic effect appeared. The cells were collected, frozen and thawed twice in an -80 °C refrigerator, and the viral RNA was extracted using an RNA extraction kit (purchased from Beijing Tiangen Biochemical Technology Co., Ltd.), reverse transcribed into cDNA, and the viral copy number was detected by real-time quantitative PCR (qPCR) to evaluate the inhibitory effect of recombinant pigeon α-interferon piINF-5 on virus replication. (Primers and probes used in qPCR: PPMV-F: ATGTACTCAAAGACTGAAGGCG; PPMV-R: TTCTCCATAATTTTGCGATATGATACC; PPMV-P: 5'-FAM-ACGCCATACATGGCCCT CAAAGGCTCAGT-BHQ1-3').
[0072] The results are as Figure 6 shown that when the cells were incubated with recombinant pigeon α-interferon piINF-5 at a concentration of 10000 IU / well for 6 h, the copy number of pigeon paramyxovirus was significantly reduced, showing an obvious antiviral effect.
[0073] Hemagglutination experiment:
[0074] The cell virus liquid in each well of the above experiment was added to a hemagglutination plate, and then the samples in different columns were serially diluted to obtain a series of test samples with different concentrations; 5% red blood cell suspension was added to the test wells and mixed evenly; then the reaction was allowed to stand at room temperature for 15 min; the hemagglutination titer was observed (the highest dilution of the antigen when the red blood cells were completely agglutinated, which was used as the hemagglutination titer of the antigen).
[0075] The results are as Figure 7 shown, further indicating that recombinant pigeon α-interferon piINF-5 significantly reduced the hemagglutination titer of pigeon paramyxovirus, further verifying its significant antiviral effect. These results indicate that recombinant pigeon α-interferon piINF-5 has significant antiviral activity against pigeon paramyxovirus.
[0076] Example 7:
[0077] Determination of the Half-life of Recombinant Pigeon α-Interferon piINF-5
[0078] Recombinant pigeon α-interferon piINF-5 was injected into pigeons by intramuscular injection in the leg at a dose of 50,000 IU / kg. Blood samples of pigeons were collected at different time points (0 h, 1 h, 2 h, 4 h, 6 h, 8 h, 12 h, 24 h, 48 h), and the interferon titer in the serum was determined by the cytopathic effect inhibition method to indirectly estimate the concentration of interferon in the serum. According to the interferon concentration data at different time points, a blood drug concentration-time curve was plotted as Figure 8 shown, and the data were fitted using a first-order kinetic model (C = C0*e^(-kt)) to calculate the half-life of recombinant pigeon α-interferon piINF-5 in vivo. By this method, the half-life of recombinant pigeon α-interferon piINF-5 was found to be 8.16 hours, reflecting its metabolism and clearance rate in pigeons. Example 8:
[0079] Application of Recombinant Pigeon α-Interferon piINF-5 in the Preparation of Drugs against Pigeon Paramyxovirus Infection
[0080] Twenty healthy experimental pigeons were randomly divided into 4 groups. The pigeon paramyxovirus solution was diluted to 1×10 9 TCID 50 / 0.1 mL, and the freeze-dried recombinant pigeon α-interferon piINF-5 prepared in Example 3 (hereinafter simply referred to as recombinant pigeon interferon) was diluted to 10 5 IU / mL and 10 6 IU / mL. The specific grouping is shown in Table 2. Among them, group A is the high-dose treatment group of recombinant pigeon interferon, group B is the low-dose treatment group of recombinant pigeon interferon, group C is the pigeon paramyxovirus control group, and group D is the blank control group. After the experimental groups were challenged on the first day, interferon was intramuscularly injected once a day for 7 consecutive days. The challenge and injection doses are shown in Table 2.
[0081] Table 2 Grouping of Interferon Treatment Experiment
[0082]
[0083] Clinical Symptom Monitoring
[0084] Clean water and feed were provided every day. The death, diet, body temperature change, feces, and neurological status (typical clinical symptoms of pigeon paramyxovirus such as lame and paralyzed) of the pigeons in the experimental groups were observed daily and recorded. A scoring system was used (recorded as 0 points for normal, 1 point for listless and neck-retracted, 2 points for wing-drop, torticollis, and ataxia, 3 points for complete paralysis and prostration, and 4 points for death). The higher the score, the more severe the disease.
[0085] The statistical results of the survival of pigeons in each group after treatment are asFigure 9 As shown in the figure, Group A was the high-dose interferon treatment group with a mortality rate of 20%. Group B was the low-dose interferon treatment group with a mortality rate of 40%. Group C was the challenge control group with a mortality rate of 100%. Group D was the blank control group with a mortality rate of 0%.
[0086] The statistical results of the clinical symptom scores of pigeons in each group after treatment are shown in Table 3. Group A (high-dose treatment group): On the 1st - 3rd day: Some pigeons showed transient mental depression without severe neurological symptoms. On the 4th - 7th day: The symptoms gradually relieved, and only individual pigeons occasionally showed neck retraction. On the 8th - 10th day: 80% of the pigeons recovered, and one pigeon developed ataxia on the 8th day and rapidly deteriorated to death; Group B (low-dose treatment group): On the 1st - 4th day: Generally showed mental depression and neck retraction, and 20% of the pigeons had drooping wings. On the 5th - 7th day: The symptoms worsened, 40% of the pigeons had torticollis or ataxia, and 3 pigeons were completely paralyzed. On the 7th - 9th day: 2 pigeons died; Group C (challenge control group): On the 3rd - 5th day: 80% of the pigeons had ataxia or drooping wings. On the 6th - 8th day: All pigeons entered a state of collapse and died before the 10th day. Group D (blank control group): There were no abnormal manifestations throughout the process, and all pigeons had a score of 0.
[0087] Table 3 Clinical scoring of the treatment trial
[0088]
[0089]
[0090] Monitoring of virus excretion
[0091] The anal swabs of the experimental pigeons were collected regularly every day, centrifuged at 12,000 r / min for 10 minutes, and the supernatant was taken for RNA extraction and reverse transcription. The virus copy number was detected by real-time quantitative PCR (qPCR). The primers are shown in Example 6.
[0092] The results of virus excretion in each group are shown in Table 4. The high-dose treatment group did not excrete virus in the first 5 days. Only one pigeon in the low-dose treatment group continuously excreted virus. All pigeons in the challenge control group continuously excreted virus.
[0093] Table 4 Virus excretion in the treatment trial
[0094]
[0095] Detection of mRNA expression of ISGs in immune organs
[0096] After necropsy, the immune organ spleen of each group was collected. RNA in the tissue was extracted using the Trizol method and reverse transcribed. According to the fluorescence quantitative detection method, Graphpad Prism 8.0 software was used for graphing.
[0097] The mRNA expression levels of ISGs in spleen tissues of the blank group, virus-challenged group, and high-dose treatment group (hereinafter referred to as the treatment group) were detected using qPCR method, and the results are as follows Figure 10 shown. The expression of ISGs in pigeons in the high-dose interferon treatment group was significantly induced, and the expression of ISGs in pigeons in the virus-challenged group also increased. For the ISG15 gene, the treatment group was upregulated by about 2 times compared with the virus-challenged group and about 18 times compared with the blank group; for the MX gene: the treatment group was upregulated by about 3 times compared with the virus-challenged group and about 35 times compared with the blank group; for the IFIT5 gene: the treatment group was upregulated by about 5 times compared with the virus-challenged group and about 22 times compared with the blank group; for the IFITM10 gene: the treatment group was upregulated by about 5 times compared with the virus-challenged group and about 42 times compared with the blank group.
[0098] The present invention provides recombinant pigeon α-interferon piINF-5 and verifies its application in anti-pigeon paramyxovirus. Through the CHO cell expression system, we have successfully overcome the problems of low efficiency and instability of traditional monomeric interferons, providing a new drug option for the treatment of pigeon paramyxovirus disease. Recombinant pigeon α-interferon piINF-5 not only has high antiviral efficacy but also has good pharmacological properties, showing important potential for clinical application.
Claims
1. A synthetic recombinant protein, the amino acid sequence of which is shown as SEQ ID NO.
13.
2. The coding gene of the recombinant protein according to claim 1.
3. The coding gene according to claim 2, wherein the gene is shown as SEQ ID NO.
14.
4. An expression cassette, recombinant vector, recombinant microorganism or isolated recombinant cell having the coding gene according to claim 2.
5. The recombinant cell according to claim 4, wherein The recombinant cell is an isolated recombinant CHO cell.
6. Use of the recombinant protein according to claim 1, the coding gene according to claim 2, or the expression cassette, recombinant vector, recombinant microorganism or isolated recombinant cell having the coding gene according to claim 2 in the preparation of recombinant pigeon interferon.
7. Use of the recombinant protein according to claim 1, the coding gene according to claim 2, or the expression cassette, recombinant vector, recombinant microorganism or isolated recombinant cell having the coding gene according to claim 2 in the preparation of a medicament for treating or preventing pigeon virus infection.
8. The application according to claim 6 or 7, characterized in that, The pigeon virus is: pigeon paramyxovirus or vesicular stomatitis virus.
Citation Information
Patent Citations
Animal fusion recombinant interferon
CN103214579A
Porcine fusion interferon
CN104292337A
Recombinant pigeon interferon alpha as well as expression engineering strain and preparation method thereof
CN116143900A
Application of pigeon lambda interferon in preparation of medicine for resisting pigeon pox virus
CN118767113A
Novel avian cytokines and genetic sequences encoding same
WO1996027666A1