Supermolecular lipid nanoparticles capable of promoting endosome escape as well as preparation method and application of supermolecular lipid nanoparticles

Abstract

The invention discloses supramolecular lipid nanoparticles capable of promoting endosome escape as well as a preparation method and application of the supramolecular lipid nanoparticles. Raw materials of the supramolecular lipid nanoparticles (CNPs) comprise the following two components: polyethylene glycol lipid and supramolecular ionizable lipid as shown in a formula (I). The nucleic acid drug delivery system which has endosome escape ability and further improves inhalation and delivery efficiency is prepared by optimizing the components and formula proportion of the CNPs, and the system has sufficient stability, safety and relatively high loading efficiency, and can remarkably improve the endosome escape ability of cells and prolong the residence time of the lung. # imgabs0 #

Description

Technical Field

[0001] The present invention belongs to the fields of biomedicine, nanotechnology, supramolecular assembly and nucleic acid delivery, and particularly relates to a supramolecular lipid nanoparticle capable of promoting endosomal escape, a preparation method thereof, and an application thereof in nucleic acid delivery. Background Art

[0002] In recent years, nucleic acid drugs (including mRNA, siRNA, etc.) have shown great potential in the field of gene therapy, especially in the treatment of lung diseases. However, the clinical application of nucleic acid molecules has long been limited by problems such as low in vivo delivery efficiency, easy degradation, and difficulty in penetrating complex biological barriers. Lipid nanoparticles (LNPs), as the mainstream delivery carrier, although their safety and feasibility have been verified in COVID-19 mRNA vaccines, their core bottlenecks - insufficient endosomal escape efficiency and limited in vivo stability - still severely restrict their application in inhalation therapy. Even LNPs containing DLin-MC3-DMA as the ionizable lipid approved by the US Food and Drug Administration (FDA) can only achieve 1-4% of the loaded RNA released into the cytoplasm, and most LNPs are trapped in endosomes / lysosomes; in addition, traditional LNPs have poor stability during the in vivo circulation process, greatly reducing the bioavailability of RNA therapy and posing risks to normal tissues, limiting their wider clinical application.

[0003] To solve the above problems, it is necessary to develop a new delivery system that can achieve efficient endosomal escape and ensure excellent in vivo stability during the delivery process. Summary of the Invention

[0004] To solve the deficiencies existing in the existing LNP delivery technology and improve the endosomal escape effect of LNPs. The primary object of the present invention is to provide a formulation of a supramolecular lipid nanoparticle with excellent stability and capable of significantly improving the intracellular endosomal escape ability, and an application thereof.

[0005] Existing studies have shown that ionizable lipids with a conical topology can promote the formation of an unstable hexagonal phase in the endosomal membrane, leading to the rupture of the endosomal membrane for rapid and complete endosomal escape. After screening thousands of natural and artificial chemicals, we considered that cyclodextrin (CD) became the best candidate molecule among the topological molecules for manufacturing new ionizable lipids due to its inherent conical structure and multiple hydroxyl groups, which allows for asymmetric modification to introduce multiple ionizable groups and hydrophobic alkyl chains. In addition, the cavity of CD provides a stable hydrophobic environment that can encapsulate poorly soluble drugs through host-guest interactions, thus creating favorable conditions for synergistic therapy. Therefore, the development of cyclodextrin-based ionizable lipids for the preparation of cyclodextrin lipid nanoparticles (CNPs) has the potential to combine high endosomal escape ability with excellent biological stability and achieve excellent pulmonary delivery.

[0006] The present invention prepares a nucleic acid drug delivery system with endosomal escape ability and thus improved inhalation delivery efficiency by optimizing the components and formulation ratios of CNPs. This system has sufficient stability, safety and high loading efficiency, and can significantly improve the intracellular endosomal escape ability and pulmonary retention time.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] In a first aspect, the present invention provides a supramolecular ionizable lipid represented by formula (I):

[0009]

[0010] Wherein, n represents the number of repeating units of D-glucose or its derivatives, n is 1, 2 or 3, that is, formula (I) is an α-cyclodextrin derivative, a β-cyclodextrin derivative or a γ-cyclodextrin derivative, and n is preferably 2.

[0011] R 1 independently selected from amines including the following structures, R 1 connected to the structure containing secondary amine or tertiary amine through oxygen or nitrogen or sulfur:

[0012]

[0013] R 1 is preferably any of the following groups:

[0014]

[0015] R 1 is further preferably any of the following groups:

[0016]

[0017] L 1Independently selected from any of the following groups: an oxygen atom, -OC(=O)-, -OC(=O)O-, -OC(=O)C(=O)O-, OC(=O)R 2 C(=O)O-, etc., preferably an oxygen atom, -OC(=O)-, -OC(=O)O-, more preferably -OC(=O)-;

[0018] R 2 Independently selected from any of the following groups: H, substituted or unsubstituted C 1-30 alkyl, substituted or unsubstituted C 2-30 alkenyl or substituted or unsubstituted C 2-30 alkynyl; the alkyl, alkenyl or alkynyl is optionally substituted by one or more OH, NH2, halogen, -OC 1-10 alkyl, -SC 1-10 alkyl, C 3-8 cycloalkyl, 5-8 membered heterocyclic group, C 6-10 aryl or 5-10 membered heteroaryl; preferably C 10-20 alkyl or C 10-20 alkenyl; more preferably C 10-15 alkyl, still more preferably C 13 alkyl.

[0019] According to an embodiment of the present invention, the supramolecular ionizable lipid represented by the formula (I) may specifically be a lipid molecule represented by the formula (1), formula (2), formula (3), formula (4), or formula (5);

[0020]

[0021] In a second aspect, the present invention provides a supramolecular lipid nanoparticle (CNP) that promotes endosomal escape and can efficiently deliver nucleic acids.

[0022] The supramolecular lipid nanoparticle (CNP) provided by the present invention comprises the following two components as raw materials: a polyethylene glycol lipid and the supramolecular ionizable lipid described in the first aspect.

[0023] Furthermore, the raw materials may further include: a neutral lipid; that is, the raw materials include the following three components: a neutral lipid, a polyethylene glycol lipid, and the supramolecular ionizable lipid described in the first aspect.

[0024] Even further, the raw materials may further include: a sterol lipid; that is, the raw materials include the following four components: a neutral lipid, a sterol lipid, a polyethylene glycol lipid, and the supramolecular ionizable lipid described in the first aspect.

[0025] Among the above-mentioned CNPs, the polyethylene glycol lipids include, but are not limited to, at least one of the following: 2-[(polyethylene glycol)-2000]-N,N-tetracosanoylacetamide (ALC-0159), 1,2-dimyristoyl-sn-glycero-methoxypolyethylene glycol (PEG-DMG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)] (PEG-DSPE), PEG-distearylglycerol (PEG-DSG), PEG-dipalmitoyl, PEG-dioleoyl, PEG-distearyl, PEG-diacylglyceramide (PEG-DAG), PEG-dipalmitoylphosphatidylethanolamine (PEG-DPPE), or PEG-1,2-dimyristyloxypropyl-3-amine (PEG-c-DMA).

[0026] Among the above-mentioned CNPs, the neutral lipids include, but are not limited to, at least one of the following: 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE), 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE), 2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DOPG), oleoyl phosphatidylcholine (POPC), 1-palmitoyl-2-oleoyl phosphatidylethanolamine (POPE).

[0027] Among the above-mentioned CNPs, the sterol lipids include, but are not limited to, at least one of the following: avenasterol, β-sitosterol, brassicasterol, ergocalciferol, campesterol, cholestanol, cholesterol, coprostanol, dehydrocholesterol, desmosterol, dihydroergocalciferol, dihydrocholesterol, dihydroergosterol, chondrillasterol, epicholesterol, ergosterol, fucosterol, hexahydroprovitamin D3, hydroxycholesterol, lanosterol, provitamin D3, saringosterol, sitostanol, sitosterol, stigmasterol, stigmasterol, cholanic acid, glycocholic acid, taurocholic acid, deoxycholic acid, and lithocholic acid.

[0028] Further, the supramolecular lipid nanoparticles for promoting endosomal escape and highly efficient nucleic acid delivery include, by mass percentage, 30%-99% of the supramolecular ionizable lipid described in the first aspect, 1%-70% of the polyethylene glycol lipid, 0%-30% of the neutral lipid molecules, and 0%-60% of the sterol lipid.

[0029] Furthermore, the endosome escape-promoting supramolecular lipid nanoparticles capable of efficiently delivering nucleic acids, in terms of mass percentage of raw materials, comprise: 60%-95% of the supramolecular ionizable lipid described in the first aspect, 5%-40% of polyethylene glycol lipid, 0%-20% of neutral lipid molecules, and 0%-20% of steroidal lipids.

[0030] In a third aspect, the present invention provides an endosome escape-promoting supramolecular lipid nanoparticle encapsulating a nucleic acid molecule.

[0031] The endosome escape-promoting supramolecular lipid nanoparticle encapsulating a nucleic acid molecule comprises the endosome escape-promoting, nucleic acid-efficiently delivering supramolecular lipid nanoparticle described in the second aspect of the present invention and a nucleic acid molecule.

[0032] The endosome escape-promoting supramolecular lipid nanoparticles encapsulating nucleic acid molecules of the present invention can introduce various exogenous nucleic acid molecules into cells, including DNA nucleic acid molecules and RNA nucleic acid molecules. DNA nucleic acid molecules such as plasmids, single-stranded DNA molecules or double-stranded DNA molecules. RNA nucleic acid molecules include protein-coding linear RNAs, circular RNAs, self-replicating RNAs and various non-coding RNAs such as microRNAs, siRNAs, piRNAs, snoRNAs, snRNAs, exRNAs, scaRNAs and long non-coding RNAs. The RNA molecules can carry various base modifications and cap structures, including but not limited to: methylation modifications such as N6-methyladenosine (m6A), n1-methyladenosine (m1A), 5-methylcytidine (m5C), 3-methylcytidine (m3C), n7-methylguanosine (m7G) and 1-methylguanosine (m1G), 2'-O-methylguanosine, N6,2'-O-dimethylguanosine (m6Am), methoxyethoxy modifications such as 2-methoxyethoxyadenosine, 2-methoxyethoxycytidine, 2-methoxyethoxyguanosine, 2-methoxyethoxyuridine, fluorination modifications, pseudouridine modification (Ψ) and methylpseudouridine modification (M1-Ψ) as well as cap0, cap1, cap2 cap structures.

[0033] In some embodiments, the nucleic acid is Firefly Luciferase mRNA, Cy5 dye-labeled siRNA or siRNA targeting heat shock protein 47 (Hsp47) (siHsp47). The nucleotide sequence of the siHsp47 is: GCAGCAAGCAACACUACAAUU (ID12406) (SEQ ID No. 1). This sequence is the sense strand in the 5'-3' direction.

[0034] In some embodiments, the mass ratio of the lipid molecules to the nucleic acid in the endosome escape-promoting supramolecular lipid nanoparticles encapsulating nucleic acid molecules can be 5:1 - 50:1.

[0035] In some embodiments, the mass ratio of the lipid molecules to the nucleic acid in the endosome escape-promoting lipid nanoparticles encapsulating nucleic acid molecules can be 10:1 - 30:1, specifically such as 20:1, 25:1 or 30:1.

[0036] In some embodiments, the particle size of the endosome escape-promoting lipid nanoparticles encapsulating nucleic acid molecules can be 100 - 300 nm, and the specific particle sizes can be 100 nm, 110 nm, 120 nm, 130 nm, 140 nm, 150 nm, 160 nm, 170 nm, 180 nm, 190 nm, 200 nm, 210 nm, 220 nm, 230 nm, 240 nm, 250 nm, 260 nm, 270 nm, 280 nm, 290 nm, 300 nm, etc.

[0037] In some embodiments, the encapsulation efficiency of the nucleic acid in the endosome escape-promoting lipid nanoparticles encapsulating nucleic acid molecules is greater than 50%. Exemplarily, the encapsulation efficiency can be 55%, 60%, 65%, 70%, 75%, 79%, 80%, 85%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, etc.

[0038] In a fourth aspect, the present invention provides a supramolecular lipid nanoparticle encapsulating a small molecule drug.

[0039] The supramolecular lipid nanoparticle encapsulating a small molecule drug provided by the present invention is used for co-delivering a small molecule drug and a nucleic acid (such as RNA). Without affecting the loading of the nucleic acid (such as RNA), this supramolecular lipid nanoparticle can efficiently load small molecule hydrophobic drugs through host-guest interactions, thereby achieving the combined therapy of drugs and genes and enhancing the therapeutic effect.

[0040] The supramolecular lipid nanoparticle encapsulating a small molecule drug provided by the present invention comprises the endosome escape-promoting, nucleic acid highly deliverable supramolecular lipid nanoparticles (CNPs) described in the second aspect of the present invention or the endosome escape-promoting supramolecular lipid nanoparticles encapsulating nucleic acid molecules described in the third aspect, and a small molecule drug.

[0041] In some embodiments, the small molecule drug is selected from all small molecules that can form host-guest complexes with α, β, γ-cyclodextrins and their derivatives, such as pirfenidone, nintedanib, ciprofloxacin, N-acetylcysteine, salbutamol, formoterol, resiquimod (R848), SMU127, 1-methyl-D-tryptophan (indoximod, 1-MT), 3-(5-fluoro-1H-indol-3-yl)-2,5-pyrrolidinedione (PF-06840003), BMS-986205 (linrodostat), IDO-IN-7 inhibitor (navoximod), oxyresveratrol, hydroxychloroquine, curcumin, tamoxifen, GSK126, GSK3326595, carvedilol (BM 14190), rapamycin, JNJ-64619178 (onametostat), eugenol, chalcone, thymol, melatonin, amantadine, etc.

[0042] In some embodiments, the small molecule drug is preferably selected from all small molecules that can form host-guest complexes with α, β, γ-cyclodextrins and their derivatives, such as pirfenidone, N-acetylcysteine, formoterol, oxyresveratrol, hydroxychloroquine, curcumin, amantadine, etc.

[0043] In some embodiments, the small molecule drug is more preferably selected from all small molecules that can form host-guest complexes with α, β, γ-cyclodextrins and their derivatives, such as pirfenidone, oxyresveratrol, etc.

[0044] In some embodiments, the molar ratio of the small molecule drug to the supramolecular ionizable lipid represented by formula (I) in the supramolecular lipid nanoparticles is (1-10):1, specifically 5:1.

[0045] In some embodiments, the particle size of the supramolecular lipid nanoparticles encapsulating small molecule drugs is 50 - 500 nm.

[0046] In some embodiments, the particle size of the supramolecular lipid nanoparticles encapsulating small molecule drugs is 100 - 300 nm.

[0047] In some embodiments, the particle size can be 100 nm, 110 nm, 120 nm, 130 nm, 140 nm, 150 nm, 160 nm, 170 nm, 180 nm, 190 nm, 200 nm, 210 nm, 220 nm, 230 nm, 240 nm, 250 nm, 260 nm, 270 nm, 280 nm, 290 nm, 300 nm, etc.

[0048] In a fifth aspect, the present invention provides a method for preparing the supramolecular lipid nanoparticles capable of promoting endosomal escape and encapsulating nucleic acid molecules as described in the third aspect of the present invention and the supramolecular lipid nanoparticles capable of promoting endosomal escape and encapsulating nucleic acid molecules and small molecule drugs as described in the fourth aspect of the present invention.

[0049] The method for preparing the supramolecular lipid nanoparticles capable of promoting endosomal escape and encapsulating nucleic acid molecules provided by the present invention includes the following steps:

[0050] Step (A1): Dissolve the supramolecular ionizable lipid molecule, polyethylene glycol lipid, neutral lipid molecule, and steroidal lipid in a solvent to obtain a liposome solution; or dissolve the supramolecular ionizable lipid molecule, polyethylene glycol lipid, neutral lipid molecule, steroidal lipid, and small molecule drug in a solvent to obtain a liposome solution;

[0051] Step (A2): Dissolve the nucleic acid molecule in a buffer solution with an appropriate pH value to obtain a nucleic acid solution;

[0052] Step (A3): Co - extrude the aqueous solution and the organic phase solution using a microfluidic device according to a certain mass ratio and volume ratio of the liposome solution in step (A1) and the nucleic acid solution in step (A2) to prepare CNPs encapsulating nucleic acid or CNPs encapsulating nucleic acid and small molecules.

[0053] The method further includes: ultrafiltration or dialysis of the CNPs encapsulating nucleic acid obtained in step (A3) to obtain CNPs encapsulating nucleic acid that can be used for in - vivo delivery; or ultrafiltration or dialysis of the CNPs encapsulating nucleic acid and small molecules obtained in step (A3) to obtain CNPs encapsulating nucleic acid and small molecules that can be used for in - vivo delivery.

[0054] Preferably, the solvent for dissolving lipid molecules in step (A1) is methanol, ethanol, tetrahydrofuran, acetone, dimethyl sulfoxide, N,N-dimethylformamide.

[0055] More preferably, the solvent for dissolving lipid molecules in step (A1) is ethanol, tetrahydrofuran, acetone.

[0056] Most preferably, the solvent for dissolving lipid molecules in step (A1) is ethanol.

[0057] Preferably, the mass percentage of the supramolecular ionizable lipid molecules in step (A1) is 30% - 99%.

[0058] More preferably, the mass percentage of the supramolecular ionizable lipid molecules in step (A1) is 60% - 95%.

[0059] Most preferably, the mass percentage of the supramolecular ionizable lipid molecules in step (A1) is 90%.

[0060] Preferably, the mass percentage of the polyethylene glycol lipid in step (A1) is 1% - 70%.

[0061] More preferably, the mass percentage of the polyethylene glycol lipid in step (A1) is 5% - 40%.

[0062] Most preferably, the mass percentage of the polyethylene glycol lipid in step (A1) is 10%.

[0063] Preferably, the mass percentage of the neutral lipid molecules in step (A1) is 0% - 30%.

[0064] More preferably, the mass percentage of the neutral lipid molecules in step (A1) is 0% - 20%.

[0065] Most preferably, the mass percentage of the neutral lipid molecules in step (A1) is 0%.

[0066] Preferably, the mass percentage of the steroidal lipid molecules in step (A1) is 0% - 60%.

[0067] More preferably, the mass percentage of the steroidal lipid molecules in step (A1) is 0% - 20%.

[0068] Most preferably, the mass percentage of the steroidal lipid molecules in step (A1) is 0%.

[0069] Preferably, the buffer solution in step (A2) is acetic acid / sodium acetate solution or citric acid / sodium citrate solution.

[0070] Most preferably, the buffer solution in step (A2) is citric acid / sodium citrate solution.

[0071] Preferably, the pH value of the buffer solution in step (A2) is 3-9.

[0072] More preferably, the pH value of the buffer solution in step (A2) is 4-6.

[0073] Most preferably, the pH value of the buffer solution in step (A2) is 5.

[0074] Preferably, the concentration of the buffer solution in step (A2) is 1 mM-1 M.

[0075] More preferably, the concentration of the buffer solution in step (A2) is 20 mM-500 mM.

[0076] Most preferably, the concentration of the buffer solution in step (A2) is 100 mM.

[0077] Preferably, the mass ratio of lipid molecules in the liposome solution to nucleic acid molecules in the nucleic acid solution in step (A3) is 5:1-50:1.

[0078] More preferably, the mass ratio of lipid molecules to nucleic acid molecules in step (A3) is 10:1-30:1.

[0079] Most preferably, the mass ratio of lipid molecules to nucleic acid molecules in step (A3) is 25:1.

[0080] Preferably, the volume ratio of the liposome solution to the nucleic acid solution in step (A3) is 1:1-1:10.

[0081] More preferably, the volume ratio of the liposome solution to the nucleic acid solution in step (A3) is 1:1-1:5.

[0082] Most preferably, the volume ratio of the liposome solution to the nucleic acid solution in step (A3) is 1:3.

[0083] In a sixth aspect, the present invention provides a supramolecular lipid nanoparticle formulation for promoting endosomal escape and encapsulating nucleic acid molecules.

[0084] The formulation provided by the present invention includes the supramolecular lipid nanoparticles for promoting endosomal escape and encapsulating nucleic acid molecules described in the third aspect of the present invention and a pharmaceutically acceptable carrier.

[0085] The pharmaceutically acceptable carrier includes but is not limited to: diluents, adjuvants, excipients, preservatives, fillers, disintegrants, wetting agents, emulsifiers, suspending agents, sweeteners, flavoring agents, fragrances, antibacterial agents, antifungal agents, lubricants, dispersants, temperature-sensitive materials, temperature regulators, adhesives, stabilizers, suspending aids, etc.

[0086] In a seventh aspect, the present invention provides a supramolecular lipid nanoparticle formulation encapsulating nucleic acids and small molecule drugs.

[0087] The preparation provided by the present invention includes the supramolecular lipid nanoparticles encapsulating nucleic acid molecules and small molecule drugs described in the fourth aspect of the present invention and a pharmaceutically acceptable carrier.

[0088] The pharmaceutically acceptable carrier includes but is not limited to: diluents, adjuvants, excipients, preservatives, fillers, disintegrants, wetting agents, emulsifiers, suspending agents, sweeteners, flavoring agents, fragrances, antibacterial agents, antifungal agents, lubricants, dispersants, temperature-sensitive materials, temperature regulators, adhesives, stabilizers, suspending aids, etc.

[0089] In the eighth aspect, the present invention provides the application of the supramolecular lipid nanoparticles encapsulating nucleic acids described in the third aspect above or the supramolecular lipid nanoparticles encapsulating nucleic acids and small molecule drugs described in the fourth aspect, the supramolecular lipid nanoparticle preparation encapsulating nucleic acids and small molecule drugs described in the sixth aspect or the supramolecular lipid nanoparticle preparation encapsulating nucleic acids and small molecule drugs described in the seventh aspect in the preparation of nucleic acid drugs.

[0090] This product can be applied as a delivery carrier for RNA drugs, including but not limited to drugs for pulmonary fibrosis, COVID-19 drugs, lung cancer drugs, asthma drugs, chronic obstructive pulmonary disease drugs, etc.

[0091] Compared with the prior art, the present invention has the following beneficial effects:

[0092] 1. The lipid nanoparticle formulation designed in the present invention has a faster and more complete endosomal escape ability compared with the traditional formulation, and can improve the RNA delivery efficiency;

[0093] 2. The lipid nanoparticle formulation designed in the present invention has better stability compared with the traditional formulation, can stay in the lungs for a long time through inhalation administration to exert its effect, and can significantly reduce the side effects on other organs caused by LNP vaccines / drugs;

[0094] 3. The lipid nanoparticle formulation designed in the present invention can load small molecule drugs more stably through host-guest interaction compared with the traditional formulation, and improve the therapeutic effect;

[0095] 4. The lipid nanoparticle formulation designed in the present invention can significantly improve the curative effect of pulmonary fibrosis in mice compared with the traditional formulation, and this delivery platform can also be extended to other pulmonary disease treatment fields such as infectious disease vaccines and tumors;

[0096] 5. The lipid nanoparticle formulation designed in the present invention has low raw material prices and is suitable for large-scale production. Description of the Drawings

[0097] Figure 1 For Compound 1 11H NMR spectrum (400 MHz, DMSO-d6, room temperature);

[0098] Figure 2 for Compound 2 1 1H NMR spectrum (400 MHz, DMSO-d6, room temperature);

[0099] Figure 3 for Compound 3 1 1H NMR spectrum (400 MHz, DMSO-d6, room temperature);

[0100] Figure 4 for Compound 4 1 1H NMR spectrum (400 MHz, DMSO-d6, room temperature);

[0101] Figure 5 for lipid-1 1 1H NMR spectrum (400 MHz, chloroform-d, room temperature);

[0102] Figure 6 are the particle size distributions, corresponding photos and TEM images of CNPs with different PEG-lipid ratios;

[0103] Figure 7 are the (a) particle size and (b) PDI of CNPs containing different ratios of PEG-lipid on day 0 and day 3;

[0104] Figure 8 are (a) the schematic diagram of the endosome-mimicking membrane rupture test protocol; (b) the real-time changes in the fluorescence intensity ratio of the mimetic endosome within 15 minutes after adding CNPs and LNPs; (c) the fluorescence intensity ratio of the inner membrane mimetic before and 15 minutes after adding CNPs and LNPs;

[0105] Figure 9 are (a) the encapsulation efficiency of PFD in CNPs and LNPs; (b) the release curves of PFD from CNPs@PFD and LNPs@PFD in PBS at pH 5.4;

[0106] Figure 10 are (a) the schematic diagram of the in vivo biodistribution experiment of the drug; (b) the biodistribution in major organs at 4 hours and 12 hours after administration of PFD, LNPs@PFD and CNPs@PFD;

[0107] Figure 11 Flow cytometry results of culturing 3T3 cells with LNPs@Cy5-siRNA or CNPs@Cy5-siRNA;

[0108] Figure 12In vitro fluorescence imaging of major organs in mice 30 hours after intranasal inhalation of CNPs@Cy5-siNC and LNPs@Cy5-siNC. He, heart; Li, liver; Sp, spleen; Lu, lung; Ki, kidney; In, intestine;

[0109] Figure 13 After treatment with PBS, CNPs@siHsp47 or CNPs@siHsp47 / PFD, the crystal violet staining photos of 3T3 cells migrating from the upper chamber to the lower chamber (containing 10 ng mL -1 TGF-β1), scale bar = 100 μm;

[0110] Figure 14 (a) Hydroxyproline content in the lungs of mice after different treatments; (a) Masson staining pictures. Detailed implementation manners

[0111] The present invention will be further described in detail below in conjunction with the specific implementation manners. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0112] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0113] Example 1: Synthesis of supramolecular ionizable lipids

[0114]

[0115] Dissolve triphenylphosphine (28 mmol, 7.3 g) in 30 mL of anhydrous DMF and cool it to 0 °C in an ice bath. Under nitrogen protection, slowly add dropwise a DMF solution (10 mL) of N-bromosuccinimide (28 mmol, 5.0 g) through a constant pressure dropping funnel, and control the dropping rate to maintain the system temperature below 5 °C. Then remove the ice bath and stir the reaction at room temperature for 30 min. Dropwise add the obtained mixed solution into β-CD (2.0 mmol, 2.3 g) dissolved in 30 mL of anhydrous DMF, and heat it to 80 °C for reflux for 18 h. After the reaction is completed, add 5 mL of methanol to quench the reaction and continue stirring for 30 min. After cooling the system to -15 °C, adjust the pH to 9.0 with sodium methoxide solution and crystallize in an ice bath for 1 h. Filter and collect the precipitate, wash it with acetone, and dry it under vacuum for 24 h to obtain a brown solid compound 1 (3.02 g, 96%), 1 1H NMR is as Figure 1 shown.

[0116] Compound 1 (1.0 mmol) and 2-dimethylaminoethylamine (or diethylenetriamine, N-(2-aminoethyl)pyrrolidine, N-(2-aminoethyl)piperidine, 2-(azetidin-1-yl)ethan-1-amine, 70 mmol) were placed in a round-bottom flask, stirred and heated under reflux for 10 h. The reaction mixture was rotary evaporated to remove the solvent, and the residue was ultrasonically washed with acetone and dried in vacuo to obtain light yellow solid compound 2. 1 The 1H NMR was as Figure 2 shown.

[0117] Compound 2 (0.80 mmol) was dissolved in 20 mL of anhydrous ethanol and cooled to 0 °C in an ice bath. Triethanolamine (8.4 mmol) and di-tert-butyl dicarbonate (Boc2O, 14 mmol) were added successively. After removing the ice bath, the mixture was stirred at room temperature for 12 h. The solvent was removed by concentration under reduced pressure, and the residue was washed with anhydrous diethyl ether and dried in vacuo to obtain light yellow solid compound 3. 1 The 1H NMR was as Figure 3 shown.

[0118] Compound 3 (0.34 mmol) was dissolved in 15 mL of anhydrous DMF and cooled to 0 °C in an ice bath. A dichloromethane solution of triethylamine (16 mmol, 2.3 mL) and myristoyl chloride (12 mmol, 3.2 g) was added. After stirring at room temperature for 12 h, the dichloromethane was removed by rotary evaporation, and the residue was poured into 200 mL of ice water for crystallization. The precipitate was collected by filtration, washed successively with cold methanol and cold ethanol, and dried in vacuo to obtain light yellow solid compound 4. 1 The 1H NMR was as Figure 4 shown.

[0119] Compound 4 (0.19 mmol, 0.2 g) was dissolved in a dichloromethane solution (10 mL) containing 15% trifluoroacetic acid and stirred at room temperature for 2 h. The reaction mixture was adjusted to pH neutral with NaHCO3 solution, then separated, and the organic phase was dried over anhydrous sodium sulfate and filtered. The solvent was removed by concentration under reduced pressure to obtain the light yellow lipid end product Lipid.

[0120] According to the different amine selections in step 2), the following lipids were specifically obtained:

[0121]

[0122] For Lipid-1, the 1 1H NMR was as Figure 5 shown.

[0123] Example 2: Formulation screening of supramolecular lipid nanoparticles (CNPs)

[0124] Considering that PEG is a polymer with excellent hydrophilicity, which can form a relatively thick hydration layer, stabilize nanoparticles through steric hindrance, and prolong the circulation time of nanoparticles in vivo. Therefore, we added PEG-lipid to the supramolecular ionizable lipid to prepare binary lipid nanoparticles.

[0125] Dissolve the compound of formula (1) and ALC-0159 in an ethanol solution in a certain proportion and mix them evenly. According to the volume ratio of the organic phase solution to the aqueous phase solution of 1:3, use a microfluidic device to co-extrude the aqueous phase solution and the organic phase solution to obtain a slightly white solution, which is CNPs.

[0126] To improve the stability of lipid nanoparticles and prolong their blood circulation time, we first screened the ratio of the compound of formula (1) to ALC-0159. In this example, we prepared nanoparticles containing different mass fractions (0%, 5%, 10%, 15%) of PEG-lipid, and used dynamic light scattering (DLS) and transmission electron microscopy (TEM) to characterize the particle size distribution and morphology of the obtained CNPs containing PEG-lipid. It was found that the particle size of the nanoparticles containing 5%, 10%, and 15% PEG-lipid was about 100 nm ( Figure 6 ). As Figure 7 shown, after storing at room temperature for 3 days, the DLS results showed that when the mass ratio of PEG-lipid was 10%, the changes in the particle size and PDI of the prepared CNPs were the smallest, indicating that the nanoparticles were the most stable. This formulation was used in subsequent experiments.

[0127] Example 3: Membrane-breaking ability of supramolecular lipid nanoparticles

[0128] To prove the excellent endosomal escape ability of CNPs, we used a fluorescence resonance energy transfer (FRET) experiment to evaluate the membrane-breaking ability of CNPs. By nucleophilic addition and amidation reactions, FITC and rhodamine B (RhoB) were attached to DSPE-PEG-NH2, and we successfully prepared a FRET probe.

[0129] The specific preparation method of the FRET probe is as follows:

[0130] Dissolve RhoB (20 mg) in 1.5 mL of dichloromethane, add 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride (20 mg) and 4-dimethylaminopyridine (0.6 mg), stir at room temperature for 30 minutes, then add DSPE-PEG-NH2 (35 mg), and continue stirring overnight. Wash with water, extract with dichloromethane, then rotary evaporate, wash with ether, and dry to obtain DSPE-PEG-RhoB.

[0131] Dissolve DSPE-PEG-NH2 (23 mg) and FITC (4.5 mg) in 0.6 mL of dichloromethane and stir overnight at room temperature. Precipitate the product with 50 mL of ether, then centrifuge and dry to obtain DSPE-PEG-FITC.

[0132] The specific preparation method of lysosome-mimicking liposomes is as follows: Dissolve DOPC, DOPE, DSPE-PEG-FITC, and DSPE-PEG-RhoB in chloroform at a molar ratio of 50:50:0.5:1, then rotary evaporate to form a thin film. Add PBS (pH 5.6) to make the total lipid concentration 1 mM and sonicate for 30 minutes to obtain endosome-mimicking lysosomes.

[0133] Supramolecular lipid nanoparticles (CNPs): CNPs prepared using the optimal formulation in Example 2.

[0134] LNPs: Using a commercial LNP formulation with a molar ratio of SM102:distearoyl phosphatidylcholine:cholesterol:PEG-lipid (ALC-0159) = 50:10:38.5:1.5, and the preparation method refers to that of CNPs.

[0135] In the lysosome-mimicking liposomes containing FITC and RhoB that we prepared, due to FRET occurring with RhoB, the fluorescence of FITC was quenched. When the nanoparticles fused with the endosome / lysosome mimics, the distance between the two probes increased, resulting in an increase in the FITC signal and a decrease in the RhoB signal ( Figure 8 a). Therefore, we used the ratio of RhoB to FITC intensity as an index of membrane fusion and rupture degree, and the lower the value, the stronger the rupture degree. As Figure 8 shown in b, compared with LNPs, CNPs induced faster and higher degrees of membrane fusion and rupture. The change in the real-time signal ratio within 15 minutes showed that after adding CNPs and LNPs, the intensity ratios of the endosome mimics decreased to 0.34 and 0.36 respectively ( Figure 8 c). The above proves that compared with LNPs, CNPs have excellent membrane disruption ability in RNA delivery and can mediate faster and more complete endosomal escape.

[0136] Example 4: Loading and in vitro release behavior of small molecule drugs by supramolecular lipid nanoparticles

[0137] Dissolve Lipid-1 and ALC-0159 in ethanol according to the optimal mass ratio screened in Example 2. At the same time, add pifithrin-α (PFD) to the above ethanol solution at a molar equivalent of 5 times that of Lipid-1 and mix well. According to the volume ratio of the organic phase solution to the aqueous phase solution of 1:3, quickly mix the two to obtain a slightly white solution of CNPs@PFD. Subsequently, dialyze with an appropriate volume of PBS solution for 4 h and collect the filtrate. The control group was a commercial LNP formulation (molar ratio SM102: distearoyl phosphatidylcholine: cholesterol: PEG-lipid (ALC-0159) = 50:10:38.5:1.5), and the addition amount of PFD was the same as that of CNPs@PFD. Subsequently, the encapsulation and release behaviors of PFD of the two prepared lipid nanoparticles were measured by dialysis. The results showed that the encapsulation rate of PFD in CNPs@PFD was significantly higher than that in LNP@PFD, and the release curve of PFD showed that CNPs@PFD had an obvious sustained-release advantage, showing obvious technical superiority compared with LNP@PFD( Figure 9 a, b).

[0138] Example 5: In vivo release behavior of CNPs@PFD

[0139] To verify the unique advantage of CNPs in delivering and retaining PFD in the lungs through host-guest interactions, we evaluated the in vivo distribution of PFD in different nanoparticle formulations. Given the advantages of intranasal administration in pulmonary drug delivery, including rapid absorption and avoidance of hepatic first-pass metabolism, we intranasally injected free PFD, LNPs@PFD (same as Example 4), or CNPs@PFD (same as Example 4) into mice, and the injection amount of PFD was 15 μg / mouse. The main organs of the mice were harvested 4 h and 12 h after administration( Figure 10 a). At 4 h after administration, the relative content of PFD in the lungs of the CNPs@PFD group mice (94.7 ± 0.83%) was significantly higher than that in the free PFD group (53.7 ± 2.21%) and the LNP@PFD group (86.5 ± 2.44%)( Figure 10b). More interestingly, 12 hours after administration, only 47.6 ± 3.04% of PFD accumulated in the lung tissues of mice in the LNPs@PFD group, while 83.6 ± 2.33% of PFD was retained in the lung tissues of mice in the CNPs@PFD group. Notably, free PFD rapidly accumulated in the liver (23.3 ± 2.76%) after 4 hours, which might cause liver injury. Although LNPs prolonged the retention time of PFD in the lungs, due to the relatively low stability of LNPs and the relatively fast dissociation rate of LNPs@PFD, 26.7 ± 3.56% of LNPs@PFD still accumulated in the liver 12 hours after administration, while CNPs significantly reduced liver accumulation, only 4.37 ± 0.55%. These research results indicate that CNPs@PFD has advantages in prolonging the lung retention time and reducing liver accumulation.

[0140] Example 6: In vitro transfection efficiency of CNPs@siRNA on 3T3 cells

[0141] To evaluate the cellular transfection efficiency of CNPs@siRNA and LNPs@siRNA, we carried out the delivery of Cy5-siRNA (negative control siRNA, GenePharma, A03010; the nucleotide sequence of the Cy5-siRNA is: Antisense 5'-ACGUGACACGUUCGGAGAATT-3' (SEQ ID No.2), sense 5'-UUCUCCGAACGUGUCACGUTT-3' (SEQ ID No.3); wherein the fluorescent dye Cy5 is labeled at the 5'-end of the sense strand of siRNA) according to the formulation in Example 3, where the mass ratio of the lipid molecules in the supramolecular lipid nanoparticles to Cy5-siRNA is 20:1; the mass ratio of the lipid molecules in LNPs to Cy5-siRNA is 20:1. Transfect 2×10 6 cells per 1 μg of RNA. Add the above-prepared nanoparticles to the 3T3 cell line. After culturing for 4 hours, collect the cells and analyze the transfection efficiency of CNPs@Cy5-siRNA and LNPs@Cy5-siRNA cells by flow cytometry. The results are as shown in the appendix Figure 11 and indicate that CNPs@Cy5-siRNA exhibits comparable transfection ability to LNPs@Cy5-siRNA in 3T3 cells.

[0142] Example 7: In vivo transfection efficiency of CNPs@siRNA

[0143] Next, we evaluated the RNA pulmonary delivery ability of CNPs@Cy5-siRNA (same as Example 6) and LNPs@Cy5-siRNA (same as Example 6) by inhalation administration, and we evaluated the biodistribution of CNPs@Cy5-siRNA under different administration routes.

[0144] As Figure 12 shown, 30 h after inhalation administration, the Cy5 signal of LNPs@Cy5-siRNA was mainly localized in the liver and intestine, rather than the lung, while a considerable proportion of CNPs@Cy5-siRNA remained in the lung. This indicates that compared with LNPs, the reason why CNPs can continuously deliver to the lung may be partly due to their excellent stability, enabling effective inhalation delivery.

[0145] Example 8: CNPs loaded with siRNA targeting Hsp47 and pirfenidone for in vitro inhibition of fibroblast migration experiment

[0146] In view of the above in vitro and in vivo screening results, we verified the inhibitory effect of CNPs co-loaded with siRNA targeting heat shock protein 47 (Hsp47) (siHsp47) and pirfenidone on fibroblast migration during pulmonary fibrosis.

[0147] The preparation method of CNPs@siHsp47 / PFD used in this example is as follows: Dissolve Lipid-1, ALC-0159, and PFD in ethanol and mix evenly; dissolve siHsp47 in a citric acid / sodium citrate solution with a pH of 5.0 and a concentration of 100 mM, and perform co-extrusion through microfluidics according to the volume ratio of the organic phase solution to the aqueous phase solution of 1:3 to obtain the nanoparticles CNPs@siHsp47 / PFD; wherein, the mass ratio of Lipid-1 to ALC-0159 is 90%:10%, the molar ratio of PFD to Lipid-1 is 5:1, and the mass ratio of lipid molecules (Lipid-1 and ALC-0159) to siHsp47 is 25:1.

[0148] The preparation method of CNPs@siHsp47 used in this example is as follows: Dissolve Lipid-1 and ALC-0159 in ethanol, dissolve siHsp47 in a citric acid / sodium citrate solution with a pH of 5.0 and a concentration of 100 mM, and perform co-extrusion through microfluidics according to the volume ratio of the organic phase solution to the aqueous phase solution of 1:3 to obtain the nanoparticles CNPs@siHsp47; wherein, the mass ratio of Lipid-1 to ALC-0159 is 90%:10%, and the mass ratio of lipid molecules (Lipid-1 and ALC-0159) to siHsp47 is 25:1.

[0149] The nucleotide sequence of the siHsp47 is: GCAGCAAGCAACACUACAAUU (ID12406). This sequence is the sense strand in the 5'-3' direction.

[0150] The prepared CNPs@siHsp47 / PFD and CNPs@siHsp47 were co-cultured with 3T3 cells, and then the migration number of 3T3 cells was verified by transwell experiment. As Figure 13 shown, CNPs@siHsp47 / PFD and CNPs@siHsp47 have excellent migration inhibitory ability, and the effect of CNPs@siHsp47 / PFD is better.

[0151] Example 9: CNPs loaded with siRNA targeting Hsp47 and pirfenidone for the treatment of mouse pulmonary fibrosis

[0152] For more comprehensive and systematic treatment verification, C57BL / 6J mice were selected in the present invention, and a mouse model of pulmonary fibrosis was constructed by intratracheal injection of bleomycin sulfate. On the 0th day, 20 mice were selected for intratracheal injection of bleomycin sulfate, and the dosage was 1.5 U / kg; starting from the 10th day, the mice were randomly grouped (5 mice in each group), and the following groups were set: PBS group, LNPs@siHsp47 group, CNPs@siHsp47 group, CNPs@siHsp47 / PFD treatment group, and at the same time, a healthy group without modeling was set (3 mice in each group). Intranasal inhalation was administered once every three days at a dose of 5 μg RNA per mouse for a total of 6 treatments. The mice were sacrificed on the 27th day, and lung tissues were taken for determination of hydroxyproline content and Masson staining. The treatment effects are as Figure 14 shown in a, b: The CNPs@siHsp47 group is better than the LNPs@siHsp47 group, and the CNPs@siHsp47 / PFD treatment is the best.

[0153] In this example, the CNPs@siHsp47 used in the CNPs@siHsp47 group and the CNPs@siHsp47 / PFD used in the CNPs@siHsp47 / PFD treatment group are the same as those in Example 8.

[0154] The preparation method of LNPs@siHsp47 used in the LNPs@siHsp47 group is as follows: Ionizable lipid molecule (SM-102), polyethylene glycol lipid (ALC-0159), cholesterol, and DSPC are dissolved in ethanol and mixed evenly; siHsp47 is dissolved in a citric acid / sodium citrate solution with a pH of 5.0 and a concentration of 100 mM, and co-extruded through microfluidics according to the volume ratio of the organic phase solution to the aqueous phase solution of 1:3 to obtain the nanoparticle LNPs@siHsp47. Among them, the molar ratio of SM102:DSPC:cholesterol:PEG-lipid (ALC-0159) = 50:10:38.5:1.5; the mass ratio of the lipid molecules (SM-102, ALC-0159, cholesterol, and DSPC) to siHsp47 is 25:1.

[0155] The present invention has been described in detail above. For those skilled in the art, without departing from the gist and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any modifications, uses, or improvements to the present invention, including those that depart from the scope disclosed in this application but are made with conventional techniques known in the art. The application of some basic features can be carried out within the scope of the following appended claims.

Claims

1. Supramolecular ionizable lipid represented by formula (I): Among them, n represents the number of repeating units of D-glucose or its derivatives, and n is 1, 2 or 3; R 1 independently selected from any of the following groups: R 2 independently selected from any of the following groups: H, substituted or unsubstituted C 1-30 alkyl, substituted or unsubstituted C 2-30 alkenyl or substituted or unsubstituted C 2-30 alkynyl C 1-30 alkyl, C 2-30 alkenyl or C 2-30 alkynyl; the alkyl, alkenyl or alkynyl is optionally substituted by one or more OH, NH2, halogen, -OC 1-10 alkyl, -SC 1-10 alkyl, C 3-8 cycloalkyl, 5-8-membered heterocyclic group, C 6-10 aryl or 5-10-membered heteroaryl; L 1 independently selected from any of the following groups: an oxygen atom, -OC(=O)-, -OC(=O)O-, -OC(=O)C(=O)O-, OC(=O)R 2 C(=O)O-.

2. The supramolecular ionizable lipid according to claim 1, characterized in that: Said R 1 is independently selected from any of the following groups: Preferably any of the following groups: and / or, said R 2 is independently selected from any of the following groups: C 10-20 alkyl, C 10-20 alkenyl; preferably C 10-15 alkyl; and / or, said L 1 independently selected from any of the following groups: an oxygen atom, -OC(=O)-, -OC(=O)O- 3. The supramolecular ionizable lipid according to claim 1 or 2, characterized in that: The supramolecular ionizable lipid represented by formula (I) is a lipid molecule represented by formula (1), a lipid molecule represented by formula (2), a lipid molecule represented by formula (3), a lipid molecule represented by formula (4) or a lipid molecule represented by formula (5):

4. A supramolecular lipid nanoparticle that promotes endosomal escape and can efficiently deliver nucleic acids, and its raw materials include the following two components: polyethylene glycol lipid and the supramolecular ionizable lipid according to any one of claims 1-3.

5. The supramolecular lipid nanoparticle according to claim 4, characterized in that: The raw materials further include: neutral lipid; And / or, the raw materials further include: steroidal lipid.

6. The supramolecular lipid nanoparticle according to claim 5, characterized in that: The polyethylene glycol lipid is selected from at least one of the following: 2-[(polyethylene glycol)-2000]-N,N-tetradecylacetamide (ALC-0159), 1,2-dimyristoyl-sn-glycero-methoxypolyethylene glycol (PEG-DMG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)] (PEG-DSPE), PEG-disterol glycerol (PEG-DSG), PEG-dipalmitoyl, PEG-dioleoyl, PEG-distearyl, PEG-diacylglycerol amide (PEG-DAG), PEG-dipalmitoyl phosphatidylethanolamine (PEG-DPPE), PEG-1,2-dimyristyloxypropyl-3-amine (PEG-c-DMA); And / or, the neutral lipid is selected from at least one of the following: 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE), 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE), 2-dioleoyl-sn-glycero-3-phosphate-(1'-rac-glycerol) (DOPG), oleoyl phosphatidylcholine (POPC), 1-palmitoyl-2-oleoyl phosphatidylethanolamine (POPE); And / or, the steroidal lipid is selected from at least one of the following: avenasterol, β-sitosterol, brassicasterol, ergocalciferol, campesterol, cholestanol, cholesterol, coprostanol, dehydrocholesterol, clionasterol, dihydroergocalciferol, dihydrocholesterol, dihydroergosterol, chondrillasterol, epicholesterol, ergosterol, fucosterol, hexahydrobrassicasterol, hydroxy cholesterol, lanosterol, lumisterol, saringosterol, sitostanol, sitosterol, stigmasterol, stigmasterol, cholanic acid, glycochenodeoxycholic acid, taurocholic acid, deoxycholic acid and lithocholic acid.

7. The supramolecular lipid nanoparticle according to claim 5 or 6, wherein: The supramolecular lipid nanoparticles, calculated by mass percentage, comprise: 30%-99% of the supramolecular ionizable lipid, 1%-70% of the polyethylene glycol lipid, 0%-30% of the neutral lipid molecule, and 0%-60% of the steroidal lipid; Further, the supramolecular lipid nanoparticles, calculated by mass percentage, comprise: 60%-95% of the supramolecular ionizable lipid, 5%-40% of the polyethylene glycol lipid, 0%-20% of the neutral lipid molecule, and 0%-20% of the steroidal lipid.

8. A promoting endosomal escape type supramolecular lipid nanoparticle encapsulating a nucleic acid molecule, which comprises the promoting endosomal escape type, highly efficient nucleic acid delivering supramolecular lipid nanoparticle according to any one of claims 4-7 and a nucleic acid molecule.

9. The endosome escape-promoting supramolecular lipid nanoparticles encapsulating nucleic acid molecules according to any one of claims 8, wherein: The mass ratio of the lipid molecule to the nucleic acid in the supramolecular lipid nanoparticles is 5:1-50:

1. Further, the mass ratio of the lipid molecule to the nucleic acid in the supramolecular lipid nanoparticles is 10:1-30:

1.

10. A supramolecular lipid nanoparticle encapsulating a small molecule drug, which comprises a small molecule drug and the promoting endosomal escape type, highly efficient nucleic acid delivering supramolecular lipid nanoparticle according to any one of claims 4-7 or the promoting endosomal escape type supramolecular lipid nanoparticle encapsulating a nucleic acid molecule according to claim 8 or 9; The small molecule drug is selected from all small molecules that can form host-guest complexes with α, β, γ-cyclodextrin and their derivatives.

11. The supramolecular lipid nanoparticle encapsulating a small molecule drug according to claim 10, wherein: The small molecule drug is selected from at least one of the following: pirfenidone, nintedanib, ciprofloxacin, N-acetylcysteine, salbutamol, formoterol, resmetirom, SMU127, 1-methyl-D-tryptophan, 3-(5-fluoro-1H-indol-3-yl)-2,5-pyrrolidinedione, BMS-986205, IDO-IN-7 inhibitor, oxyresveratrol, hydroxychloroquine, curcumin, tamoxifen, GSK126, GSK3326595, carvedilol, rapamycin, JNJ-64619178, eugenol, chalcone, thymol, melatonin, amantadine; And / or, the molar ratio of the small molecule drug to the supramolecular ionizable lipid shown in formula (I) in the supramolecular lipid nanoparticles is (1-10):

1.

12. A preparation method of the promoting endosomal escape type supramolecular lipid nanoparticle encapsulating a nucleic acid molecule according to claim 8 or 9 or the supramolecular lipid nanoparticle encapsulating a small molecule drug according to claim 10 or 11, comprising the following steps: Step (A1): Dissolving the supramolecular ionizable lipid, polyethylene glycol lipid, neutral lipid molecule, steroidal lipid according to any one of claims 1-3 in a solvent to obtain a liposome solution; or, dissolving the supramolecular ionizable lipid, polyethylene glycol lipid, neutral lipid molecule, steroidal lipid, small molecule drug according to any one of claims 1-3 in a solvent to obtain a liposome solution; Step (A2): Dissolve the nucleic acid molecule in a buffer solution with an appropriate pH value to obtain a nucleic acid solution; Step (A3): According to a certain mass ratio and volume ratio, co-extrude the aqueous solution and the organic solution of the liposome solution in step (A1) and the nucleic acid solution in step (A2) by using a microfluidic device to prepare a promoted endosomal escape type supramolecular lipid nanoparticle encapsulating a nucleic acid molecule or a supramolecular lipid nanoparticle encapsulating a small molecule drug.

13. The preparation method according to claim 12, characterized in that: The solvent used to dissolve the lipid molecule in the step (A1) is methanol, ethanol, tetrahydrofuran, acetone, dimethyl sulfoxide, N, N-dimethylformamide. Preferably, the solvent used to dissolve the lipid molecule in the step (A1) is ethanol, tetrahydrofuran, acetone; And / or, the mass percentage of the supramolecular ionizable lipid molecule in the step (A1) is 30%-99%. Preferably, the mass percentage of the supramolecular ionizable lipid molecule in the step (A1) is 60%-95%; And / or, the mass percentage of the polyethylene glycol lipid in the step (A1) is 1%-70%. Preferably, the mass percentage of the polyethylene glycol lipid in the step (A1) is 5%-40%; And / or, the mass percentage of the neutral lipid molecule in the step (A1) is 0%-30%. Preferably, the mass percentage of the neutral lipid molecule in the step (A1) is 0%-20%; And / or, the mass percentage of the steroidal lipid molecule in the step (A1) is 0%-60%. Preferably, the mass percentage of the steroidal lipid molecule in the step (A1) is 0%-20%; And / or, the buffer solution in the step (A2) is an acetic acid / sodium acetate solution or a citric acid / sodium citrate solution. Preferably, the buffer solution in the step (A2) is a citric acid / sodium citrate solution; And / or, the pH value of the buffer solution in the step (A2) is 3-9. Preferably, the pH value of the buffer solution in the step (A2) is 4-6; And / or, the concentration of the buffer solution in the step (A2) is 1 mM-1 M. Preferably, the concentration of the buffer solution in the step (A2) is 20 mM-500 mM; And / or, the mass ratio of the lipid molecule in the liposome solution to the nucleic acid molecule in the nucleic acid solution in the step (A3) is 5:1-50:

1. Preferably, the mass ratio of the lipid molecule to the nucleic acid molecule in the step (A3) is 10:1-30:1; And / or, the volume ratio of the liposome solution to the nucleic acid solution in the step (A3) is 1:1-10:

1. Preferably, the volume ratio of the liposome solution to the nucleic acid solution in the step (A3) is 1:1-5:

1.

14. Use of the promoted endosomal escape type supramolecular lipid nanoparticle encapsulating a nucleic acid molecule according to claim 8 or 9 or the supramolecular lipid nanoparticle encapsulating a small molecule drug according to claim 10 or 11 in the preparation of nucleic acid drugs; including but not limited to drugs for pulmonary fibrosis, COVID drugs, lung cancer drugs, asthma drugs, chronic obstructive pulmonary disease drugs, etc. Use in the preparation of a delivery vector for nucleic acid drugs, wherein the nucleic acid drugs include but are not limited to drugs for pulmonary fibrosis, COVID-19 drugs, lung cancer drugs, asthma drugs, and chronic obstructive pulmonary disease drugs.

Images