Detection device for plant pathogenic microorganisms

The gene chip with specific probes for soil-borne pathogens addresses detection challenges by enhancing accuracy and throughput, enabling precise identification of plant pathogens.

CN120290300APending Publication Date: 2025-07-11YUNNAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510453588.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-11
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

Current soil-borne pathogen detection methods, such as microbe isolation culture, real-time PCR, high-throughput qPCR, and gene chip technologies, face challenges in accuracy, throughput, and complexity, particularly in distinguishing between closely related species of plant pathogens, limiting their effectiveness in precise detection.

Method used

A plant pathogen detection device using a gene chip with specifically designed oligonucleotide probes for Alternaria, Botrytis, Fusarium, and Verticillium species, incorporating negative controls and quality control probes, to enhance specificity and accuracy in identifying soil-borne pathogens.

Benefits of technology

The device achieves precise, high-throughput detection of soil-borne pathogens with reduced false positives and negatives, filling the gap in gene chip technology for accurate plant pathogen identification.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290300A_ABST
    Figure CN120290300A_ABST
Patent Text Reader

Abstract

The invention provides a detection device for plant pathogenic microorganisms, and belongs to the technical field of microorganism detection, the detection device contains a specific gene probe set of the plant pathogenic microorganisms, and the plant pathogenic microorganisms comprise at least one of Alternania alterata, Botrytis cinerea, Fusarium avenaceum, Fusarium bothii, Fusarium fujikuroi, Fusarium trichotricinctum, Fusarium trichotricinctum, Sclerotinia sclerotiorum and Verticilliumdahliae. The device comprises a specific gene probe set of plant pathogenic microorganisms, has excellent resolution, can improve the accuracy of pathogenic microorganism detection, and realizes accurate detection of soil-borne pathogenic microorganisms.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of microbial detection, and particularly relates to a detection device for plant pathogenic microorganisms. Background Art

[0002] Accurate detection of pathogenic microorganisms is the basis for achieving precise prevention and control of diseases. Taking the detection of soil-borne pathogens as an example, soil-borne diseases refer to diseases caused by pathogenic microorganisms in the soil invading crops from the roots or stems when conditions are suitable. Soil-borne disease pathogens can often survive in the soil for several years or even more than a decade. There are hundreds of common soil-borne diseases. Soil-borne diseases in the seedling stage of crops can cause rapid death of seedlings, while infection with soil-borne diseases in the mature stage of crops can lead to a 20% - 50% reduction in production, and even complete crop failure in severe cases. Soil-borne diseases pose a huge threat to the sustainable development of agriculture.

[0003] Soil-borne pathogens mainly include Fusarium, Alternaria, Phytophthora, etc. The current soil-borne pathogen detection technologies mainly include the following: microbial isolation and culture method, real-time fluorescence quantitative PCR (qPCR), high-throughput qPCR, amplicon high-throughput sequencing, whole-genome analysis, and gene chip technologies. The microbial isolation and culture method is a classic detection technology. By isolating and culturing the corresponding microorganisms on diseased plants and inoculating them onto healthy plants to detect pathogens, this method requires a long detection time and low throughput, and is not suitable for large-scale detection or situations with high requirements for detection timeliness. Real-time fluorescence quantitative PCR absolutely quantifies the copy number of pathogen-labeled DNA through pre-designed specific primers. Although the qPCR technology has high detection accuracy, its detection throughput is still low. The high-throughput qPCR technology integrates multiple primers on a matrix and performs multiple reactions in one system. Although it improves the detection throughput, there are still many technical problems that are difficult to solve. Testing dozens of primers with different reaction conditions under the same reaction conditions will cause inevitable testing deviations. Amplicon sequencing and whole-genome technologies have extremely high detection throughput, but their detection accuracy is low, cannot meet the need for precise pathogen identification, and the data processing is cumbersome and complex, requiring professional bioinformatics processing means and consuming a large amount of computing power.

[0004] Gene chip technology (GeneChip), also known as microarray technology (MicroArray), is a high-throughput detection technology based on oligonucleotide probe hybridization and fluorescence labeling detection. Its basic principle is to design nucleic acid probes according to specific genes of specific microbial classifications or functional groups, fix the probes on a matrix to form a microarray, add fluorescence labeling after extracting environmental DNA, hybridize with the single-stranded DNA on the chip, wash the chip and then scan and image it to identify the fluorescence intensity, and react the specific DNA copy number in the sample according to the fluorescence intensity. The accuracy of gene chip in detecting pathogenic bacteria is comparable to that of qPCR, but the detection throughput is thousands of times that of qPCR technology, and it avoids complicated bioinformatics processing, which is an ideal technology for pathogenic bacteria detection. In the process of chip design, the quality of probe design is directly related to the detection effect of gene chip, so the method of probe design is the core of chip design work.

[0005] The existing probe design methods are mainly divided into three types, which are to mine specific probes from the conserved regions of the microbial genome, design specific probes for specific functional genes, and directly mine specific probes from the microbial genome.

[0006] Designing specific gene probes for conserved regions in the microbial genome, such as the 16S rRNA gene of bacteria and the internal transcribed spacer (ITS) of eukaryotes, is the most common probe design method. However, both the 16S rRNA gene and the ITS sequence have the problem of insufficient resolution, often only being able to identify the detection level at the species level. Even in some genera with little difference within a genus, it can only achieve the classification level at the genus level, far from meeting the requirements of precise microbial detection. This is because the sequence differences of microorganisms within the same species or even the same genus in the conserved region may be very small, resulting in the probes designed by this method being insufficient to achieve precise detection of pathogenic microorganisms.

[0007] Gene probes designed for specific functional genes of microorganisms are commonly used in the design of environmental functional gene chips to evaluate the copy number of specific functional genes of microorganisms in the environment and measure the functional potential of microbial community-related ecological processes. In the aspect of pathogen detection, existing algorithms analyze the key virulence genes of well-studied pathogens and design gene probes accordingly. This method has a significant improvement in accuracy compared with the method of designing probes for conserved regions. However, in microbial research, compared with human pathogenic bacteria or zoonotic pathogens, the prior knowledge of plant pathogenic bacteria or other microorganisms is relatively scarce, and it is difficult to obtain such data, which may be difficult to meet the needs of probe design. In addition, limited by the length of specific genes, it may not be possible to obtain enough probes that meet the conditions. Moreover, in environments with extremely rich microbial diversity such as soil, strict indicators are required for probe design to reduce the false positive rate. Using only virulence genes for design may lead to a decline in probe-related indicators.

[0008] Algorithms for directly obtaining probes from microbial genomes have wide applicability and can make the most of microbial genomic information to select the probes with the best indicators for the detection of specific microbial taxa. However, the complex microbial genomic data pose a huge challenge to probe design methods. On the one hand, existing algorithms use commercial software to calculate relevant indicators in key links of the process. Some commercial software is difficult to obtain and has not been maintained or updated for many years, and its usability is difficult to guarantee, seriously affecting the flexibility and reliability of the process. On the other hand, existing methods are inefficient in dealing with redundant non-specific sequences in the genome and are difficult to meet the needs of large-scale probe design, especially difficult to design specific probes for fungi, and often ignore the verification of intra-species conservation of probes.

[0009] In summary, existing probe design methods mainly focus on mining probes from conserved regions in microbial genomes and designing specific probes for specific functional genes of interest. However, these probe design methods lack flexibility or require a large amount of prior knowledge about pathogen genomes, such as identifying virulence genes. Compared with well-studied human pathogenic bacteria or zoonotic pathogenic bacteria, the research on related genes of plant pathogenic bacteria is relatively scarce, and prior knowledge is difficult to obtain, restricting the application of this method. Therefore, although gene chip technology has great potential in detecting soil-borne pathogens, its research is still blank. Summary of the Invention

[0010] To fill the blank in the detection of soil-borne pathogens by gene chip technology, the present invention provides a detection device for plant pathogenic microorganisms, which includes a set of specific gene probes for plant pathogenic microorganisms, has excellent resolution, can improve the accuracy of pathogen detection, and achieve precise detection of pathogenic microorganisms.

[0011] The present invention is achieved through the following technical solutions:

[0012] The present invention provides a detection device for plant pathogenic microorganisms, which contains a specific gene probe set for plant pathogenic microorganisms. The plant pathogenic microorganisms include at least one of Alternaria alternata, Botrytis cinerea, Fusarium avenaceum, Fusarium boothii, Fusarium fujikuroi, Fusarium odoratissimum, Fusarium tricinctum, Sclerotinia sclerotiorum, and Verticillium dahliae;

[0013] The specific gene probe set for Alternaria alternata contains 50 oligonucleotide probes, and their nucleotide sequences are shown in SEQ ID NO.1 - 50 respectively;

[0014] The specific gene probe set for Botrytis cinerea contains 50 oligonucleotide probes, and their nucleotide sequences are shown in SEQ ID NO.51 - 100 respectively;

[0015] The specific gene probe set for Fusarium avenaceum contains 50 oligonucleotide probes, and their nucleotide sequences are shown in SEQ ID NO.101 - 150 respectively;

[0016] The specific gene probe set for Fusarium boothii contains 50 oligonucleotide probes, and their nucleotide sequences are shown in SEQ ID NO.151 - 200 respectively;

[0017] The specific gene probe set for Fusarium fujikuroi contains 50 oligonucleotide probes, and their nucleotide sequences are shown in SEQ ID NO.201 - 250 respectively;

[0018] The specific gene probe set for Fusarium odoratissimum contains 50 oligonucleotide probes, and their nucleotide sequences are shown in SEQ ID NO.251 - 300 respectively;

[0019] The specific gene probe set of Fusarium tricinctum contains 50 oligonucleotide probes, and their nucleotide sequences are shown in SEQ ID NO. 301 to 350 respectively;

[0020] The specific gene probe set of Sclerotinia sclerotiorum contains 50 oligonucleotide probes, and their nucleotide sequences are shown in SEQ ID NO. 351 to 400 respectively;

[0021] The specific gene probe set of Verticillium dahliae contains 50 oligonucleotide probes, and their nucleotide sequences are shown in SEQ ID NO. 401 to 450 respectively.

[0022] Furthermore, the detection device contains negative control probes, global quality control probes and built-in probes;

[0023] The nucleotide sequence of the negative control probe is shown in SEQ ID NO. 451, and the nucleotide sequence of the global quality control probe is shown in SEQ ID NO. 452;

[0024] The built-in probes include pos probes and neg probes.

[0025] Furthermore, the detection device is a gene chip, and the gene chip contains a solid-phase carrier, and the specific gene probe set, the negative control probe, the global quality control probe and the built-in probes are all fixed on the solid-phase carrier.

[0026] Furthermore, the gene chip contains a microarray of 192 rows × 82 columns, and the specific gene probe set, the negative control probe, the global quality control probe and the built-in probes are arranged on the microarray in a certain order;

[0027] In the gene chip, the total number of the built-in probes is 536 repeats, and they are randomly distributed in the microarray;

[0028] The negative control probe is repeated 114 times and is distributed on the dividing lines of 4×8 sub-arrays;

[0029] The global quality control probe is repeated 544 times, and the 192 rows × 82 columns microarray is virtually divided into 4×8 sub-arrays, and the global quality control probe radiates radially from the center of each sub-array to the surroundings;

[0030] The specific gene probe set of the plant pathogenic microorganism contains 50 to 450 oligonucleotide probes, repeated once, and is randomly arranged in the microarray.

[0031] Based on the same inventive concept, the present invention provides an application of a detection device for plant pathogenic microorganisms in detecting plant pathogenic microorganisms.

[0032] Based on the same inventive concept, the present invention provides an application of a detection device for plant pathogenic microorganisms in detecting soil-borne pathogens.

[0033] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0034] 1. A detection device for plant pathogenic microorganisms according to the present invention, the detection device being a gene chip, comprising a set of specific gene probes for soil-borne pathogens in 1-9. The set of specific gene probes for each pathogen includes 50 highly specific oligonucleotide probes. The set of specific gene probes is directly mined from the genomic data of pathogenic microorganisms, having the advantages of high specificity and good coverage of each strain within the species, and being able to avoid false positives and false negatives.

[0035] 2. A detection device for plant pathogenic microorganisms according to the present invention, the set of specific gene probes in the detection device filters out candidate probes with high similarity in genomic alignment to microorganisms belonging to the same genus, family, and order as the target pathogen, improving the resolution of the probe set, and further improving the accuracy of pathogenic microorganism detection, achieving precise detection of pathogenic microorganisms, and effectively filling the gap in the detection of soil-borne pathogens by gene chip technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the following drawings are some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0037] Figure 1 It is a schematic diagram of the probe arrangement of the gene chip of the present invention.

[0038] Figure 2 It is the probe combination sequence of 9 typical soil-borne pathogens in 5 genera. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0039] The following will specifically describe the present invention in combination with the specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly presented therefrom. Those skilled in the art should understand that these specific embodiments and examples are used to illustrate the present invention, rather than limiting the present invention.

[0040] Throughout the specification, unless otherwise specifically stated, the terms used herein shall be understood to have the meanings as commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention pertains. In case of any contradiction, this specification shall prevail.

[0041] Unless otherwise specifically stated, various raw materials, reagents, instruments, and equipment used in the present invention can be obtained through market purchase or can be prepared by existing methods.

[0042] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods.

[0043] The following will describe in detail a detection device for plant pathogenic microorganisms of the present invention in conjunction with examples and experimental data.

[0044] Example 1

[0045] This example provides a method for designing a specific gene probe for detecting pathogenic microorganisms, including:

[0046] S1. Obtain the reference genome data of the target pathogen, the reference genome data of all species belonging to the same genus as the target pathogen, and the genome data of all strains under the target pathogen.

[0047] S2. Use MUMmer to compare the reference genome data of the target pathogen with the reference genome data of all species belonging to the same genus as the target pathogen, and obtain all fragments in the reference genome of the target pathogen with a continuous alignment of ≥20 identical bases with the reference genomes of other microorganisms belonging to the same genus, and record the starting base sites and ending base sites of all fragments.

[0048] S3. Break the reference genome of the target pathogen into a 50nt k-mer set, filter out the non-specific fragments in the 50nt k-mer set, and obtain an initial candidate probe set:

[0049] S31. Break the reference genome of the target pathogen into a 50nt k-mer set, and filter out all 50nt k-mers in the 50nt k-mer set with a continuous alignment of ≥20 identical bases with the reference genomes of other microorganisms belonging to the same genus according to the starting base site and the ending base site, and obtain an initial candidate k-mer set;

[0050] S32. Record the starting sites and ending sites of all 50nt k-mers in the initial candidate k-mer set;

[0051] S33. Screen the initial candidate k-mer set to form an initial candidate probe set, where the starting sites of all candidate probes in the initial candidate probe set are spaced at least 25 base sites apart in the reference genome of the target pathogen.

[0052] S4. Filter the initial candidate probe set to obtain candidate probe set 3:

[0053] S41. Filter the initial candidate probe set according to thermodynamic parameters. The specific criteria are as follows: the GC content is 35% - 65%, the melting temperature is 55°C - 80°C, and the number of consecutive identical bases does not exceed 4. Initial candidate probes that do not meet the specific criteria are discarded, and the remaining initial candidate probes form candidate probe set 1;

[0054] S42. Use blastn v2.9.0 to pairwise align the k-mers in candidate probe set 1, and remove k-mers with ≥15 consecutive aligned identical bases compared to other k-mers. The remaining k-mers form candidate probe set 2;

[0055] S43. Perform conservation detection on the k-mers in candidate probe set 2. Use blastn to align candidate probe set 2 with the genomic data of all strains within the species of the target pathogen. If a certain k-mer has ≥35 consecutive aligned identical bases and identity ≥96 with the genome of any strain, it is considered that the k-mer covers that strain. Count the number of strains covered by each k-mer, sort the candidate probes in descending order according to the number of covered strains, and select the top 50000 k-mers to form candidate probe set 3.

[0056] S5. Filter the candidate probe set 3 to obtain a specific probe set:

[0057] S51. When the number of target pathogens is 1, align the k-mers in candidate probe set 3 with the NCBI NT database, and screen and exclude k-mers with ≥20 consecutive aligned identical bases or identity ≥90 with the gene sequences of non-target microorganisms to generate a specific probe set;

[0058] S52. When the number of target pathogens ≥2, align the candidate probe set 3 corresponding to each target pathogen with the genomic data of the remaining target pathogens respectively, and filter out k-mers with ≥20 consecutive aligned identical bases or identity ≥90 to obtain candidate probe set 4;

[0059] Align each k-mer in each of the candidate probe sets 4 with the NCBI NT database, and screen out and exclude k-mers with ≥20 consecutive aligned identical bases or identity ≥90 with non-target microbial gene sequences to generate multiple specific probe sets.

[0060] Example 2

[0061] In this example, specific oligonucleotide probes for 9 soil-borne plant pathogens are designed.

[0062] In this example, specific oligonucleotide probes are designed for 9 soil-borne pathogens in 5 genera with a wide spread range and high harm degree, and a probe combination for 9 typical soil-borne pathogens in 5 genera is obtained. The 5 genera include Alternaria, Botrytis, Fusarium, Verticillium, and Sclerotinia. The specific scientific names are: Alternaria alternata, Botrytis cinerea, Fusarium avenaceum, Fusarium boothii, Fusarium fujikuroi, Fusarium odoratissimum, Fusarium tricinctum, Sclerotinia sclerotiorum, Verticillium dahliae.

[0063] The specific probe design steps are as follows:

[0064] (1) Construction of the genomic database of the target pathogen: This database includes the genomic data of all target pathogens to be detected and the genomic data of all non-target microorganisms for control (including the reference genomes of all species in the same genus as the target pathogen and the genomes of all strains under the target pathogen - from the Genbank database). The inventor obtained the genomic sequences of 9 target pathogens from the Genbank database. The inventor further screened out the reference genomes of the target pathogens, and the screening principle was: in the case of multiple reference genomes for the same species, select the genomic data with the highest assembly level or the highest genomic integrity to ensure the accuracy and integrity of the genomic data as much as possible.

[0065] The numbers of the reference genomes of each target pathogen in this example are as follows:

[0066] Scientific name of the pathogen Genome number Alternaria alternata GCF_001642055.1 Botrytis cinerea GCF_000143535.2 Fusarium avenaceum GCA_025948275.1 Fusarium boothii GCA_017656985.1 Fusarium fujikuroi GCF_900079805.1 Fusarium odoratissimum GCF_000260195.1 Sclerotinia sclerotiorum GCF_000146945.2 Verticillium dahliae GCF_000150675.1 Fusarium tricinctum GCA_020744515.1

[0067] (2) Specific probe design:

[0068] 1) First, merge the genomic data of other microorganisms belonging to the same genus as the target pathogen to be designed into a single fasta file, denoted as nontarget_genomes.fna. Use the NUCmer module of MUMmer4 to align the target pathogen reference genome data file target_genome.fna with nontarget_genomes.fna. Mark all sequence fragments in the target pathogen reference genome with a continuous alignment of ≥20 identical bases with the genomes of other non-target microorganisms of the same genus, and record the starting and ending base positions of all fragments.

[0069] 2) Use a self-written script to break the marked target pathogen reference genome file into 50nt k-mer sets using a sliding window method with a step size of 1 and a window length of 50. Delete the 50nt k-mers in the 50nt k-mer sets that have a continuous alignment of ≥20nt with the reference genomes of other non-target microorganisms of the same genus according to the starting and ending base positions recorded in step 1) to form an initial candidate k-mer set.

[0070] 3) Record the starting and ending positions of all 50nt k-mers in the initial candidate k-mer set. To prevent an excessive number of k-mers with a large amount of overlap in the target pathogen genome in the initial candidate k-mer set from affecting the subsequent calculation efficiency, select k-mers with a difference of at least 25 bases in the starting positions in the target pathogen genome from the initial candidate k-mer set to form an initial candidate probe set.

[0071] 4) Screen suitable 50nt k-mers in the initial candidate probe set according to thermodynamic parameters. The specific screening criteria are as follows: the GC content is between 35% and 65% (the GC content is used to limit the melting temperature), the melting temperature is between 55°C and 80°C, and the number of consecutive identical bases does not exceed 4. 50nt k-mers that do not meet this condition will be discarded, and the remaining k-mers form candidate probe set 1.

[0072] 5) Use blastn v2.9.0 to perform pairwise alignment on the k-mer set in candidate probe set 1, and remove k-mers with ≥15 consecutive identical bases with other k-mers. The remaining k-mers form candidate probe set 2.

[0073] 6) Perform conservation detection on the k-mer set in candidate probe set 2. Use blastn to align the filtered k-mer set obtained above with the genomic data of all strains of the target pathogen at the subspecies level. If the sequence has a continuous alignment with the genome of any strain with a consistent base number ≥ 35 and identity ≥ 96, then it is considered that the k-mer covers that strain; count the number of strains covered by each k-mer, and in the order from most to least, obtain the top 50,000 k-mers ranked by the number of covered strains to form candidate probe set 3.

[0074] 7) Align the k-mers in candidate probe set 3 corresponding to the 9 target pathogens one by one with the reference genomic data of the remaining target pathogens, and filter out the k-mers with a continuous alignment with a consistent base number ≥ 20 or identity ≥ 90. The remaining k-mers form candidate probe set 4.

[0075] 8) Align the k-mers in each candidate probe set 4 with the NCBI NT database respectively, and screen out the non-specific k-mers with ≥ 20 consecutive identical bases or identity ≥ 90 with the gene sequences of non-target microorganisms. Generate 9 specific probe sets.

[0076] In this embodiment, the above steps are adopted to design specific oligonucleotide probes for 9 soil-borne pathogens in 5 genera with a wide spread range and great harm degree, and obtain the probe combinations of 9 typical soil-borne pathogens in 5 genera as Figure 2 shown.

[0077] Example 3

[0078] Gene chip and its preparation method:

[0079] Use the probes designed in Example 2 to design a gene chip. In addition to the specific oligonucleotide probes for the above 9 pathogens, this gene chip also includes negative control probes and global quality control probes. The sequence of the negative control probe is:

[0080] Probe Neg (negative control probe):

[0081] AAA AAT TTA TAC TCA TGA ACT GCC TAA ATG GCT AAT TTT TAA CGA GAA AA.

[0082] The global quality control probe is:

[0083] Probe UCP (global quality control probe):

[0084] CCG CAC CTC GGA CCG CAC ACA ATC GTT TGA GGA CGT GTA GCT GTG CTG GC.

[0085] The design method of global quality control probe and negative control probe is as follows: 100,000 random sequences of 50 nt are generated by computer simulation, and the generation principle is that there should not be five consecutive identical bases. Then, the generated sequences are aligned to the NCBI NT library using bl astn, and all sequences with consecutive aligned consistent base numbers ≥ 20 or identities ≥ 90 are filtered and deleted. Two sequences are randomly selected as negative control probes and global quality control probes.

[0086] The inventors used the 8×15K CGH (whole genome hybridization) microarray chip of the Agilent (https: / / www.agi lent.com / ) platform, which includes a solid phase carrier, on which the probe is fixed during preparation. The above-designed oligonucleotide probes, negative control probes, global quality control probes, and Agilent's own built-in probes are designed and arranged in a certain order on the solid phase carrier to form a microarray. The inventors selected the Agilent 8×15K microarray chip (there are 8 microarrays on one substrate of the Agilent 8×15K CGH microarray chip, and each microarray has 192 rows×82 columns of sites where probes can be arranged, and each microarray already contains 536 Agilent built-in probes of neg and pos, which should be avoided when deploying self-designed probes), and used red and green dual-channel staining. Each microarray can detect two samples at a time (i.e., two DNA samples are stained with cy3 and cy5 respectively, and one microarray can be hybridized with two stained samples, and then different fluorescence can be scanned. Which probes are lit up is determined based on the sites that emit significant hybridization fluorescence signals, and which pathogens are detected in the sample is determined based on the species targeted by these probes. Since a chip contains 8 microarrays, one chip can detect 16 samples). The distribution of various probes in a single microarray is shown in Figure 1 ( Figure 1 In the chip, UCP probe is a global quality control probe, NCP probe is a negative control probe, pos and neg probes are built-in Agilent chips. Except for the sites occupied by these probes, all sites can be placed with pathogen detection specific probes), which are described in more detail as follows:

[0087] Agilent built-in probes: There are 536 pos and neg probes in total, randomly distributed in a single microarray.

[0088] Global quality control probe: 1 probe sequence, repeated 544 times. In addition, the 192 rows × 82 columns microarray was virtually divided into 4 × 8 subarrays, and the global quality control probe was radially spread from the center of each subarray.

[0089] Negative control probe: a total of 1 probe sequence, repeated 114 times, distributed on the dividing lines of the 4×8 subarrays.

[0090] Pathogen detection specific probes: A total of 450 probe sequences, repeated once, randomly arranged in the microarray.

[0091] Among them, the pos and neg probes are built-in probes that come with the Agilent chip platform.

[0092] Example 4

[0093] Using gene chips to detect samples:

[0094] In this embodiment, the inventors used the gene chip prepared in Example 3 containing 9 soil-borne pathogens and a total of 450 probes to detect the sample to be tested. In this embodiment, the inventors obtained 9 strains from Beina Biotechnology (bncc.com), and the specific introduction source numbers are shown in Table 1.

[0095] Table 1 Sample number and source of Example 4

[0096] Sample name Introduction number Sample 1 BNCC116486 Sample 2 BNCC123731 Sample 3 BNCC143048 Sample 4 BNCC370120 Sample 5 BNCC120618 Sample 6 BNCC122299 Sample 7 BNCC122963 Sample 8 BNCC337560 Sample 9 BNCC143004

[0097] The test involves the following steps:

[0098] 1. Preparation of DNA to be tested

[0099] The inventors used QIAGEN DNeasy PowerSo il Pro Kits and ALFA-SEQ Fungal DNA Kit fungal DNA small extraction kit to extract DNA from the samples to be tested, and then used Nanodrop to determine the sample DNA concentration and nucleic acid purity index. For samples with OD 260 / 280 and 260 / 230 less than 1.5, the DNA was purified using OMEGA EZNACyclePure Kit, and finally all samples had DNA 260 / 280 and 260 / 230 ≥ 1.5, and the total amount of nucleic acid was determined using Qubit. The specific experimental operations were carried out in full accordance with the kit instructions.

[0100] Table 2 DNA concentration of each sample to be tested in Example 4

[0101] Sample name DNA concentration (ng / μL) Sample 1 70.4 Sample 2 75 Sample 3 123.2 Sample 4 58.6 Sample 5 118.8 Sample 6 146.4 Sample 7 46 Sample 8 33.6 Sample 9 48.8

[0102] 2. Chip hybridization and cleaning

[0103] (1) Purification of target sample DNA

[0104] a. Pre-equilibrate OnePure MagBeads at room temperature for 30 minutes and mix well by shaking vigorously to ensure no obvious precipitation of magnetic beads;

[0105] b. Add 50 - 100 uL of the DNA sample to be purified by magnetic beads into a PCR tube / strip tube, then add an equal volume of OnePure MagBeads, vortex to mix well, briefly centrifuge to collect the liquid on the tube wall, and let it stand at room temperature for 5 minutes;

[0106] c. Place the PCR tube / strip tube on a magnetic rack. Wait until the solution in the tube becomes clear, then discard the supernatant;

[0107] d. Add 200 uL of freshly prepared 80% ethanol to the PCR tube / strip tube, let it stand for 30 seconds, then discard the supernatant. Repeat this operation until the supernatant is removed relatively cleanly;

[0108] e. Place the PCR tube / strip tube on a magnetic rack and let it stand at room temperature for 1 to 2 minutes until the magnetic beads crack, or open the lid of the tube and place it on a 45 °C metal bath until there is no water shine on the surface of the magnetic beads and no ethanol residue at the bottom of the tube;

[0109] f. Remove the PCR tube / strip tube from the magnetic rack, add 43 uL of pre-warmed sterile water to resuspend the magnetic beads, mix well by vortexing or pipetting, briefly centrifuge to collect the liquid on the tube wall, and let it stand at room temperature for 3 minutes;

[0110] g. Place the PCR tube / strip tube on a magnetic rack. Wait until the solution in the tube becomes clear, and transfer 42 uL of the supernatant to a new EP tube for the next labeling step.

[0111] (2) DNA Fluorescent Labeling

[0112] Use the Agilent SureTag Complete DNA Labeling Kit, including the following steps:

[0113] a. Take 250 ng of the gDNA purified by magnetic beads and make up the volume to 14.75 uL with sterile water. Then add 2.75 uL of Random primer, mix well, and perform the following denaturation reaction: 98 °C for 10 min, hot lid at 105 °C; after the time is up, immediately cool the sample on ice;

[0114] b. After briefly centrifuging the above sample, directly add the following reagents: 1 uL of sterile water, 5.5 uL of 5×Reaction buffer, 2.75 uL of 10×dNTP mix, 0.25 uL of Cy5-dUTP, 0.5 uL of Exo(-)Klenow, a total of 27.5 uL;

[0115] c. After mixing by pipetting or vortexing, quickly centrifuge to collect the liquid on the tube wall and remove air bubbles;

[0116] d. Place the reaction system on a PCR instrument, set the hot lid temperature to 105 °C, and run the following program: 37 °C for 4 hours, 95 °C for 3 minutes, hold at 4 °C.

[0117] (3) Purification of Fluorescently Labeled DNA Products

[0118] a. Centrifuge the labeled product, confirm the column order, add 125 uL of 1×TE and the sample in three portions each time and mix, rinse the labeled tube and transfer it to the purification column. Centrifuge at 14000×g for 10 min;

[0119] b. Discard the filtrate, put the collection tube back into the collection column, add 480 uL of 1×TE (pH 8.0) to the collection column, cover the lid, and centrifuge at 14000×g for 10 min;

[0120] c. Take out the collection column and invert it into a new 2 mL centrifuge tube, make corresponding marks on the tube, centrifuge at 1000×g for 1 min, and the obtained product is the purified sample (samples from the same hybridization region are purified and recovered into the same collection tube) (the volume is approximately between 40 - 64 uL). Transfer the purified product into a PCR tube;

[0121] d. Measure the total nucleic acid concentration and the corresponding dye - label concentration using Nanodrop one;

[0122] e. Dry the sample to a volume of 10 uL using a concentrator.

[0123] (4) Hybridization of Target Sample Fluorescent DNA with Gene Chip

[0124] Use the Agilent Oligo aCGH / ChIP - on - chip Hybridization Kit, including the following steps:

[0125] a. After preparing the hybridization system according to Table 3, add 45 uL of the hybridization system to the above - concentrated 10 uL sample, mix by pipetting, briefly centrifuge, then place the reaction system on a PCR instrument, set the hot lid temperature to 105 °C, and run the following program: 98 °C for 3 min, 37 °C for 30 min, hold at 37 °C;

[0126] Table 3 Chip Hybridization System

[0127]

[0128]

[0129] b. Hybridization: a. First, place a clean gasket into the Agilent chamber with the gasket label facing up and align it with the rectangular part at the bottom of the chamber, ensuring that the washer is flush with the chamber base; b. Then, pipette 47 μL of the sample at 37 °C from the previous step into the middle of the rubber ring on the gasket, avoiding the generation of bubbles, and invert the chip onto the gasket; c. Next, cover the chamber lid and tighten the knob; d. Place each assembled device into the rotating rack of the incubator, take a balanced chamber, rotate the hybridization chamber vertically to moisten the slide, and evaluate the fluidity of the bubbles. e. Set the rotation speed of the hybridization rotator to 20 rpm and hybridize at 67 °C for 22 hours.

[0130] c. Chip cleaning: After hybridization, take out the chip at room temperature and place it in Wash Solution 1 (reagent from the Agilent kit), set the shaking speed to 250 rpm, and shake and clean at room temperature for 5 minutes; then use Wash Solution 2 (reagent from the Agilent kit), set the shaking speed to 200 rpm, and shake and clean at 39 °C for 1 minute. Finally, remove the liquid on the chip surface and scan within 4 hours.

[0131] 3. Signal Detection and Data Processing

[0132] (1) Chip fluorescence result scanning and feature extraction: Use the Agilent chip scanner for scanning to obtain the chip fluorescence feature data in tiff format. Perform dual-channel feature extraction based on different red and green stainings to obtain the probe signal feature data table.

[0133] (2) Data quality detection: Perform quality detection on the obtained data. If a) all negative probe signals are below the 100 threshold, it proves that no detection is made. b) All global quality control probe signals are above the 100 threshold. Then the data is considered qualified.

[0134] (3) Pathogen detection determination: For any pathogen, if both of the following conditions are met simultaneously: a) The probe signal value ≥ 700, then it is considered that the probe is detected. b) The number of detected probes ≥ 17, then it is considered that the pathogen is detected as positive.

[0135] Table 4 Pathogen detection results of Example 4

[0136]

[0137]

[0138] Explanation of Table 4: - indicates no detection

[0139] Example 5

[0140] This example verifies the accuracy of the method for detecting soil-borne pathogens using gene chips.

[0141] To verify the accuracy of the method for detecting soil-borne pathogens using gene chips in Example 4 of the present invention, the inventor divided the samples in Example 4 into three parts, and took two of them for amplicon sequencing and whole-genome sequencing respectively. The accuracy differences between the gene chip detection method and the common amplicon and whole-genome methods were compared.

[0142] The amplicon sequencing process is as follows:

[0143] (1) Add 25 μL of TaKaRa Taq version 2.0, 1 μL of forward primer (ITS1 TCCGTAGGTGAACCTGCGG), 1 μL of reverse primer (ITS4 TCCTCCGCTTATTGATATGC), and 22 μL of enzyme-free water to 1 μL of template DNA, for a total of 50 μL PCR system.

[0144] (2) Run the following cycle for the solution prepared above in a T100 PCR instrument produced by BIO-RAD: initially maintain at 98 °C for 2 min, 98 °C for 10 s, 49 °C for 30 s, 72 °C for 60 s, and after 30 cycles, maintain at 72 °C for 5 min.

[0145] (3) Sequence the above PCR products on a SeqStudio sequencer produced by Applied Biosystems.

[0146] (4) Compare the sequencing data with the NCBI NT database to obtain the alignment results of the ITS region.

[0147] The whole-genome sequencing process does not require PCR. Paired-end sequencing is performed using a Nova Seq sequencer produced by Illumina, and the sequencing depth is 5G.

[0148] Table 5 Comparison of the detection of soil-borne pathogens by the gene chip detection method, whole-genome sequencing, and amplicon sequencing detection methods

[0149]

[0150] It can be seen from Table 5 that the effect of the specific probes designed in the invention for detecting 9 soil-borne pathogens is more accurate than the common amplicon sequencing, and can accurately distinguish species that cannot be distinguished by conventional methods. Compared with the whole-genome method, the gene chip designed in the present invention has a shorter detection cycle, lower cost, and avoids complex bioinformatics processing. In summary, the present invention can achieve rapid and accurate detection of soil-borne pathogens, with excellent sensitivity and specificity.

[0151] The resolution of all probes is at the species level, and the coverage of the probe strains is as follows:

[0152] Scientific name of the pathogen Total number of strains at the subspecies level Total number of covered strains Strain coverage rate Verticillium dahliae 46 39 84.78% Botrytis cinerea 56 52 92.86% Fusarium fujikuroi 24 20 83.33% Fusarium tricinctum 6 6 100% Fusarium odoratissimum 7 7 100% Sclerotinia sclerotiorum 29 20 68.96% Alternaria alternata 75 35 46.67% Fusarium boothii 3 3 100% Fusarium avenaceum 13 13 100%

[0153] Finally, it should also be noted that the term "comprise", "include" or any other variant thereof is intended to cover non-exclusive inclusion, such that a process, method, article or apparatus comprising a series of elements not only includes those elements but also includes other elements not expressly listed, or elements inherent to such process, method, article or apparatus.

[0154] Although the preferred embodiments of the present invention have been described, additional changes and modifications can be made to these embodiments by those skilled in the art once they learn of the basic creative concept. Therefore, the appended claims are intended to be construed to include the preferred embodiments as well as all changes and modifications falling within the scope of the present invention.

[0155] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention is also intended to include these modifications and variations.

Claims

1. A detection device for plant pathogenic microorganisms, characterized in that, The detection device contains a specific gene probe set for plant pathogenic microorganisms, and the plant pathogenic microorganisms include at least one of Alternaria alternata, Botrytis cinerea, Fusarium avenaceum, Fusarium boothii, Fusarium fujikuroi, Fusarium odoratissimum, Fusarium tricinctum, Sclerotinia sclerotiorum, and Verticillium dahliae; The specific gene probe set for Alternaria alternata contains 50 oligonucleotide probes, and their nucleotide sequences are shown in SEQ ID NO.1 to 50 respectively; The specific gene probe set for Botrytis cinerea contains 50 oligonucleotide probes, and their nucleotide sequences are shown in SEQ ID NO.51 to 100 respectively; The specific gene probe set for Fusarium avenaceum contains 50 oligonucleotide probes, and their nucleotide sequences are shown in SEQ ID NO.101 to 150 respectively; The specific gene probe set for Fusarium boothii contains 50 oligonucleotide probes, and their nucleotide sequences are shown in SEQ ID NO.151 to 200 respectively; The specific gene probe set for Fusarium fujikuroi contains 50 oligonucleotide probes, and their nucleotide sequences are shown in SEQ ID NO.201 to 250 respectively; The specific gene probe set for Fusarium odoratissimum contains 50 oligonucleotide probes, and their nucleotide sequences are shown in SEQ ID NO.251 to 300 respectively; The specific gene probe set for Fusarium tricinctum contains 50 oligonucleotide probes, and their nucleotide sequences are shown in SEQ ID NO.301 to 350 respectively; The specific gene probe set for Sclerotinia sclerotiorum contains 50 oligonucleotide probes, and their nucleotide sequences are shown in SEQ ID NO.351 to 400 respectively; The specific gene probe set for Verticillium dahliae contains 50 oligonucleotide probes, and their nucleotide sequences are shown in SEQ ID NO.401 to 450 respectively.

2. The detection device for plant pathogenic microorganisms according to claim 1, wherein, The detection device contains negative control probes, global quality control probes, and built-in probes; The nucleotide sequence of the negative control probe is shown in SEQ ID NO.451, and the nucleotide sequence of the global quality control probe is shown in SEQ ID NO.452; The built-in probes include pos probes and neg probes.

3. The detection device for plant pathogenic microorganisms according to claim 2, characterized in that, The detection device is a gene chip, and the gene chip includes a solid-phase carrier, and the specific gene probe set, the negative control probe, the global quality control probe, and the built-in probe are all fixed on the solid-phase carrier.

4. The detection device for plant pathogenic microorganisms according to claim 3, characterized in that, The gene chip includes a microarray of 192 rows × 82 columns, and the specific gene probe set, the negative control probe, the global quality control probe, and the built-in probe are arranged on the microarray in a certain order; In the gene chip, there are a total of 536 repeats of the built-in probe, which are randomly distributed in the microarray; The global quality control probe is repeated 544 times, and the microarray of 192 rows × 82 columns is virtually divided into 4×8 sub-arrays, and the global quality control probe radiates from the center of each sub-array to the surroundings; The negative control probe is repeated 114 times and is distributed on the dividing lines of the 4×8 sub-arrays; The specific gene probe set for plant pathogenic microorganisms includes 50 to 450 oligonucleotide probes, which are repeated once and randomly arranged in the microarray.

5. Use of a detection device for plant pathogenic microorganisms according to any one of claims 1 to 4 in the detection of plant pathogenic microorganisms.

6. Use of a detection device for plant pathogenic microorganisms according to any one of claims 1 to 4 in the detection of soil-borne pathogenic bacteria.