Tgsrs51 gene deleted toxoplasma gondii attenuated strain and application thereof

Abstract

The invention discloses a toxoplasma gondii attenuated strain with deletion of a Tgsrs51 gene and application of the toxoplasma gondii attenuated strain, and belongs to the technical field of gene engineering. A Tgsrs51 gene is deleted in a genome of the toxoplasma gondii attenuated strain; and the ID (Identity) number of the Tgsrs51 gene on a ToxoDB (Database) website is TGME49308840. A Tgsrs51 gene deleted strain of a toxoplasma gondii type II Pru strain is constructed by utilizing a CRISPR-Cas9 technology, and experiments prove that the Tgsrs51 gene deletion can remarkably reduce the invasion efficiency of the toxoplasma gondii Pru strain, the secretion capacity of micronematosome MIC2 and the tachyzoite proliferation rate, lead to in-vitro growth limitation, remarkably improve the survival rate of infected mice and remarkably reduce the number of intracerebral cysts. The invention provides a theoretical basis for researching a molecular mechanism and an immune mechanism of toxoplasma gondii pathopoiesis, and provides a new strategy for prevention and control of toxoplasmosis.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and particularly to a Toxoplasma gondii attenuated virulent strain with Tgsrs51 gene deletion and its application. Background Art

[0002] Toxoplasma gondii is an obligate intracellular parasitic opportunistic pathogen that can infect almost all warm-blooded animals including humans, causing toxoplasmosis. In immunocompetent individuals, Toxoplasma gondii infection usually presents as latent infection, but in immunodeficient populations (such as AIDS patients, organ transplant recipients) and pregnant women, it can lead to severe clinical symptoms such as encephalitis, chorioretinitis, congenital toxoplasmosis, etc., even endangering life.

[0003] Currently, the means for the prevention and control of toxoplasmosis are limited. Although traditional chemical drug treatments (such as sulfonamides, pyrimethamine, etc.) can control acute infections to a certain extent, they have limitations such as the generation of drug resistance, relatively large toxic and side effects, and the inability to eliminate cysts, making it difficult to achieve complete cure. Therefore, the development of safe and effective vaccines has become a key strategy for the prevention of toxoplasmosis.

[0004] Attenuated live vaccines are considered to be one of the most promising vaccine types because they can mimic the natural infection process and induce long-lasting cellular and humoral immune responses in the body. Early studies on attenuated live vaccines mainly relied on natural attenuated strains or attenuated strains obtained by physical or chemical mutagenesis. However, these traditional attenuated strains have the potential risk of virulence reversion, and the immune protection effects are uneven, which limits their wide application in clinical practice. With the rapid development of molecular biology and genetic engineering technology, the research strategy of developing attenuated live vaccines based on gene deletion has gradually become a research hotspot. This strategy obtains attenuated but immunogenic mutant strains by precisely knocking out key genes related to virulence, invasiveness, immune escape, or metabolism in the Toxoplasma gondii genome. Compared with traditional attenuation methods, gene deletion attenuated live vaccines have the following significant advantages: First, the attenuation mechanism is clear, and the degree of attenuation can be precisely controlled by gene editing technology; second, they have high genetic stability, reducing the risk of virulence reversion; third, they are convenient for molecular labeling, which is conducive to the differential diagnosis between vaccine strains and wild strains.

[0005] In recent years, a series of important progress has been made in the research on live attenuated vaccines of Toxoplasma gondii with gene deletion. Researchers have successively conducted deletion studies on multiple candidate genes, such as dense granule protein genes (GRA), rhoptry protein genes (ROP), apicoplast-related genes, metabolism-related genes, etc. SRSs are a superfamily of proteins with different developmental expressions and antigenicities. In the tachyzoite, bradyzoite, and cyst stages of Toxoplasma gondii, SRSs show significant stage specificity. Different surface antigen proteins of Toxoplasma gondii each undertake unique biological functions. However, the current research on SRSs proteins in live attenuated vaccines of Toxoplasma gondii with gene deletion is relatively scarce. Summary of the Invention

[0006] The purpose of the present invention is to provide a Toxoplasma gondii attenuated strain with Tgsrs51 gene deletion and its application to solve the problems existing in the above-mentioned prior art. The present invention constructs a Tgsrs51 gene deletion strain of Toxoplasma gondii type II Pru strain by using CRISPR-Cas9 technology. It has been experimentally confirmed that the deletion of the Tgsrs51 gene can significantly reduce the invasion efficiency, microneme MIC2 secretion ability, and tachyzoite proliferation rate of the Toxoplasma gondii Pru strain, resulting in limited growth in vitro, and significantly improving the survival rate of infected mice and significantly reducing the number of cerebral cysts. The present invention provides a theoretical basis for studying the molecular mechanism and immune mechanism of Toxoplasma gondii pathogenesis and provides a new strategy for the prevention and control of toxoplasmosis.

[0007] To achieve the above purpose, the present invention provides the following solutions:

[0008] The present invention provides a Toxoplasma gondii attenuated strain with the Tgsrs51 gene, wherein the Tgsrs51 gene is deleted in the genome of the Toxoplasma gondii attenuated strain; the ID number of the Tgsrs51 gene on the ToxoDB website is TGME49_308840.

[0009] The present invention also provides a method for constructing the above-mentioned Toxoplasma gondii attenuated strain, which knocks out the Tgsrs51 gene in the Toxoplasma gondii genome by CRISPR-Cas9-mediated homologous recombination technology.

[0010] Optionally, the Toxoplasma gondii includes type II Pru strain.

[0011] The present invention also provides the application of the above-mentioned Toxoplasma gondii attenuated strain in the preparation of a live attenuated vaccine against Toxoplasma gondii.

[0012] The present invention also provides a live attenuated vaccine against Toxoplasma gondii, which is prepared from the above-mentioned Toxoplasma gondii attenuated strain.

[0013] Furthermore, the live attenuated vaccine against Toxoplasma gondii further contains a vaccine adjuvant.

[0014] The present invention also provides the application of the above-mentioned live attenuated Toxoplasma gondii vaccine in the preparation of a drug for preventing and controlling toxoplasmosis.

[0015] The present invention discloses the following technical effects:

[0016] The present invention constructs a Tgsrs51 gene deletion strain (PruΔsrs51) of Toxoplasma gondii type II Pru strain by using CRISPR-Cas9 technology. Through experiments such as plaque, invasion, microneme MIC2 secretion and proliferation, it is confirmed that the deletion of the Tgsrs51 gene can significantly reduce the invasion efficiency, microneme secretion ability and tachyzoite proliferation rate of Toxoplasma gondii, resulting in limited growth in vitro, but has no effect on its egress and bradyzoite transformation. Further in vivo experiments show that the survival rate of mice infected with PruΔsrs51 is significantly increased, and the number of cysts in the brain is reduced. After the deletion of this gene, the acute virulence can be reduced by weakening the invasion and proliferation ability of the parasite, and the chronic infection process can be inhibited.

[0017] The present invention confirms that the Tgsrs51 gene is one of the virulence genes of Toxoplasma gondii, and the SRS51 protein plays a core role in the pathogenesis of Toxoplasma gondii, and it has good application prospects for live attenuated vaccines. The present invention provides a theoretical basis for studying the molecular mechanism and immune mechanism of Toxoplasma gondii pathogenesis, and provides a new strategy for the prevention and control of toxoplasmosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0019] Figure 1 Schematic diagram of the principle of Tgsrs51 gene knockout in Toxoplasma gondii Pru strain;

[0020] Figure 2 Identification result diagram of Tgsrs51 gene knockout strain (PruΔsrs51) of Toxoplasma gondii Pru strain;

[0021] Figure 3 Detection result diagram of plaque experiment of wild-type Pru strain and Tgsrs51 gene knockout strain (PruΔsrs51) of Toxoplasma gondii Pru strain; among them, A is the plaque diagram; B is the statistical chart of plaque area;

[0022] Figure 4 Statistical chart of invasion rate of wild-type Pru strain and Tgsrs51 gene knockout strain (PruΔsrs51) of Toxoplasma gondii Pru strain;

[0023] Figure 5Graph showing the detection results of microneme secretion of the wild-type Pru strain and the Tgsrs51 gene knockout strain (PruΔsrs51) of Toxoplasma gondii Pru strain;

[0024] Figure 6 Statistical graph of the parasitophorous vacuole (PV) ratio of the wild-type Pru strain and the Tgsrs51 gene knockout strain (PruΔsrs51) of Toxoplasma gondii Pru strain;

[0025] Figure 7 Statistical graph of the egress rate of the wild-type Pru strain and the Tgsrs51 gene knockout strain (PruΔsrs51) of Toxoplasma gondii Pru strain;

[0026] Figure 8 Graph showing the detection results of the conversion rate of bradyzoites in vitro of the wild-type Pru strain and the Tgsrs51 gene knockout strain (PruΔsrs51) of Toxoplasma gondii Pru strain; among them, A is the statistical graph of the conversion rate under the conditions of pH 7.4 and 5% CO2; B is the statistical graph of the conversion rate under the conditions of pH 8.2 and no CO2;

[0027] Figure 9 Survival curve graph of mice infected with the wild-type Pru strain and the Tgsrs51 gene knockout strain (PruΔsrs51) of Toxoplasma gondii Pru strain; among them, A - E are respectively the survival curve graphs of mice injected with 5×10 5 、5×10 4 、5×10 3 、5×10 2 and 2×10 2 tachyzoites;

[0028] Figure 10 Statistical graph of the number of cerebral cysts in surviving mice infected with the wild-type Pru strain and the Tgsrs51 gene knockout strain (PruΔsrs51) of Toxoplasma gondii Pru strain. Detailed implementation manners

[0029] The various exemplary implementation manners of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0030] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0031] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although only preferred methods and materials are described in this invention, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of this invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the said documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0032] Without departing from the scope or spirit of the present invention, various modifications and variations can be made to the specific embodiments of the description of the present invention, which are obvious to those skilled in the art. Other embodiments obtained from the description of the present invention are obvious to those skilled in the art. The description and examples of the present invention are merely exemplary.

[0033] Regarding "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.

[0034] Example 1

[0035] I. Experimental Materials

[0036] 1. Experimental Instruments

[0037] The main experimental instruments used in this example are shown in Table 1.

[0038] Table 1 Main Experimental Instruments and Source Manufacturers

[0039]

[0040] 2. Experimental Reagents

[0041] The main reagents used in this example are shown in Table 2. All primers used in this example were synthesized by Shanghai Sangon Biotech Co., Ltd., and the antibodies used were provided by Invitrogen (Shanghai) Trading Co., Ltd.

[0042] Table 2 Main Reagents

[0043]

[0044] The main reagents are as follows:

[0045] Solid LB solution: Take 2 g of yeast powder, 4 g of tryptone, 4 g of sodium chloride and 6 g of agar powder, and dissolve them in 400 mL of ddH2O.

[0046] Liquid LB solution: Take 2 g of yeast powder, 4 g of tryptone and 4 g of sodium chloride, dissolve them in 400 mL of ddH2O, and autoclave for later use.

[0047] 1×PBS buffer: Dissolve 1 tablet of PBS tablets in 100 mL of autoclaved ddH2O and dissolve completely.

[0048] 2% DMEM: Add 5 mL of HEPES solution, 600 µL of penicillin-streptomycin, and 10 mL of fetal bovine serum to 500 mL of high-glucose DMEM medium, mix well and set aside.

[0049] 1×TritonX-100: Dissolve 400 µL of TritonX-100 stock solution in 400 mL of autoclaved 1×PBS buffer.

[0050] 5% BSA solution: Dissolve 5 g of BSA powder in 100 mL of PBS solution.

[0051] 5% blocking solution: Prepare according to the ratio of 1 g of skim milk powder dissolved in 20 mL of 1×TBST solution.

[0052] 3. Experimental animals

[0053] The mice used in this example are all 6-8 week-old female Kunming mice, purchased from the Experimental Animal Center of Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences.

[0054] II. Experimental methods

[0055] 1. Cultivation of cells and strains

[0056] The type II Pru strain and human foreskin fibroblast cells (HFF cells) used in this example were provided by the research team on important zoonotic diseases of livestock and poultry at Lanzhou Veterinary Research Institute.

[0057] The subculture of HFF cells uses DMEM medium supplemented with 10% fetal bovine serum. The subculture of Toxoplasma gondii uses DMEM medium containing 1% fetal bovine serum. The above cultures are all carried out in an incubator at 37°C and 5% CO2.

[0058] When a large number of parasitophorous vacuoles (PVs) filled with Toxoplasma gondii tachyzoites appear in the infected HFF cells, use a cell scraper to collect the cells, and use a 27-gauge needle to break the cells to release the tachyzoites inside. Subsequently, use a microporous filter with a pore size of 5 µm to filter out the tachyzoites, and collect pure and vigorous tachyzoites. Put these tachyzoites into new blank HFF cells for subculture and set aside.

[0059] 2. Construction, screening and identification of the Tgsrs51 gene knockout strain of Toxoplasma gondii Pru strain

[0060] The principle of knocking out the Tgsrs51 gene in the Toxoplasma gondii Pru strain is asFigure 1 As shown. By using the principle of CRISPR-Cas9-mediated homologous recombination to construct gene knockout parasite strains, it mainly includes the following key steps: First, construct a knockout plasmid; Second, construct a drug screening plasmid, which needs to contain the 3' and 5' homologous arms of the Tgsrs51 gene. The fragment composed of these homologous arms can be used to screen out the required recombinants after electroporation. The specific construction process is as follows:

[0061] (1)Obtaining the Tgsrs51 gene and SgRNA

[0062] Obtain the gene information of the Toxoplasma gondii SRS51 protein in the Toxoplasma gondii database ToxoDB (http: / / toxodb.org). Enter the ID number (TGME49_308840) of the Tgsrs51 gene on the ToxoDB website to obtain the gene sequence. Design SgRNA with the E-CRISPR website and select the SgRNA with the highest score. The sequence is as follows:

[0063] SgRNA(5'→3'): GGAGACCAGCAACCACGCGG (SEQ ID NO.1).

[0064] (2)Construction of the knockout plasmid

[0065] Using the pSAG1-Cas9-U6-sgUPRT plasmid as a template, select the SgRNA-F and SgRNA-R primer pairs of the Tgsrs51 gene, and use PCR amplification technology to replace the SgUPRT in the plasmid with the SgRNA of the Tgsrs51 gene. The specific primer sequences are as follows:

[0066] SgRNA-F(5'→3'): GGAGACCAGCAACCACGCGGGTTTTAGAGCTAGAAATAGC (SEQ IDNO.2);

[0067] SgRNA-R(5'→3'): AACTTGACATCCCCATTTAC (SEQ ID NO.3).

[0068] The PCR reaction system is: 2×Phanta Max Buffer 25 µL, Phanta Max Super-FidelityDNAPolymerase 1 µL, dNTP Mix (10 mM) 1 µL, upstream primer 2.5 µL, downstream primer 2.5 µL, template plasmid 2µL, deionized water 16 µL.

[0069] The PCR reaction conditions were as follows: 95°C for 3 min; 95°C for 30 s, 56°C for 30 s, 72°C for 3 min 30 s, for 30 cycles; 72°C for 10 min; hold at 16°C.

[0070] Perform DpnI digestion on the obtained PCR product. The digestion reaction system was: 8 μL of PCR product, 1 μL of DpnI, and 1 μL of CutSmart. The digestion reaction conditions were: 37°C, water bath overnight.

[0071] Perform a cyclization reaction on the digested product. The cyclization reaction system was: 2 μL of digested product, 0.5 μL of KLD, and 2.5 μL of KLDBuffer. The cyclization reaction conditions were: 25°C, 2 h.

[0072] Transform the cyclized product into DH5α competent cells. The specific transformation process was as follows: First, perform ice bath treatment, then heat shock, then place it on ice again and let it stand still, then perform shaking culture, then spread the bacterial liquid on the plate, after overnight culture, select single colonies for expansion culture. Use primer pairs JD-F and JD-R to perform PCR identification on the cultured bacterial liquid. The bacterial liquid identified as positive was subjected to sequencing confirmation, and the knockout plasmid was extracted. The specific primer sequences were as follows:

[0073] JD-F: GGAGACCAGCAACCACGCGG (SEQ ID NO.4);

[0074] JD-R: AACTTGACATCCCCATTTAC (SEQ ID NO.5).

[0075] The PCR amplification reaction system was: 13 μL of Premix ExTaq, 5 μL of bacterial liquid, 1 μL of JD-F, 1 μL of JD-R, and 5 μL of deionized water.

[0076] The PCR amplification reaction conditions were: 95°C for 3 min; 95°C for 30 s, 56°C for 30 s, 72°C for 1 min, for 30 cycles; 72°C for 10 min, hold at 16°C.

[0077] (3)Construction and amplification of the DHFR template containing the homologous arm of the Tgsrs51 gene

[0078] Using the genomic DNA of the type II Pru strain as a template, the U5 homologous arm fragment was amplified using the primer pair TGME49_308840-U5-F and TGME49_308840-U5-R, and the U3 homologous arm fragment was amplified using the primer pair U3-308840-Gbison-F and U3-308840-Gbison-R; using the pUC19 plasmid as a template, the pUC19 vector fragment was amplified using the primer pair pUC19-F and pUC19-R; using the pUPRT-DHFR-D plasmid as a template, the DHFR fragment was amplified using the primer pair DHFR-F and DHFR-R. The specific primer sequences are as follows:

[0079] TGME49_308840-U5-F:

[0080] GGTTTTCCCAGTCACGACGTTGAGGCACTCGTCTCACATTTC (SEQ ID NO.6);

[0081] TGME49_308840-U5-R:

[0082] GGATTTACAGCCTGGCGAAGCTTGTGTTTGTTGTCAGTCATCGC (SEQ ID NO.7);

[0083] U3-308840-Gbison-F:

[0084] CTATGCACTTGCAGGATGAATTCACGAGCAGTAGTCCCAGTTCT (SEQ ID NO.8);

[0085] U3-308840-Gbison-R:

[0086] GAGCGGATAACAATTTCACACGTCTTTGTTTCCCGTATCC (SEQ ID NO.9);

[0087] pUC19-F: TGTGAAATTGTTATCCGCTC (SEQ ID NO.10);

[0088] pUC19-R: AACGTCGTGACTGGGAAAACC (SEQ ID NO.11);

[0089] DHFR-F: AAGCTTCGCCAGGCTGTAAATCC (SEQ ID NO.12);

[0090] DHFR-R: GAATTCATCCTGCAAGTGCATAG (SEQ ID NO.13).

[0091] The PCR reaction amplification system for homologous arm fragments is as follows: 25 μL of 2×Phanta Max Buffer, 1 μL of Phanta Max Super-Fidelity DNA Polymerase, 1 μL of dNTP Mix (10 mM each), 2.5 μL of upstream primer, 2.5 μL of downstream primer, 2 μL of template plasmid, and 16 μL of deionized water.

[0092] The PCR amplification system for the pUC19 vector fragment and the DHFR fragment is as follows: 25 μL of 2×Phanta Max Buffer, 1 μL of Phanta Max Super-Fidelity DNA Polymerase, 1 μL of dNTP Mix (10 mM each), 2.5 μL of upstream primer, 2.5 μL of downstream primer, 2 μL of template plasmid, and 16 μL of deionized water.

[0093] After the PCR amplification is completed, electrophoresis operations are performed on the homologous arm fragments, the DHFR fragment, and the pUC19 vector fragment respectively, and the products are recovered from the gel. The gel-extracted products are subjected to restriction enzyme digestion. The restriction enzyme digestion reaction system is as follows: 2 μL of the U5 homologous arm fragment, 2 μL of the U3 homologous arm fragment, 2 μL of the DHFR fragment, 2 μL of the pUC19 fragment, 1 μL of DpnI, and 1 μL of rCutSmart. The restriction enzyme digestion reaction conditions are: 37°C, water bath overnight.

[0094] The above restriction enzyme digestion products are seamlessly cloned using the ClonExpress MultiS one-step cloning method. The seamless cloning system is as follows: 8 μL of the above restriction enzyme digestion products, 4 μL of 5×CE Multis Buffer, 2 μL of Exnase Multi, and 6 μL of deionized water. The seamless cloning conditions are: 37°C, 2 h. The ligation products are transformed according to the DH5α competent cell transformation method in step (2), positive plasmids are screened out, and after large-scale culture and plasmid extraction, they are stored at -20°C. Using this positive plasmid as a template, the 5′UTR-DHFR-3′UTR homologous arm fragment of the Tgsrs51 gene is amplified using the TGME49_308840-KZ-F and TGME49_308840-KZ-R primers. The PCR amplification fragment is recovered from the gel and stored at -20°C for later use. The specific primer sequences are as follows:

[0095] TGME49_308840-KZ-F(5'→3'): GAGGCACTCGTCTCACATTTC (SEQ ID NO.14);

[0096] TGME49_308840-KZ-F(5'→3'): CGTCTTTGTTTCCCGTATCC (SEQ ID NO.15).

[0097] (4) Preparation before electroporation

[0098] Wash the electroporation cuvette in advance, then mix 50 µg of the knockout plasmid with 25 µg of the 5′UTR-DHFR-3′UTR homologous arm fragment of the Tgsrs51 gene, and place it in a 60 °C water bath for 30 min for sterilization. At the same time, preheat the electroporation solution in a 37 °C incubator, and change the medium in the HFF cell bottle originally containing 10% FBS to DMEM medium containing 1% FBS.

[0099] (5) Electroporation of tachyzoites of Toxoplasma gondii type II Pru strain

[0100] a. Collect the freshly released tachyzoites into a sterile centrifuge tube, centrifuge at 1500 r / min for 10 min, and discard the supernatant.

[0101] b. Add 5 mL of preheated electroporation solution to the pellet, gently pipette to mix, to wash away the residual medium on the tachyzoites, centrifuge at 1200 r / min for 10 min, and discard the supernatant.

[0102] c. Add 500 µL of preheated electroporation solution to the pellet, gently pipette to mix, and then pipette 250 µL and add it to the pre-sterilized plasmid and fragment mixture.

[0103] d. Gently pipette to mix and then transfer it to a pre-dried electroporation cuvette, taking care not to have air bubbles, otherwise it will affect the electroporation effect.

[0104] e. To ensure voltage stability, first set the electroporator to a voltage of 1600 V and perform two no-load electroporation operations. Subsequently, place the electroporation cuvette into the electroporator for electroporation, and perform electroporation 3 times.

[0105] f. Transfer the sample in the electroporation cuvette to a cell culture bottle that has been pre-changed with medium and is confluent with HFF cells. After making a mark, place it in an incubator at 37 °C and 5% CO2 for culture.

[0106] (6) Drug screening after electroporation

[0107] Observe the parasite plaques 32 - 36 hours after electroporation. When there are parasite plaques, continue the culture and screening by adding 3 mM pyrimethamine at a ratio of 1:1000. After 2 - 3 generations, resistant tachyzoites can be obtained.

[0108] (7)Screening of monoclonal parasite strains

[0109] After the pyrimethamine - resistant Toxoplasma gondii tachyzoites completely escape from HFF cells, count them using a hemocytometer and dilute to 1×10³ cells / mL. Using the limited dilution method, inoculate 1, 2, 5, and 10 cells per well into a 96 - well plate filled with confluent HFF cells for culture. After 8 - 9 days, screen for monoclonal parasite plaques under the microscope and extract the DNA of the monoclonal parasite strains.

[0110] (8)Identification of the Tgsrs51 gene - knockout strain of Toxoplasma gondii Pru strain

[0111] According to the Tgsrs51 gene sequence, design a pair of PCR2 knockout - identification primers with a product size of 400 - 600 bp upstream and downstream of its SgRNA sequence; design a pair of PCR1 identification primers with a product size of 1300 - 1500 bp upstream of the 5' - end homologous arm; design a pair of PCR3 identification primers with a product size of 1300 - 1500 bp downstream of the 3' - end homologous arm. The specific primer sequences are as follows:

[0112] TGME49_308840 - PCR2 - F: GTATGGAAGACTTTTGACACGC (SEQ ID NO.16);

[0113] TGME49_308840 - PCR2 - R: CCTGAGTACATCCGACAATGAAT (SEQ ID NO.17);

[0114] TGME49_308840 - PCR1 - F: AACGAGTGACGAAAACGGAACTGG (SEQ ID NO.18);

[0115] TGME49_308840 - PCR1 - R: GCCAAAGTAGAAAGGAATTAGCAT (SEQ ID NO.19);

[0116] TGME49_308840 - PCR3 - F: TGACGCAGATGTGCGTGTATCCAC (SEQ ID NO.20);

[0117] TGME49_308840 - PCR3 - R: ACCGTTTGCTCCCCTTCTACCATT (SEQ ID NO.21).

[0118] The PCR reaction system for identifying the knockout of the Tgsrs51 gene is as follows: 13 μL of Premix Ex Taq, 1 μL of the upstream primer, 1 μL of the downstream primer, 5 μL of the template (DNA), and 5 μL of deionized water.

[0119] The PCR reaction conditions for identifying the knockout of the Tgsrs51 gene are as follows: 95°C for 3 min; 95°C for 30 s, 56°C for 30 s, 72°C for PCR2 (1 min) / PCR1, PCR3 (1 min 30 s), for 30 cycles; 72°C for 10 min, and hold at 16°C.

[0120] The parasite strain with successful knockout of the Tgsrs51 gene was named PruΔsrs51.

[0121] 3. Biological function analysis of the Tgsrs51 gene knockout strain (PruΔsrs51) of Toxoplasma gondii Pru strain

[0122] (1) Plaque assay

[0123] a. When the tachyzoites of the wild-type Toxoplasma gondii Pru and the PruΔsrs51 knockout strain were about to escape from the HFF cells, they were scraped off with a cell scraper and broken with a 27G needle to maintain better viability of the parasite strain.

[0124] b. The tachyzoites were counted using a hemocytometer and diluted with DMEM containing 1% fetal bovine serum. The tachyzoites of the knockout strain and the wild strain were seeded into a 12-well plate filled with confluent HFF cells at 200 per well and cultured in an incubator at 37°C and 5% CO2 for 8 d.

[0125] c. After 8 d, observe under a microscope. When a large number of plaques appeared, discard the original medium. Slowly add 1 mL of pre-warmed PBS at 37°C along the side wall of each well (if the cell state is not good, do not wash to avoid flushing the cells). Gently shake the 12-well plate and carefully discard the PBS. Repeat 3 times and then add 500 μL of 4% tissue cell fixative for fixation.

[0126] d. After 30 min of fixation, pour out the fixative and add 500 μL of the prepared 0.5% crystal violet staining solution, and let it stand at room temperature.

[0127] e. After 30 min of staining, pour out the staining solution, wash 3 times with PBS, and invert the 12-well plate to air dry. Subsequently, take pictures with a camera and analyze the pictures with ImageJ software and Prism9 to determine the changes in plaque area and size.

[0128] (2) Invasion assay

[0129] a. When the tachyzoites of Toxoplasma gondii Pru wild type and PruΔsrs51 knockout strain are about to escape from HFF cells, scrape them off with a cell scraper and break them with a 27G needle to maintain better activity of the parasite strain.

[0130] b. Then count the tachyzoites using a hemocytometer and dilute them with DMEM containing 1% fetal bovine serum. Inoculate the tachyzoites of the knockout strain and the wild strain into a 12-well plate filled with confluent HFF cells at a density of 2×10 6 per well and culture them in an incubator at 37 °C and 5% CO2 for 1 h.

[0131] c. Pour out the culture medium and slowly add 500 µL of 4% tissue cell fixative along the side wall of the well for fixation at room temperature.

[0132] d. After 30 min, pour out the fixative, wash 3 times with PBS, add 160 µL of diluted mouse anti-SAG (1:1000), and incubate in the dark in an incubator at 37 °C.

[0133] e. After 2 h, wash 3 times with PBS, add 160 µL of diluted Alexa Fluor 594 goat anti-mouse IgG (H+L) (1:500), and incubate in the dark in an incubator at 37 °C.

[0134] f. After 1 h, wash 3 times with PBS, add 400 µL of 0.1% Triton-100 for permeabilization in the dark at room temperature.

[0135] g. After 30 min, wash 3 times with PBS, add 200 µL of diluted rabbit anti-IMC1 (1:500), and incubate in the dark in a constant temperature incubator at 37 °C.

[0136] h. After 2 h, wash 3 times with PBS, add 160 µL of diluted Alexa Fluor 488 goat anti-rabbit IgG (H+L) (1:500), and incubate in the dark in an incubator at 37 °C.

[0137] i. After 90 min, wash 3 times with PBS, then place it under a confocal fluorescence microscope to observe and record the number of green and red parasites. All Toxoplasma gondii are green, and the non-invasive ones are red. Based on this, calculate the invasion rate of Toxoplasma gondii (invasion rate = number of invaded Toxoplasma gondii / total number of Toxoplasma gondii × 100%).

[0138] (3)Microneme secretion experiment

[0139] a. When the tachyzoites of Toxoplasma gondii Pru wild type and PruΔsrs51 knockout strain are about to escape from HFF cells, scrape them off with a cell scraper and break them with a 27G needle to maintain better viability of the parasite strain.

[0140] b. Transfer 2×10 7 tachyzoites into a 15 mL centrifuge tube, centrifuge at 1500 r / min for 10 min, and discard the supernatant.

[0141] c. Resuspend the tachyzoite pellet with 1 mL of DMEM medium. Take 200 µL of tachyzoites and set up an induction group and a control group. Induction group: Add 200 µL of pre-warmed (to 37 °C) DMEM culture medium (containing 2% absolute ethanol ETOH, 6% FBS) to the tachyzoites, and gently pipette to mix evenly. Control group: Directly add 200 µL of DMEM culture medium to 200 µL of the tachyzoite suspension and vortex to mix evenly.

[0142] d. Incubate the two groups of samples in an incubator at 37 °C and 5% CO2 for 5 min, immediately transfer to an ice bath for cooling for 5 min, and then centrifuge at 1500×g for 10 min, and discard the supernatant.

[0143] e. Add 100 μL of RIPA lysis buffer, 1 µL of protease inhibitor, and 1 µL of EDTA to the tachyzoite pellet, lyse on ice for 1 h, and invert and mix 3 times during this period. After lysis, centrifuge at 1500 r / min for 10 min, take 100 µL of the supernatant and 100 µL of the supernatant before lysis, add 33.3 µL of 4× protein loading buffer, and heat at 100 °C for 10 min to prepare the samples.

[0144] f. Load 20 µL per well of the 10% protein gel for SDS-PAGE electrophoresis. Run the stacking gel at 80 V and the separating gel at 120 V.

[0145] g. Add 20 µL of the sample to the prepared 10% protein gel wells for SDS-PAGE electrophoresis. Run the stacking gel at 80V and the separating gel at 120 V.

[0146] h. After electrophoresis, cut a PVDF membrane of the corresponding size according to the size of the protein gel, and use a semi-dry transfer device to transfer the membrane for 10 min to transfer the protein gel to the PVDF membrane.

[0147] i. Quickly place the transferred PVDF membrane into 5% non-fat milk powder (prepared with 1×PBST) for blocking for 2 h. After blocking, wash with 1×PBST 3 times for 15 min each time. After washing, dilute the rabbit anti-Toxoplasma gondii ALD internal reference antibody and rabbit anti-MIC2 antibody with 1% non-fat milk powder at 1:500 and 1:1000 respectively, and incubate overnight at 4 °C.

[0148] j. After incubating the PVDF membrane with the primary antibody, wash it 3 times in PBST for 15 min each time. Then add goat anti-rabbit IgG (1:5000) to the antibody incubation box and incubate it on a shaker at room temperature for 1.5 h.

[0149] k. After the incubation time of the secondary antibody ends, quickly wash it 3 times with 1×PBST for 10 min each time.

[0150] l. After the washing is completed, add the pre-prepared ECL luminescent solution, place it in the dark for a period of time, and then develop it in a gel imager.

[0151] (4)Proliferation assay

[0152] a. When the tachyzoites of Toxoplasma gondii Pru wild type and PruΔsrs51 knockout strain are about to escape from HFF cells, scrape them off with a cell scraper and break them with a 27 G needle to maintain better activity of the parasite strain.

[0153] b. Count the Toxoplasma gondii tachyzoites using a hemocytometer and dilute them with DMEM containing 1% fetal bovine serum. Seed 2×10 5 wild-type and knockout tachyzoites per well into a 12-well plate filled with confluent HFF cells and culture them in an incubator at 37 °C and 5% CO2 for 36 h.

[0154] c. After discarding the original medium, slowly add 500 µL of 4% tissue cell fixative along the side wall of each well and fix it at room temperature for 30 min.

[0155] d. Discard the fixative, wash it 3 times with PBS, and then add 400 µL of 0.1% Triton-100 to permeabilize it at room temperature for 30 min.

[0156] e. Discard the permeabilization solution, wash it 3 times with PBS, and then add 200 µL of diluted rabbit anti-IMC1 (1:500), and incubate it in an incubator at 37 °C for 2 h.

[0157] f. Wash it 3 times with PBS, add 160 µL of Alexa Fluor594 goat anti-rabbit IgG(H+L) diluted 1:500, and incubate it in an incubator at 37 °C for 1.5 h.

[0158] g. Wash it 3 times with PBS again, select 100 PVs under a fluorescence microscope, and count the PV ratios of 2, 4, 8, 16, and 32 tachyzoites in each PV (taking 2 tachyzoites as an example, the ratio of 2 tachyzoites in a PV = the number of PVs with 2 tachyzoites among all selected PVs / the number of selected PVs used).

[0159] (5)Egress assay

[0160] a. When the tachyzoites of wild-type Toxoplasma gondii Pru and PruΔsrs51 knockout strain are about to escape from HFF cells, scrape them off with a cell scraper and break them with a 27 G needle to maintain better viability of the parasite strain.

[0161] b. Count the tachyzoites of Toxoplasma gondii using a hemocytometer and dilute them with DMEM containing 1% fetal bovine serum. Inoculate 2×10 4 tachyzoites of the wild strain and knockout strain per well into a 12-well plate filled with confluent HFF cells and culture them in an incubator at 37 °C and 5% CO2 for 48 h.

[0162] c. When it is observed under the microscope that there are 8 or more tachyzoites in a large number of PVs, pour out the original culture medium, add the pre-warmed culture medium containing 3 µM calcium ionophore A23187, and add the fixative after seeing the tachyzoites escape under the microscope.

[0163] d. After fixation, count the number of PVs that have escaped and those that have not escaped through the microscope. At least 100 PVs are counted and finally the escape probability is calculated (escape rate = number of escaped PVs / total number of PVs).

[0164] (6) In vitro bradyzoite transformation assay

[0165] a. When the tachyzoites of wild-type Toxoplasma gondii Pru and PruΔsrs51 knockout strain are about to escape from HFF cells, scrape them off with a cell scraper and break them with a 27 G needle to maintain better viability of the parasite strain.

[0166] b. Count the tachyzoites of Toxoplasma gondii using a hemocytometer and dilute them with DMEM containing 1% fetal bovine serum at pH 7.4. Inoculate 1×10 3 tachyzoites of the wild strain and knockout strain per confocal dish filled with confluent HFF cells (set two groups) and culture them in an incubator at 37 °C and 5% CO2 for 4 h.

[0167] c. Pour out the original culture medium from one of the groups. Add 2 mL of induction medium of DMEM containing 1% fetal bovine serum at pH 8.2 and continue to culture in a cell incubator at 37 °C without CO2 for 48 h (change the medium every 24 h), and continue to culture the other group in the original incubator for 36 h.

[0168] d. After the culture is completed, discard the normal and induced culture media respectively and add 500 µL of fixative.

[0169] e. After 30 min, wash 4 times with PBS and add 400 µL of 0.1% Triton-100 for penetration.

[0170] f. After 30 min, wash 4 times with PBS. Add 160 µL of pre-diluted rabbit anti-IMC1 (1:500), and place it in an incubator at 37 °C for incubation in the dark.

[0171] g. After 2 h, wash 4 times with PBS, add 160 µL of pre-diluted Alexa Fluor 594 goat anti-rabbit IgG(H+L) (1:500) and DBA (1:500), and place it in an incubator at 37 °C for incubation in the dark.

[0172] h. After washing 4 times with PBS for 90 min, add 1 mL of PBS. Under a laser confocal microscope, count the number of PVs stained and not stained with DBA, and calculate the conversion rate (conversion rate = number of PVs stained with DBA / total number of PVs).

[0173] (7)Mouse virulence test

[0174] a. Raise 60 female mice aged 6 - 8 weeks in advance for 1 week and group them, with 6 mice in each group, for a total of 10 groups.

[0175] b. When the tachyzoites of Toxoplasma gondii Pru wild type and PruΔsrs51 knockout strain are about to escape from HFF cells, scrape them off with a cell scraper and break them with a 27 G needle to maintain the better activity of the parasite strain.

[0176] c. Use a hemocytometer to count the Toxoplasma gondii tachyzoites, and dilute the tachyzoites with DMEM containing 1% fetal bovine serum.

[0177] d. Inject the tachyzoites of Pru wild strain and knockout strain intraperitoneally into each mouse at doses of 5×10 5 、5×10 4 、5×10 3 、5×10 2 and 2×10 2 tachyzoites respectively for grouping.

[0178] e. To ensure accurate infection numbers, carry out plaque assays with the same number of tachyzoites synchronously as a parallel control.

[0179] f. During the experiment, observe the mice every day and record their disease onset and death time in detail.

[0180] (8)Detection of the number of cerebral cysts

[0181] The mice that survived 30 days after infection in (7) were sacrificed, their brain tissues were removed and ground, 1 mL of PBS was added to make a homogenate, and it was transferred to a 1.5 mL EP tube. After gently pipetting and mixing, 10 μL of the mixed homogenate was pipetted onto a glass slide, covered with a coverslip, and the number of cerebral cysts was recorded under a microscope. After repeating the experiment in 4 groups and calculating the average value, the number of cerebral cysts per mouse was calculated according to the dilution factor (number of cerebral cysts in a mouse = number of cerebral cysts in 10 μL × dilution factor).

[0182] (9) Statistical analysis

[0183] All experiments were set with 3 biological replicates. The data were analyzed using GraphPad Prism 9.5, and the results were expressed as mean ± standard error of the mean (SEM). The differences between two groups were analyzed using Student's t-test, and for multiple groups, one-way ANOVA was used. Significance annotation: *P ≤ 0.05, **P < 0.01, ***P < 0.001, ***P < 0.0001 (ns: P > 0.05).

[0184] III. Test results

[0185] 1. Identification of the Tgsrs51 gene knockout strain (PruΔsrs51) of Toxoplasma gondii Pru strain

[0186] As Figure 2 shown, the results showed that a band of about 500 bp could be amplified by PCR2 for the wild-type Pru strain, while no band was amplified for the knockout strain PruΔsrs51. Because the DHFR fragment was inserted into the knockout strain, the results showed that PCR1 and PCR3 could amplify bands of 1700 bp and 1400 bp in PruΔsrs51, and no band could be amplified for the wild strain Pru because the DHFR fragment was not inserted. Thus, it could be verified that the construction of the Tgsrs51 gene deletion strain was successful.

[0187] 2. Plaque assay

[0188] As Figure 3 shown, the results showed that the plaque area formed by PruΔsrs51 was significantly lower than that of the wild-type Pru strain (****, P < 0.0001), indicating that knocking out the Tgsrs51 gene would inhibit the in vitro growth ability of Toxoplasma gondii.

[0189] 3. Invasion assay

[0190] To explore which specific link in intracellular growth was affected by the deletion of the Tgsrs51 gene, an invasion assay was carried out. As Figure 4As shown, the results showed that there was a significant difference in the invasion rate between PruΔsrs51 and the wild-type Pru strain (**, P < 0.01), indicating that knocking out the Tgsrs51 gene would affect the invasion ability of Toxoplasma gondii.

[0191] 4. Effect on the secretion of microneme MIC2

[0192] To verify the effect of Tgsrs51 gene deletion on the invasion ability of Toxoplasma gondii, the secretion of microneme protein MIC2 of the wild-type Pru strain and PruΔsrs51 was detected. As Figure 5 shown, the results showed that the deletion of the Tgsrs51 gene would reduce the secretion of microneme protein MIC2 of Toxoplasma gondii.

[0193] 5. Proliferation assay

[0194] To further explore the role of the Tgsrs51 gene in the proliferation of Toxoplasma gondii, a proliferation experiment was carried out. As Figure 6 shown, the results showed that the deletion of the Tgsrs51 gene would affect the proliferation ability of Toxoplasma gondii tachyzoites in cells. Compared with the wild-type Pru strain, the deletion of the Tgsrs51 gene would significantly reduce the proliferation efficiency of Toxoplasma gondii (**, P < 0.01).

[0195] 6. Egress assay

[0196] To explore the effect of Tgsrs51 gene deletion on the egress ability of Toxoplasma gondii Pru wild-type strain tachyzoites, the numbers of egressed and non-egressed PVs were calculated. As Figure 7 shown, the results showed that the deletion of the Tgsrs51 gene had no significant effect on the egress ability of Pru tachyzoites (P > 0.05), and the egress rate reached over 90%.

[0197] 7. In vitro bradyzoite conversion assay

[0198] To study whether the deletion of the Tgsrs51 gene would affect the in vitro bradyzoite conversion ability of Toxoplasma gondii, an in vitro bradyzoite conversion assay was carried out. As Figure 8 shown, the results showed that under the conditions of pH 7.4 and 5% CO2, the deletion of the Tgsrs51 gene had no effect on the conversion ability of Toxoplasma gondii tachyzoites to bradyzoites (P > 0.05, Figure 8 in A). Under the conditions of pH 8.2 and no CO2, the deletion of the Tgsrs51 gene also had no effect on the conversion ability of Toxoplasma gondii tachyzoites to bradyzoites (P > 0.05, Figure 8 in B).

[0199] 8. Mouse virulence assay

[0200] To study whether the deletion of the Tgsrs51 gene affects the virulence of the Toxoplasma gondii type II strain Pru strain, a virulence test on mice was conducted. As Figure 9 shown, the results showed that there were significant differences in the survival time of mice infected with 5×10 5 , 5×10 4 , 5×10 3 , 5×10 2 and 2×10 2 Pru and PruΔsrs51 tachyzoites (P<0.05).

[0201] 9. Detection of the number of cerebral cysts

[0202] To evaluate the effect of the deletion of the Tgsrs51 gene on chronic infection, four groups of mice infected with 5×10 2 and 2×10 2 wild-type and knockout strains were sacrificed 30 days later. By microscopic examination of the ground brain tissue, the cysts in the brain tissue were counted. As Figure 10 shown, the results showed that the number of cerebral cysts formed by the Tgsrs51 gene deletion strain was significantly reduced compared with the wild-type Pru strain (P<0.001 and P<0.05).

[0203] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A Toxoplasma gondii attenuated virulent strain with Tgsrs51 gene deletion, characterized in that, The Tgsrs51 gene is deleted in the genome of the attenuated Toxoplasma gondii strain; the ID number of the Tgsrs51 gene on the ToxoDB website is TGME49_308840.

2. The construction method of the Toxoplasma gondii attenuated virulent strain according to claim 1, characterized in that, The Tgsrs51 gene in the Toxoplasma gondii genome was knocked out by CRISPR-Cas9-mediated homologous recombination technology.

3. The construction method according to claim 2, characterized in that, The Toxoplasma gondii includes the type II Pru strain.

4. Use of the attenuated Toxoplasma gondii strain according to claim 1 in the preparation of an attenuated live vaccine against Toxoplasma gondii.

5. A live attenuated Toxoplasma gondii vaccine, characterized in that, The attenuated live vaccine against Toxoplasma gondii is prepared from the attenuated Toxoplasma gondii strain according to claim 1.

6. The attenuated live vaccine against Toxoplasma gondii according to claim 5, wherein, The attenuated live vaccine against Toxoplasma gondii further contains a vaccine adjuvant.

7. Use of the attenuated live vaccine against Toxoplasma gondii according to claim 5 or 6 in the preparation of a drug for preventing and controlling toxoplasmosis.

Images