Novel engineering strain for synthesizing beta-hydroxy beta-methylbutyric acid

Abstract

The invention provides a recombinant strain for synthesizing HMB, application of the recombinant strain, and a method for performing whole-cell catalytic synthesis of HMB by using the strain. According to the recombinant strain, genes such as fadR, FabF, FabH, iclR and frdA are knocked out, and genes such as fadD, fadL, atoSC, aceA, aceB, maeA and maeB are enhanced or inserted, so that a strain capable of producing HMB by taking glucose and fatty acid as raw materials is obtained. The strain has the prospect of green, efficient and industrial production of HMB by utilizing the capability of synthesizing HMB.

Description

Technical Field

[0001] The present invention relates to the technical fields of gene editing, genetically recombined editing of microbial strains, synthetic biology, and whole-cell microbial catalysis. Specifically, it relates to a recombinant strain for generating HMB and a preparation method thereof. Background Art

[0002] β-hydroxy-β-methylbutyric acid (HMB) is an important metabolite of L-leucine in mammals, which can change the balance of protein metabolism during the growth of new muscle tissue and has an anti-catabolic effect. HMB has been widely used as an animal feed additive, a human sports nutrition supplement, and a dietary food, and is expected to play an important role in cancer treatment. It can also be used for clinical treatment of muscle wasting diseases such as tumors and AIDS. The traditional method for producing HMB is chemical synthesis, but this method has problems such as toxic organic substances and multi-stage reactions, which does not conform to the concept of sustainable development.

[0003] In the prior art, a biological production process using β-methylbutyric acid (MBA) as a substrate and Galactomyces reessii as a cell factory has been developed, but this method has disadvantages such as high raw material and energy consumption, high cost, and complex operation.

[0004] Therefore, there is an urgent need in the prior art to develop a green biosynthetic pathway for HMB with high production efficiency. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a stable genetically recombined strain, which can prepare β-hydroxy-β-methylbutyric acid (HMB) with high conversion rate, low cost, and few side reactions through whole-cell catalysis.

[0006] According to an exemplary embodiment of the present disclosure, the present disclosure provides a recombinant Escherichia coli for synthesizing β-hydroxy-β-methylbutyric acid HMB, which includes deletion, knockout, or inhibitory expression of the following gene clusters: fatty acid metabolism regulatory factor gene fadR, β-ketoacyl-ACP synthase II gene fabF, β-ketoacyl-ACP synthase III gene fabH, glyoxylate pathway inhibitor gene iclR, and fumarate reductase flavoprotein A subunit gene frdA;

[0007] And it includes enhancement or exogenous insertion of the following gene clusters: acyl-CoA synthetase gene fadD, long-chain fatty acid transporter gene fadL, short-chain fatty acid degradation regulatory gene cluster atoSC, isocitrate lyase gene aceA, malate synthase gene aceB, Escherichia coli malate dehydrogenase genes maeA and maeB.

[0008] Optionally or alternatively, the recombinant Escherichia coli further comprises the following modifications:

[0009] Deletion, knockout or inhibitory expression of the NAD(P) transhydrogenase sthA gene and the branched-chain amino acid aminotransferase gene ilvE; and

[0010] Enhancement or exogenous insertion of the leucine dehydrogenase gene leuDH, the α-ketoisocaproate dioxygenase gene kicd, the ketoacid reductoisomerase gene ilvC, the dihydroxyacid dehydratase gene ilvD, the 2-isopropylmalate synthase gene leuA, and the acetolactate synthase genes ilvBN.

[0011] Optionally or alternatively, the recombinant Escherichia coli further comprises the following modifications:

[0012] Deletion, knockout or inhibitory expression of the NADH-dependent D-lactate dehydrogenase gene ldhA, the quinone-dependent D-lactate dehydrogenase gene dld, the L-lactate dehydrogenase gene lldD, the pyruvate oxidase gene poxB, and the pyruvate formate-lyase gene pflB.

[0013] According to another aspect of the present disclosure, a method for generating β-hydroxy-β-methylbutyric acid HMB is provided, comprising: fermenting to produce HMB using the recombinant Escherichia coli described in any one of the foregoing.

[0014] Optionally or alternatively, the recombinant Escherichia coli ferments using fatty acids and glucose as substrates to produce HMB; preferably, the fatty acids include saturated fatty acids such as stearic acid (C18), palmitic acid (C16), myristic acid (C14), lauric acid (C12), capric acid (C10), caprylic acid (C8) or hexanoic acid (C6); also include unsaturated fatty acids, such as oleic acid (C18), linoleic acid (C18) and linolenic acid (C18); or include triglycerides mainly composed of fatty acids, such as soybean oil, peanut oil, palm oil and olive oil, or contain oil-containing waste such as gutter oil, etc.

[0015] Optionally or alternatively, a polyoxyethylene ether Brij58 emulsifier is also added during the fermentation of the recombinant Escherichia coli.

[0016] According to another aspect of the present disclosure, a method for preparing a recombinant Escherichia coli capable of synthesizing β-hydroxy-β-methylbutyric acid HMB is provided, comprising:

[0017] (1) Deletion, knockout or inhibitory expression: of the fatty acid metabolism regulatory factor gene fadR, the β-ketoacyl-ACP synthase II gene fabF, the β-ketoacyl-ACP synthase III gene fabH, the glyoxylate pathway inhibitor gene iclR, and the fumarate reductase flavoprotein A subunit gene frdA; and

[0018] (2) Enhancement or exogenous insertion: fatty acyl-CoA synthetase gene fadD, long-chain fatty acid transporter gene fadL, short-chain fatty acid degradation regulatory gene cluster atoSC, isocitrate lyase gene aceA, malate synthase gene aceB, Escherichia coli malate dehydrogenase genes maeA and maeB.

[0019] Optionally or alternatively, the method further comprises:

[0020] Deletion, knockout or inhibitory expression: NAD(P) transhydrogenase sthA gene and branched-chain amino acid aminotransferase gene ilvE; and

[0021] Enhancement or exogenous insertion: leucine dehydrogenase gene leuDH, α-ketoisocaproic acid dioxygenase gene kicd, keto acid reductoisomerase gene ilvC, dihydroxy acid dehydratase gene ilvD, 2-isopropylmalate synthase gene leuA, acetolactate synthase genes ilvBN.

[0022] Optionally or alternatively, the method further comprises:

[0023] Deletion, knockout or inhibitory expression: NADH-dependent D-lactate dehydrogenase gene ldhA, quinone-dependent D-lactate dehydrogenase gene dld, L-lactate dehydrogenase gene lldD, pyruvate oxidase gene poxB, and pyruvate formate-lyase gene pflB.

[0024] According to another aspect of the present disclosure, there is provided the use of the strain according to any one of the foregoing in the production of β-hydroxy-β-methylbutyric acid HMB.

[0025] The beneficial technical effects achieved by the present invention are as follows:

[0026] The present invention has developed a completely new novel HMB production route based on microbial fermentation. This method can use inexpensive fatty acids and glucose as substrates, and utilize microbial fermentation to directly synthesize high-purity HMB from scratch, with high conversion rate, low cost, and few side reactions. Specific Embodiments

[0027] Definitions

[0028] Unless otherwise defined or clearly indicated by the context, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art.

[0029] Throughout this specification and the appended claims, the words "comprise" and "include" and variations thereof shall be construed inclusively. That is, these words are intended to express the possibility of including other elements or integers not specifically recited, where the context allows.

[0030] The article "a / an" is used herein to refer to one or more than one (i.e., one or at least one) of the grammatical object of the article. For example, "an element" can mean one element or more than one element. When a noun (e.g., compound, additive, etc.) is mentioned in the singular form, the plural form is intended to be included. Thus, when referring to a particular part (e.g., "gene"), unless otherwise specified, this means "at least one" of that gene, e.g., "at least one gene".

[0031] Unless otherwise clearly indicated, the various embodiments of the invention described herein can be combined crosswise.

[0032] The term "carbon source" refers to a source of carbon, preferably a carbon-containing compound or molecule, including sugars, glycerol, fatty acids, etc.

[0033] The term "cell" refers to a eukaryotic organism or a prokaryotic organism, preferably existing as a single cell. In the present invention, the cell can be recombinant Escherichia coli. That is, the recombinant cell is selected from the group of cells of the genus consisting of Escherichia coli.

[0034] As used herein, the terms "recombinant" / "engineered" (e.g., referring to "recombinant Escherichia coli", "recombinant cell", "recombinant microorganism" and / or "recombinant strain") can refer to a cell, microorganism or strain containing a nucleic acid as a result of one or more genetic modifications. Briefly, the cell, microorganism or strain contains a different combination of nucleic acids from one or more of its parents (any of them). To construct a recombinant cell, microorganism or strain, one or more recombinant DNA techniques and / or one or more additional mutagenesis techniques can be used. For example, recombinant Escherichia coli and / or recombinant Escherichia coli cells can contain a nucleic acid that is not present in the corresponding wild-type Escherichia coli and / or cells, and this nucleic acid has been introduced into the Escherichia coli or Escherichia coli cells using recombinant DNA techniques (i.e., transgenic Escherichia coli and / or cells), or the nucleic acid that is not present in the wild-type Escherichia coli and / or cells is the result of one or more mutations (e.g., using recombinant DNA techniques or another mutagenesis technique such as UV irradiation) in a nucleic acid sequence (such as a gene encoding a wild-type polypeptide) that is present in the wild-type Escherichia coli and / or Escherichia coli cells. In addition, the term "recombinant" can appropriately refer to, for example, a cell, microorganism or strain from which a nucleic acid sequence has been removed using recombinant DNA techniques.

[0035] In this text, recombinant Escherichia coli that contains or has a certain activity is understood to mean that the recombinant Escherichia coli can contain one or more nucleic acid sequences encoding a protein with this activity. Thus, it is allowed for the recombinant Escherichia coli to functionally express this protein or enzyme.

[0036] The term "functionally express" means that there is functional transcription of the relevant nucleic acid sequence, allowing the nucleic acid sequence to actually be transcribed, for example resulting in the synthesis of a protein.

[0037] As used herein, the term "transgenic" (e.g., when referring to "transgenic Escherichia coli" and / or "transgenic cells") refers respectively to such Escherichia coli and / or cells that contain nucleic acids that are not naturally present in the Escherichia coli and / or cells and have been introduced into the Escherichia coli and / or cells using, for example, recombinant DNA technology, such as recombinant yeast and / or cells.

[0038] As used herein with respect to a protein or polypeptide, the term "mutation" means that compared to the wild-type or naturally occurring protein or polypeptide sequence, at least one amino acid has been replaced by a different amino acid, inserted into the amino acid sequence, or deleted from the amino acid sequence. The replacement, insertion, or deletion of amino acids can be achieved, for example, via mutagenesis of the nucleic acids encoding these amino acids. Mutagenesis is a method well known in the art and includes, for example, site-directed mutagenesis by means of PCR or via oligonucleotide-mediated mutagenesis, as described in the following reference: Sambrook et al., Molecular Cloning - A Laboratory Manual, 2nd Edition, Volumes 1 - 3 (1989), published by Cold Spring Harbor Publishing.

[0039] As used herein with respect to a gene, the term "mutation" means that compared to the wild-type or naturally occurring nucleic acid sequence, at least one nucleotide in the nucleic acid sequence of the gene or its regulatory sequence has been replaced by a different nucleotide, inserted into the nucleic acid sequence, or deleted from the nucleic acid sequence. The replacement, insertion, or deletion of amino acids can be achieved, for example, via mutagenesis, resulting in, for example, the transcription of a protein sequence with a qualitatively or quantitatively altered function or the knockout of the gene. In the context of the present invention, "altered gene" has the same meaning as a mutant gene.

[0040] As used herein, the term "gene" either refers to a nucleic acid sequence that can be transcribed into mRNA and then translated into a protein. A gene encoding a certain protein refers to one or more nucleic acid sequences encoding this protein.

[0041] As used herein, the terms "nucleic acid" or "nucleotide" refer to monomeric units in a polymer of deoxyribonucleotides or ribonucleotides (i.e., polynucleotides) in single-stranded or double-stranded form, and unless otherwise restricted, encompass known analogs having the essential properties of natural nucleotides, since they hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides (e.g., peptide nucleic acids). For example, a certain enzyme defined by a nucleotide sequence encoding the enzyme includes (unless otherwise restricted) nucleotide sequences that hybridize to a reference nucleotide sequence encoding the enzyme. Polynucleotides can be full-length or subsequences of native or heterologous structural or regulatory genes. Unless otherwise indicated, the term includes reference to a specified sequence as well as its complementary sequence. Thus, DNA or RNA having a backbone modified for reasons of stability or otherwise is a polynucleotide as contemplated herein. In addition, DNA or RNA containing rare bases (such as inosine) or modified bases (such as tritylated bases) (to name just two examples) are polynucleotides as used herein. It will be understood that a wide variety of modifications have been made to DNA and RNA for many useful purposes known to those of skill in the art. The term polynucleotide as used herein includes such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells (especially including simple and complex cells).

[0042] The terms "nucleotide sequence" and "nucleic acid sequence" are used interchangeably herein. An example of a nucleic acid sequence is a DNA sequence.

[0043] The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to, for example, a polymer of amino acid residues displayed by an amino acid sequence. These terms apply to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids, as well as to naturally occurring amino acid polymers. The essential property of such analogs of naturally occurring amino acids is that when incorporated into a protein, the protein is specifically reactive with antibodies raised against the same protein consisting entirely of naturally occurring amino acids. The terms "polypeptide", "peptide" and "protein" also include modifications including, but not limited to, glycosylation, lipid attachment, sulfation, γ-carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation.

[0044] The term "enzyme" as used herein refers to a protein having catalytic function. In cases where a protein catalyzes a biological reaction, the terms "protein" and "enzyme" may be used interchangeably herein. When an enzyme is referred to by reference to the Enzyme Commission (EC), the EC is such a classification where enzymes are classified or can be classified according to the enzyme nomenclature provided by the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology (NC-IUBMB), which can be found at http: / / www.chem.qmul.ac.uk / iubmb / enzyme / . Other suitable enzymes that are not (yet) classified in the designated classes but can be so classified are intended to be included.

[0045] If a protein or nucleic acid sequence (such as a gene) is referred to herein by reference to an accession number, unless otherwise specified, the number is specifically used to refer to the protein or nucleic acid sequence (gene) having the sequence that can be found via www.ncbi.nlm.nih.gov / (available as of October 1, 2020).

[0046] Each nucleic acid sequence encoding a polypeptide herein also includes any conservatively modified variants thereof. By reference to the genetic code, this includes, which describes every possible silent variation of nucleic acids. The term "conservatively modified variant" applies to both amino acid and nucleic acid sequences. With respect to a particular nucleic acid sequence, conservatively modified variants are those nucleic acids that, due to the degeneracy of the genetic code, encode the same amino acid sequence or a conservatively modified variant of the amino acid sequence. The term "degeneracy of the genetic code" refers to the fact that a large number of functionally identical nucleic acids encode any given protein. For example, the codons GCA, GCC, GCG, and GCU all encode the amino acid alanine. Thus, at every position where a codon specifies alanine, the codon can be changed to any of the corresponding codons described without changing the encoded polypeptide. Such nucleic acid variations are "silent variations" and represent one type of conservatively modified variation.

[0047] As used herein, a "functional homolog" (or simply "homolog") of a polypeptide and / or amino acid sequence having a specific sequence (e.g., "SEQ ID NO:X") or of a certain gene refers to a polypeptide and / or amino acid sequence that includes the said specific sequence, or to a nucleic acid sequence that includes the polypeptide and / or amino acid sequence encoding the said specific sequence, provided that one or more amino acids are mutated, substituted, deleted, added, and / or inserted, and the polypeptide has (qualitatively) the same enzymatic function for substrate conversion.

[0048] As used herein, a "functional homolog" (or simply "homolog") of a polynucleotide and / or nucleic acid sequence having a specific sequence (e.g., "SEQ ID NO:X") refers to a polynucleotide and / or nucleic acid sequence that contains the said specific sequence, provided that one or more nucleic acids are mutated, substituted, deleted, added, and / or inserted, and the polynucleotide encodes a polypeptide sequence having (qualitatively) the same enzymatic function for substrate conversion. With respect to nucleic acid sequences, the term functional homolog is intended to include nucleic acid sequences that differ from another nucleic acid sequence due to the degeneracy of the genetic code and encode the same polypeptide sequence.

[0049] Sequence identity is defined herein as the relationship between two or more amino acid (polypeptide or protein) sequences or between two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. Generally, sequence identity or similarity is compared over the entire length of the sequences being compared. In the art, "identity" also means the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by matches between strings of such sequences.

[0050] When exhibiting a certain level of similarity, amino acid or nucleotide sequences are said to be homologous. The fact that two sequences are homologous indicates a common evolutionary origin. Whether two homologous sequences are more closely related or more distantly related is indicated by the "percentage of identity" or "percentage of similarity", which are high or low, respectively. Although controversial, the terms "level of homology" or "percentage of homology" are often used interchangeably to indicate the "percentage of identity" or "percentage of similarity". The comparison of sequences and the determination of the percentage of identity between two sequences can be accomplished using mathematical algorithms. Those skilled in the art will be aware of the fact that several different computer programs are available for aligning two sequences and determining the homology between the two sequences (Kruskal et al., "An overview of sequence comparison: Time warps, string edits, and macromolecules", ["Sequence comparison overview: Time warps, string edits, and macromolecules"], (1983), Society for Industrial and Applied Mathematics (SIAM) [Industrial and Applied Mathematics Society (SIAM)], Volume 25, Number 2, pp. 201-237 and the handbook edited by D. Sankoff and J. B. Kruskal, "Time warps, string edits and macromolecules: the theory and practice of sequence comparison", ["Time warps, string edits, and macromolecules: Theory and practice of sequence comparison"], (1983), pp. 1-44, published by Addison-Wesley Publishing Company, Massachusetts USA [Addison-Wesley Publishing Company, Massachusetts, USA]).

[0051] The Needleman and Wunsch algorithm can be used to align two sequences to determine the percentage identity between two amino acid sequences. (Needleman et al., "A General Method Applicable to the Search for Similarities in the Amino Acid Sequence of Two Proteins" (1970) J. Mol. Biol. Vol. 48, pp. 443-453). This algorithm aligns amino acid sequences as well as nucleotide sequences. The Needleman-Wunsch algorithm has been implemented in the computer program NEEDLE. For the purposes of the present invention, the NEEDLE program from the EMBOSS package (version 2.8.0 or higher, see Rice et al., "EMBOSS: The European Molecular Biology Open Software Suite", (2000), Trends in Genetics Vol. 16, (6) pp. 276-277, http: / / emboss.bioinformatics.nl / ) is used. For protein sequences, EBLOSUM62 is used as the substitution matrix. For nucleotide sequences, EDNAFULL is used. Other matrices can be specified. Optional parameters for amino acid sequence alignment are a gap opening penalty of 10 and a gap extension penalty of 0.5. Those skilled in the art will understand that all these different parameters will produce slightly different results, but the overall percentage identity of the two sequences does not change significantly when different algorithms are used.)

[0052] Homology or identity is the percentage of identical matches over the total alignment region between two complete sequences including any gaps or extensions. Homology or identity between two aligned sequences is calculated as follows: the number of corresponding positions in the alignment showing the same amino acid in both sequences divided by the total length of the alignment including gaps. Identity as defined herein can be obtained from NEEDLE and is labeled "IDENTITY" in the output of the program.)

[0053] The homology or identity between two aligned sequences is calculated as follows: the number of corresponding positions in the alignment that show the same amino acid in the two sequences is divided by the total length of the alignment after subtracting the total number of gaps in the alignment. Identity as defined herein can be obtained from NEEDLE using the NOBRIEF option and is labeled "longest-identity" in the output of the program.

[0054] Variants of the nucleotide or amino acid sequences disclosed herein can also be defined as nucleotide or amino acid sequences that have one or more mutations, substitutions, insertions, and / or deletions compared to the nucleotide or amino acid sequences specifically disclosed herein (e.g., in the sequence listing).

[0055] Optionally, when determining the degree of amino acid similarity, one of ordinary skill in the art can also consider so-called "conservative" amino acid substitutions, which will be clear to one of ordinary skill in the art. Conservative amino acid substitutions refer to the interchangeability of residues with similar side chains. For example, a group of amino acids with aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids with aliphatic-hydroxy side chains is serine and threonine; a group of amino acids with amide-containing side chains is asparagine and glutamine; a group of amino acids with aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids with basic side chains is lysine, arginine, and histidine; and a group of amino acids with sulfur-containing side chains is cysteine and methionine. In one embodiment, the group of conservative amino acid substitutions is: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine. A substitution variant of an amino acid sequence disclosed herein is a variant in which at least one residue in the disclosed sequence has been removed and a different residue has been inserted in its place. Preferably, the amino acid change is conservative. In one embodiment, the conservative substitutions for each naturally occurring amino acid are as follows: Ala to Ser; Arg to Lys; Asn to Gln or His; Asp to Glu; Cys to Ser or Ala; Gln to Asn; Glu to Asp; Gly to Pro; His to Asn or Gln; Ile to Leu or Val; Leu to Ile or Val; Lys to Arg; Gln or Glu; Met to Leu or Ile; Phe to Met, Leu, or Tyr; Ser to Thr; Thr to Ser; Trp to Tyr; Tyr to Trp or Phe; and Val to Ile or Leu.

[0056] The nucleotide sequences of the present invention can also be defined by their ability to hybridize, under moderate hybridization conditions or preferably under stringent hybridization conditions, to portions of the specific nucleotide sequences disclosed herein. Stringent hybridization conditions are defined herein as conditions that allow nucleic acid sequences of at least about 25 nucleotides, preferably about 50, 75, or 100 nucleotides, and most preferably about 200 or more nucleotides to hybridize in a solution containing about 1 M salt (preferably 6x SSC or any other solution with equivalent ionic strength) at a temperature of about 65°C, and to be washed in a solution containing about 0.1 M or less salt (preferably 0.2x SSC or any other solution with equivalent ionic strength) at 65°C. Preferably, the hybridization is carried out overnight, i.e., for at least 10 hours; and preferably, the washing is carried out for at least one hour, with the washing solution being replaced at least twice. These conditions will generally allow specific hybridization of sequences having about 90% or higher sequence identity. Moderate conditions are defined herein as conditions that allow nucleic acid sequences of at least 50 nucleotides, preferably about 200 or more nucleotides, to hybridize in a solution containing about 1 M salt (preferably 6x SSC or any other solution with equivalent ionic strength) at a temperature of about 45°C, and to be washed in a solution containing about 1 M salt (preferably 6x SSC or any other solution with equivalent ionic strength) at room temperature. Preferably, the hybridization is carried out overnight, i.e., for at least 10 hours; and preferably, the washing is carried out for at least one hour, with the washing solution being replaced at least twice. These conditions will generally allow specific hybridization of sequences having up to 50% sequence identity. Those skilled in the art will be able to modify these hybridization conditions in order to specifically identify sequences with identities varying between 50% and 90%.

[0057] "Expression" refers to the transcription of a gene into structural RNA (rRNA, tRNA) or messenger RNA (mRNA), followed by translation into a protein.

[0058] "Overexpression" refers to the expression of a gene (correspondingly a nucleic acid sequence) by a recombinant cell that exceeds its expression in the corresponding wild-type cell. Such overexpression can be arranged, for example, by increasing the transcription frequency of one or more nucleic acid sequences, e.g., by operably linking the nucleic acid sequence to a promoter that is functional in the recombinant cell; and / or by increasing the copy number of a certain nucleic acid sequence.

[0059] The term "upregulation" and its variants refer to the process by which a cell increases the amount of a cellular component such as RNA or protein. Such upregulation can occur in response to or be caused by genetic modification.

[0060] The term "pathway" or "metabolic pathway" is understood herein to mean a series of chemical reactions in a cell that build and break down molecules.

[0061] A nucleic acid sequence (i.e., polynucleotide) or a protein (i.e., polypeptide) can be native or heterologous to the genome of a host cell.

[0062] "Native," "homologous," or "endogenous" with respect to a host cell means that a nucleic acid sequence is indeed naturally present in the genome of the host cell, or that a protein is naturally produced by that cell. The terms "native," "homologous," and "endogenous" are used interchangeably herein.

[0063] As used herein, "heterologous" or "exogenous" can refer to a nucleic acid sequence or a protein. For example, with respect to a host cell, "heterologous" can refer to a polynucleotide that is not naturally present in the genome of the host cell in that manner, or a polypeptide or protein that is not naturally produced by that cell in that manner. A heterologous nucleic acid sequence is a nucleic acid derived from a foreign species, or if from the same species, has been substantially modified in composition and / or genomic locus by deliberate human intervention relative to its natural form. For example, a promoter operably linked to a native structural gene is from a species different from the species from which the structural gene is derived, or if from the same species, one or both have been substantially modified relative to their original forms. A heterologous protein can be derived from a foreign species, or if from the same species, has been substantially modified relative to its original form by deliberate human intervention. That is, heterologous protein expression involves the expression of a protein that is not naturally expressed in that manner in a host cell. The term "heterologous expression" refers to the expression of a heterologous nucleic acid in a host cell. The expression of heterologous proteins in eukaryotic host cell systems such as E. coli is well known to those skilled in the art. A polynucleotide comprising a nucleic acid sequence encoding a certain protein or enzyme having a specific activity can be expressed in such eukaryotic systems. In some embodiments, transformed / transfected cells can be used as an expression system for expressing an enzyme. The expression of heterologous proteins in E. coli is well known. A publication by Cold Spring Harbor Laboratory is a recognized work that describes various methods that can be used to express proteins in E. coli.

[0064] As used herein, a "promoter" is a DNA sequence that directs the transcription of a (structural) gene or other (partial) nucleic acid sequence. Appropriately, the promoter is located in the 5' region of the gene, near the transcription start site of the (structural) gene. The promoter sequence can be constitutive, inducible, or repressible. In one embodiment, no (external) inducer is required.

[0065] As used herein, the term "vector" includes references to both autosomal expression vectors and integration vectors for integration into the chromosome.

[0066] The term "expression vector" refers to a linear or circular DNA molecule that contains a segment encoding a polypeptide of interest, which is under the control of (i.e., operably linked to) additional nucleic acid segments that provide for its transcription. Such additional segments can include promoter and terminator sequences, and can optionally include one or more origins of replication, one or more selectable markers, enhancers, polyadenylation signals, etc. Expression vectors are usually derived from plasmid or viral DNA, or can contain elements of both.

[0067] A "plasmid" refers to an extrachromosomal DNA that replicates autonomously, does not integrate into the genome of a microorganism, and is usually circular in nature.

[0068] As used herein, a "host cell" is understood to be a cell (such as an Escherichia coli cell) that will be transformed with one or more nucleic acid sequences encoding one or more heterologous proteins to construct a transformed cell (also referred to as a recombinant cell). For example, a transformed cell can contain a vector and can support the replication and / or expression of the vector.

[0069] As used herein, "transformation" refers to the insertion of an exogenous polynucleotide into a host cell, regardless of the method used for insertion, such as direct uptake, transduction, f-conjugation, or electroporation. The exogenous polynucleotide can be maintained as a non-integrating vector (e.g., a plasmid), or alternatively can integrate into the host cell genome. As used herein, "transformation" refers to the insertion of an exogenous polynucleotide (i.e., an exogenous nucleic acid sequence) into a host cell, regardless of the method used for insertion, such as direct uptake, transduction, f-conjugation, or electroporation. The exogenous polynucleotide can be maintained as a non-integrating vector (e.g., a plasmid), or alternatively can integrate into the host cell genome.

[0070] The present disclosure will be further described in detail below in conjunction with specific embodiments. The examples given are only for clarifying the present disclosure, rather than limiting the scope of the present disclosure. The experimental methods in the following examples are all conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples can all be obtained from commercial sources unless otherwise specified.

[0071] In the following examples, the strain Escherichia coli BW25113 was purchased from the Escherichia coli Genetic Stock Center CGSC of Yale University, USA.

[0072] In the present invention, the D-lactate dehydrogenase ldhA gene is as shown in eco:b1380 in the KEGG database (https: / / www.genome.jp / kegg / ).

[0073] In the present invention, the quinone-dependent D-lactate dehydrogenase dld gene is as shown in eco:b1380 in the KEGG database.

[0074] In the present invention, the L-lactate dehydrogenase lldD gene is as shown in eco:b3605 in the KEGG database.

[0075] In the present invention, the pyruvate oxidase poxB gene is as shown in eco:b1380 in the KEGG database.

[0076] In the present invention, the pyruvate formate-lyase pflB gene is as shown in eco:b0903 in the KEGG database.

[0077] In the present invention, the leucine dehydrogenase leuDH gene is as shown in ppu:PP_4617 in the KEGG database.

[0078] In the present invention, the 2-isopropylmalate synthase leuA gene is as shown in eco:b0074 in the KEGG database.

[0079] In the present invention, the branched-chain amino acid aminotransferase ilvE gene is as shown in eco:b3770 in the KEGG database.

[0080] In the present invention, the keto-acid reductoisomerase ilvC gene is as shown in eco:b3774 in the KEGG database.

[0081] In the present invention, the acetolactate synthase ilvBN gene is as shown in eco:b0903 in the KEGG database.

[0082] In the present invention, the dihydroxy-acid dehydratase ilvD gene is as shown in eco:b3771 in the KEGG database.

[0083] In the present invention, the fumarate reductase flavoprotein subunit frdA gene is as shown in eco:b4154 in the KEGG database.

[0084] In the present invention, the nucleotide sequence of the fatty acid degradation repressor fadR gene is as shown in Gene ID: 94865 in Gene Bank, and the amino acid sequence of the fatty acid degradation repressor encoded by this gene is as shown in the reference sequence number NP_415705 in NCBI.

[0085] In the present invention, the nucleotide sequence of the fatty acyl-CoA synthetase fadD gene is as shown in Gene ID: 94632 in Gene Bank, and the amino acid sequence of the fatty acyl-CoA synthetase encoded by this gene is as shown in the reference sequence number NP_416319 in NCBI.

[0086] In the present invention, the nucleotide sequence of the long-chain fatty acid transport protein fadL gene is as shown by Gene ID: 946820 in Gene Bank, and the amino acid sequence of the long-chain fatty acid transport protein encoded by this gene is as shown by the reference sequence number NP_416846 in NCBI.

[0087] In the present invention, the nucleotide sequence of the NAD(P) transhydrogenase sthA gene is as shown by Gene ID: 94846 in Gene Bank, and the amino acid sequence of the NAD(P) transhydrogenase encoded by this gene is as shown by the reference sequence number NP_418397 in NCBI.

[0088] In the present invention, the nucleotide sequence of the atoS gene of the short-chain fatty acid degradation regulatory gene cluster is as shown by Gene ID: 949011 (submission date: May 2, 2024) in Gene Bank, and the amino acid sequence of the atoS protein encoded by the atoS gene is as shown by the reference sequence number NP_416723 (submission date: March 9, 2022) in NCBI.

[0089] In the present invention, the nucleotide sequence of the β-ketoacyl-ACP synthase II (3-oxoacyl-[acyl carrier protein] synthase 2) fabF gene is as shown by Gene ID: 946665 (submission date: May 2, 2024) in Gene Bank, and the amino acid sequence of the β-ketoacyl-ACP synthase II encoded by this gene is as shown by the reference sequence number NP_415613 (submission date: March 9, 2022) in NCBI.

[0090] In the present invention, the nucleotide sequence of the β-ketoacyl-ACP synthase III (3-oxoacyl-[acyl carrier protein] synthase 3) fabH gene is as shown by Gene ID: 946003 (submission date: May 2, 2024) in Gene Bank, and the amino acid sequence of the β-ketoacyl-ACP synthase III encoded by this gene is as shown by the reference sequence number NP_415609 (submission date: March 9, 2022) in NCBI.

[0091] In the present invention, the nucleotide sequence of the isocitrate lyase repressor iclR is as shown in Gene ID: 948524 in Gene Bank (submission date: May 2, 2024), and the amino acid sequence of the isocitrate lyase repressor encoded by this gene is as shown in the reference sequence number NP_418442 in NCBI (submission date: March 9, 2022).

[0092] Example 1. Construction of recombinant Escherichia coli FK01-FK14.

[0093] The preparation method of the relevant strains was obtained according to the following steps (1)-(2):

[0094] (1) Starting from Escherichia coli BW25113, the fadR gene, a fatty acid metabolism regulatory factor in this strain, was knocked out to obtain strain FK01.

[0095] The specific steps are as follows:

[0096] (1-a) Preparation of the targeting fragment K01

[0097] The DNA fragment was synthesized by gene synthesis (GenScript): from 5' to 3', it consisted of the following in sequence: fadRup (fragment 21), FRT-Kan-FRT (fragment 1), fadRdown (fragment 22). fadR-1 / fadR-2 were used as primers, and PCR amplification was performed using the gene-synthesized DNA fragment as a template to obtain the targeting fragment K01.

[0098] (1-b) Preparation of the host bacterium containing the pKD46 plasmid

[0099] The pKD46 plasmid (derived from the Escherichia coli Genetic Stock Center CGSC at Yale University, USA) was transformed into Escherichia coli BW25113 by the calcium chloride transformation method. After overnight culture on an LB plate containing ampicillin at 30 °C, colonies were selected to obtain the recombinant Escherichia coli BW25113 / pKD46 containing the plasmid pKD46. After induction with arabinose, BW25113 / pKD46 expressed three recombinant proteins of λ phage, and the host bacterium acquired the ability of homologous recombination. Then, it was prepared into BW25113 / pKD46 competent cells by washing with 10% glycerol.

[0100] (1-c) Homologous recombination

[0101] The targeting fragment K01 prepared in (1 - a) was electrotransformed into the competent cells of BW25113 / pKD46 prepared in (1 - b), and cultured overnight at 37 °C on an LB plate containing kanamycin (concentration: 50 µg / ml). Clones were selected and genomic DNA was extracted. PCR amplification was performed using fadR - 3 / Kan - R as primers for identification. A positive result was obtained when a target band of approximately 1000 bp was amplified. The positive clone was named FK01 - kan. The sequencing analysis results showed that the genomic DNA of FK01 - kan contained the K01 fragment. FK01 - kan was cultured overnight at 42 °C to eliminate the temperature - sensitive plasmid pKD46.

[0102] (1 - d)Elimination of resistance

[0103] The pCP20 plasmid (derived from the E. coli Genetic Stock Center CGSC of Yale University, USA) was transformed into FK01 - kan by the calcium chloride transformation method. It was cultured overnight at 30 °C on an LB plate containing ampicillin, and the FLP recombinase on the pCP20 plasmid was used to eliminate the kanamycin - resistant fragment. It was cultured overnight at 42 °C to eliminate the temperature - sensitive plasmid pCP20.

[0104] (2)Obtaining of strains FK02 to FK17

[0105] In the construction process of each strain in this step, the method completely identical to that in Example 1 (1) was adopted.

[0106] Including the following strain modifications:

[0107] Starting from the strain FK01, the β - ketoacyl - ACP synthase II gene fabF and the β - ketoacyl - ACP synthase III gene fabH in this strain were sequentially knocked out to obtain the FK02 strain and the FK03 strain.

[0108] Starting from the strain FK03, the promoter of the fatty acyl - CoA synthetase gene fadD, the long - chain fatty acid transporter gene fadL, and the promoter of the short - chain fatty acid degradation regulatory gene cluster atoSC in this strain were sequentially replaced with the P119 promoter to obtain the FK04 strain, the FK05 strain, and the FK06 strain.

[0109] Starting from the strain FK06, the glyoxylate pathway inhibitor gene iclR in this strain was replaced with the expression cassette of the Escherichia coli isocitrate lyase gene aceA and the Escherichia coli malate synthase gene aceB to obtain the FK07 strain.

[0110] Starting from the strain FK07, the fumarate reductase flavoprotein A subunit gene frdA in this strain was replaced with the expression cassette of the Escherichia coli malate dehydrogenase genes maeA and maeB to obtain the FK08 strain.

[0111] Starting from strain FK08, the NAD(P) transhydrogenase gene sthA in this strain was replaced with the expression cassettes of the Pseudomonas putida leucine dehydrogenase gene leuDH and the mouse α-ketoisocaproic acid dioxygenase gene kicd to obtain strain FK09.

[0112] Starting from strain FK09, the branched-chain amino acid aminotransferase gene ilvE in this strain was replaced with the expression cassette of the Escherichia coli keto acid reductoisomerase gene ilvC, and at the same time, the promoter of the downstream dihydroxy acid dehydratase gene ilvD was replaced with the P119 promoter to obtain strain FK10.

[0113] Starting from strain FK10, the promoters of the 2-isopropylmalate synthase gene leuA and the acetolactate synthase genes ilvBN in this strain were successively replaced with the P119 promoter to successively obtain strain FK11 and strain FK12.

[0114] Starting from strain FK12, the NADH-dependent D-lactate dehydrogenase gene ldhA, the quinone-dependent D-lactate dehydrogenase gene dld, the L-lactate dehydrogenase gene lldD, the pyruvate oxidase gene poxB, and the pyruvate formate-lyase gene pflB in this strain were knocked out to successively obtain strain FK13, strain FK14, strain FK15, strain FK16, and strain FK17.

[0115] The differences in the construction process of each strain from that in Example 1 (1) were that different starting strains, different targeting fragments, and different primers were used. The specific experimental materials used and the information of the obtained strains are shown in Table 2.

[0116] Table 2. Construction process of FK02 to FK17

[0117]

[0118]

[0119]

[0120] Table 3. Gene editing fragments and sequences of Example 1

[0121] Serial number Fragment number Fragment name Sequence (5'-3') SEQ ID SEQID NO.1 Fragment 1 FRT-Kan-FRT aaatgggaaatttactgagccaatcccattccggggatccgtcgacctgcagttcgaagttcctattctctagaaagtataggaacttcagagcgcttttgaagctcacgctgccgcaagcactcagggcgcaagggctgctaaaggaagcggaacacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcaggggatcaagatctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctaataaggggatcttgaagttcctattccgaagttcctattctctagaaagtataggaacttcgaagcagctccagcctacaaaacatgaatgtcatgaaaatggtccc SEQ ID NO.2 Fragment 2 P119 promoter atggcttgtcatgcttaattgacagctagctcagtcctaggtataatgctagcagggagaccacaacggtttccctctacaaataattttgtttaactttcgcgcgcgtaacaggaggaattaacc SEQ ID NO.3 Fragment 3 TrrnB terminator tattgagaattagaaatttgcctggcggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtctccccatgcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctt SEQ ID NO.4 Fragment 4 RBS aggaggaattaacc SEQ ID NO.5 Fragment 11 aceA atgaaaacccgtacacaacaaattgaagaattacagaaagagtggactcaaccgcgttgggaaggcattactcgcccatacagtgcggaagatgtggtgaaattacgcggttcagtcaatcctgaatgcacgctggcgcaactgggcgcagcgaaaatgtggcgtctgctgcacggtgagtcgaaaaaaggctacatcaacagcctcggcgcactgactggcggtcaggcgctgcaacaggcgaaagcgggtattgaagcagtctatctgtcgggatggcaggtagcggcggacgctaacctggcggccagcatgtatccggatcagtcgctctatccggcaaactcggtgccagctgtggtggagcggatcaacaacaccttccgtcgtgccgatcagatccaatggtccgcgggcattgagccgggcgatccgcgctatgtcgattacttcctgccgatcgttgccgatgcggaagccggttttggcggtgtcctgaatgcctttgaactgatgaaagcgatgattgaagccggtgcagcggcagttcacttcgaagatcagctggcgtcagtgaagaaatgcggtcacatgggcggcaaagttttagtgccaactcaggaagctattcagaaactggtcgcggcgcgtctggcagctgacgtgacgggcgttccaaccctgctggttgcccgtaccgatgctgatgcggcggatctgatcacctccgattgcgacccgtatgacagcgaatttattaccggcgagcgtaccagtgaaggcttcttccgtactcatgcgggcattgagcaagcgatcagccgtggcctggcgtatgcgccatatgctgacctggtctggtgtgaaacctccacgccggatctggaactggcgcgtcgctttgcacaagctatccacgcgaaatatccgggcaaactgctggcttataactgctcgccgtcgttcaactggcagaaaaacctcgacgacaaaactattgccagcttccagcagcagctgtcggatatgggctacaagttccagttcatcaccctggcaggtatccacagcatgtggttcaacatgtttgacctggcaaacgcctatgcccagggcgagggtatgaagcactacgttgagaaagtgcagcagccggaatttgccgccgcgaaagatggctataccttcgtatctcaccagcaggaagtgggtacaggttacttcgataaagtgacgactattattcagggcggcacgtcttcagtcaccgcgctgaccggctccactgaagaatcgcagttctaa SEQ ID NO.6 Fragment 12 aceB atgactgaacaggcaacaacaaccgatgaactggctttcacaaggccgtatggcgagcaggagaagcaaattcttactgccgaagcggtagaatttctgactgagctggtgacgcattttacgccacaacgcaataaacttctggcagcgcgcattcagcagcagcaagatattgataacggaacgttgcctgattttatttcggaaacagcttccattcgcgatgctgattggaaaattcgcgggattcctgcggacttagaagaccgccgcgtagagataactggcccggtagagcgcaagatggtgatcaacgcgctcaacgccaatgtgaaagtctttatggccgatttcgaagattcactggcaccagactggaacaaagtgatcgacgggcaaattaacctgcgtgatgcggttaacggcaccatcagttacaccaatgaagcaggcaaaatttaccagctcaagcccaatccagcggttttgatttgtcgggtacgcggtctgcacttgccggaaaaacatgtcacctggcgtggtgaggcaatccccggcagcctgtttgattttgcgctctatttcttccacaactatcaggcactgttggcaaagggcagtggtccctatttctatctgccgaaaacccagtcctggcaggaagcggcctggtggagcgaagtcttcagctatgcagaagatcgctttaatctgccgcgcggcaccatcaaggcgacgttgctgattgaaacgctgcccgccgtgttccagatggatgaaatccttcacgcgctgcgtgaccatattgttggtctgaactgcggtcgttgggattacatcttcagctatatcaaaacgttgaaaaactatcccgatcgcgtcctgccagacagacaggcagtgacgatggataaaccattcctgaatgcttactcacgcctgttgattaaaacctgccataaacgcggtgcttttgcgatgggcggcatggcggcgtttattccgagcaaagatgaagagcacaataaccaggtgctcaacaaagtaaaagcggataaatcgctggaagccaataacggtcacgatggcacatggatcgctcacccaggccttgcggacacggcaatggcggtattcaacgacattctcggctcccgtaaaaatcagcttgaagtgatgcgcgaacaagacgcgccgattactgccgatcagctgctggcaccttgtgatggtgaacgcaccgaagaaggtatgcgcgccaacattcgcgtggctgtgcagtacatcgaagcgtggatctctggcaacggctgtgtgccgatttatggcctgatggaagatgcggcgacggctgaaatttcccgtacctcgatctggcagtggatccatcatcaaaaaacgttgagcaatggcaaaccggtgaccaaagccttgttccgccagatgctgggcgaagagatgaaagtcattgccagcgaactgggcgaagaacgtttctcccaggggcgttttgacgatgccgcacgcttgatggaacagatcaccacttccgatgagttaattgatttcctgaccctgccaggctaccgcctgttagcgtaa SEQ ID NO.7 Fragment 13 maeA atggaaccaaaaacaaaaaaacagcgttcgctttatatcccttacgctggccctgtactgctggaatttccgttgttgaataaaggcagtgccttcagcatggaagaacgccgtaacttcaacctgctggggttactgccggaagtggtcgaaaccatcgaagaacaagcggaacgagcatggatccagtatcagggattcaaaaccgaaatcgacaaacacatctacctgcgtaacatccaggacactaacgaaaccctcttctaccgtctggtaaacaatcatcttgatgagatgatgcctgttatttataccccaaccgtcggcgcagcctgtgagcgtttttctgagatctaccgccgttcacgcggcgtgtttatctcttaccagaaccggcacaatatggacgatattctgcaaaacgtgccgaaccataatattaaagtgattgtggtgactgacggtgaacgcattctggggcttggtgaccagggcatcggcgggatgggcattccgatcggtaaactgtcgctctataccgcctgtggcggcatcagcccggcgtatacccttccggtggtgctggatgtcggaacgaacaaccaacagctgcttaacgatccgctgtatatgggctggcgtaatccgcgtatcactgacgacgaatactatgaattcgttgatgaatttatccaggctgtgaaacaacgctggccagacgtgctgttgcagtttgaagactttgctcaaaaaaatgcgatgccgttacttaaccgctatcgcaatgaaatttgttcttttaacgatgacattcagggcactgcggcggtaacagtcggcacactgatcgcagcaagccgcgcggcaggtggtcagttaagcgagaaaaaaatcgtcttccttggcgcaggttcagcgggatgcggcattgccgaaatgatcatctcccagacccagcgcgaaggattaagcgaggaagcggcgcggcagaaagtctttatggtcgatcgctttggcttgctgactgacaagatgccgaacctgctgcctttccagaccaaactggtgcagaagcgcgaaaacctcagtgactgggataccgacagcgatgtgctgtcactgctggatgtggtgcgcaatgtaaaaccagatattctgattggcgtctcaggacagaccgggctgtttacggaagagatcatccgtgagatgcataaacactgtccgcgtccgatcgtgatgccgctgtctaacccgacgtcacgcgtggaagccacaccgcaggacattatcgcctggaccgaaggtaacgcgctggtcgccacgggcagcccgtttaatccagtggtatggaaagataaaatctaccctatcgcccagtgtaacaacgcctttattttcccgggcatcggcctgggtgttattgcttccggcgcgtcacgtatcaccgatgagatgctgatgtcggcaagtgaaacgctggcgcagtattcaccattggtgctgaacggcgaaggtatggtactgccggaactgaaagatattcagaaagtctcccgcgcaattgcgtttgcggttggcaaaatggcgcagcagcaaggcgtggcggtgaaaacctctgccgaagccctgcaacaggccattgacgataatttctggcaagccgaataccgcgactaccgccgtacctccatctaa SEQ ID NO.8 Fragment 14 maeB atggatgaccagttaaaacaaagtgcacttgatttccatgaatttccagttccagggaaaatccaggtttctccaaccaagcctctggcaacacagcgcgatctggcgctggcctactcaccaggcgttgccgcaccttgtcttgaaatcgaaaaagacccgttaaaagcctacaaatataccgcccgaggtaacctggtggcggtgatctctaacggtacggcggtgctggggttaggcaacattggcgcgctggcaggcaaaccggtgatggaaggcaagggcgttctgtttaagaaattcgccgggattgatgtatttgacattgaagttgacgaactcgacccggacaaatttattgaagttgtcgccgcgctcgaaccaaccttcggcggcatcaacctcgaagacattaaagcgccagaatgtttctatattgaacagaaactgcgcgagcggatgaatattccggtattccacgacgatcagcacggcacggcaattatcagcactgccgccatcctcaacggcttgcgcgtggtggagaaaaacatctccgacgtgcggatggtggtttccggcgcgggtgccgcagcaatcgcctgtatgaacctgctggtagcgctgggtctgcaaaaacataacatcgtggtttgcgattcaaaaggcgttatctatcagggccgtgagccaaacatggcggaaaccaaagccgcatatgcggtggtggatgacggcaaacgtaccctcgatgatgtgattgaaggcgcggatattttcctgggctgttccggcccgaaagtgctgacccaggaaatggtgaagaaaatggctcgtgcgccaatgatcctggcgctggcgaacccggaaccggaaattctgccgccgctggcgaaagaagtgcgtccggatgccatcatttgcaccggtcgttctgactatccgaaccaggtgaacaacgtcctgtgcttcccgttcatcttccgtggcgcgctggacgttggcgcaaccgccatcaacgaagagatgaaactggcggcggtacgtgcgattgcagaactcgcccatgcggaacagagcgaagtggtggcttcagcgtatggcgatcaggatctgagctttggtccggaatacatcattccaaaaccgtttgatccgcgcttgatcgttaagatcgctcctgcggtcgctaaagccgcgatggagtcgggcgtggcgactcgtccgattgctgatttcgacgtctacatcgacaagctgactgagttcgtttacaaaaccaacctgtttatgaagccgattttctcccaggctcgcaaagcgccgaagcgcgttgttctgccggaaggggaagaggcgcgcgttctgcatgccactcaggaactggtaacgctgggactggcgaaaccgatccttatcggtcgtccgaacgtgatcgaaatgcgcattcagaaactgggcttgcagatcaaagcgggcgttgattttgagatcgtcaataacgaatccgatccgcgctttaaagagtactggaccgaatacttccagatcatgaagcgtcgcggcgtcactcaggaacaggcgcagcgggcgctgatcagtaacccgacagtgatcggcgcgatcatggttcagcgtggggaagccgatgcaatgatttgcggtacggtgggtgattatcatgaacattttagcgtggtgaaaaatgtctttggttatcgcgatggcgttcacaccgcaggtgccatgaacgcgctgctgctgccgagtggtaacacctttattgccgatacatatgttaatgatgaaccggatgcagaagagctggcggagatcaccttgatggcggcagaaactgtccgtcgttttggtattgagccgcgcgttgctttgttgtcgcactccaactttggttcttctgactgcccgtcgtcgagcaaaatgcgtcaggcgctggaactggtcagggaacgtgcaccagaactgatgattgatggtgaaatgcacggcgatgcagcgctggtggaagcgattcgcaacgaccgtatgccggacagctctttgaaaggttccgccaatattctggtgatgccgaacatggaagctgcccgcattagttacaacttactgcgtgtttccagctcggaaggtgtgactgtcggcccggtgctgatgggtgtggcgaaaccggttcacgtgttaacgccgatcgcatcggtgcgtcgtatcgtcaacatggtggcgctggccgtggtagaagcgcaaacccaaccgctgtaa SEQ ID NO.9 Fragment 15 leuDH atgttcgcgctgatgcaaagcacccgtacccagtcactgcacctgttcaatgacccgcctacgggcctgaaagccgttgtggcaatccacagtgagcatttgggcccggccatgggggggtgccgctacctgccttacgccgatgacgaaagcgccatgaccgacgcgattcgcctggcccagggcatgagctacaaggcagcactggccggcttgccgatggggggtggcaaggcggtaatcatgcgcaacccgcatgtggaaaaccgcgcagcgctgttcgaggcctttggccgcttcatcgataccttgcatgggcgcttcatcatcgccgtggacagtggcacctcgaccttggacatggactgcattgcccacagcacgccctacgtgaccagcaccactgcatcgggcgacccatcgccacatgcggcgatgggggtgttcgcgggcatacgtgccacaacctcgttccggctgggcagcgatgacctgagaggcttgcgggtagcggtccaggggttgggcaatgttggttatgccctggcggagcaattgcatgcggtgggcgcggagctgctggtcagcgacttggacccggggcgggtgcggctggcgatggagcagttcgatgccaaaccggtgaccaacgatgcgttgatcagtaccccttgcgatatctttgcaccctgcggcgtgggcccggtactgaacgggcagagcgtgatgcaactgcgttgtgcggcagtggcgggggcggccaacaaccagctgactaccttgcaggtggcagaccagctggagtcgcgcggcatattgtatgcacctgactacgtgatcaatgccggtgggctgatctatgtggcactcacccaccgtggcgaagaccagcgcaccattactgcgcacctggcgcgaatcccttcacggctgaccgaagtgtttggccatgcgcaggcggagaagcgttcgccggcaagggtggcgcagatgttggcggagcggttgttgtatggctga SEQ IDNO.10 Fragment 16 kicd atgacaacctacaacaacaaaggaccaaagcctgagagaggccggttcctccatttccactcggtgaccttctgggttggcaatgccaagcaggctgcttccttctactgcaacaagatgggctttgaacctctggcctacaggggcctagagactggctcccgggaggtagtcagccacgtcatcaagcgagggaaaattgtgtttgttctctgctctgctctcaatccctggaacaaagagatgggcgaccacttggtgaagcatggcgacggggtgaaagacatcgcattcgaggtggaagactgcgaccacattgtgcagaaagctcgagaacggggcgccaaaattgtgcgggagccatgggtggagcaagacaaatttgggaaggtgaagtttgctgtgctgcagacgtatggagataccacacacaccctggtggagaagatcaactacactggccgtttcttacctggattcgaggccccaacatacaaggataccctgcttccaaaactacccagatgtaaccttgagatcattgaccacattgtaggcaaccaacccgaccaagaaatgcagtctgcctcagaatggtacctgaaaaacctgcagttccaccggttctggtccgtggacgacacgcaggtgcacacggagtacagctctctgcgctccattgtggtgaccaactacgaggaatccatcaaaatgcccatcaacgagccagctccgggcaggaagaagtctcagatccaggaatatgtggactataatgggggtgctggggtccagcacatcgctctcaagacggaagacatcatcacagcaatccgccacttgagggagcgaggcacggagttcttggcagccccatcttcttactacaaactgcttcgggagaatctcaagtcagccaagatccaggtgaaagagagcatggacgtcctggaggagctgcatatcctagtcgactatgacgagaaaggctacctcctacagatcttcaccaagcccatgcaggaccggcccacactcttcctggaagtcattcaacgtcacaaccaccagggctttggagcgggcaacttcaactctctgttcaaggcgttcgaggaggagcaagccctacggggcaacctcactgacctggagcccaatggtgtgaggtctggaatgtaa SEQ IDNO.11 Fragment 17 ilvC atggctaactacttcaatacactgaatctgcgccagcagctggcacagctgggcaaatgtcgctttatgggccgcgatgaattcgccgatggcgcgagctaccttcagggtaaaaaagtagtcatcgtcggctgtggcgcacagggtctgaaccagggcctgaacatgcgtgattctggtctcgatatctcctacgctctgcgtaaagaagcgattgccgagaagcgcgcgtcctggcgtaaagcgaccgaaaatggttttaaagtgggtacttacgaagaactgatcccacaggcggatctggtgattaacctgacgccggacaagcagcactctgatgtagtgcgcaccgtacagccactgatgaaagacggcgcggcgctgggctactcgcacggtttcaacatcgtcgaagtgggcgagcagatccgtaaagatatcaccgtagtgatggttgcgccgaaatgcccaggcaccgaagtgcgtgaagagtacaaacgtgggttcggcgtaccgacgctgattgccgttcacccggaaaacgatccgaaaggcgaaggcatggcgattgccaaagcctgggcggctgcaaccggtggtcaccgtgcgggtgtgctggaatcgtccttcgttgcggaagtgaaatctgacctgatgggcgagcaaaccatcctgtgcggtatgttgcaggctggctctctgctgtgcttcgacaagctggtggaagaaggtaccgatccagcatacgcagaaaaactgattcagttcggttgggaaaccatcaccgaagcactgaaacagggcggcatcaccctgatgatggaccgtctctctaacccggcgaaactgcgtgcttatgcgctttctgaacagctgaaagagatcatggcacccctgttccagaaacatatggacgacatcatctccggcgaattctcttccggtatgatggcggactgggccaacgatgataagaaactgctgacctggcgtgaagagaccggcaaaaccgcgtttgaaaccgcgccgcagtatgaaggcaaaatcggcgagcaggagtacttcgataaaggcgtactgatgattgcgatggtgaaagcgggcgttgaactggcgttcgaaaccatggtcgattccggcatcattgaagagtctgcatattatgaatcactgcacgagctgccgctgattgccaacaccatcgcccgtaagcgtctgtacgaaatgaacgtggttatctctgataccgctgagtacggtaactatctgttctcttacgcttgtgtgccgttgctgaaaccgtttatggcagagctgcaaccgggcgacctgggtaaagctattccggaaggcgcggtagataacgggcaactgcgtgatgtgaacgaagcgattcgcagccatgcgattgagcaggtaggtaagaaactgcgcggctatatgacagatatgaaacgtattgctgttgcgggttaa SEQ IDNO.12 Fragment 21 fadRup gctatcagcgtagttagccctctggtatgatgagtccaactttgttttgctgtgttatggaaatctcact SEQ IDNO.13 Fragment 22 fadRdown aagaatgggaaatctgtaaaaacaacaaaaaacccctcgtttgaggggtttgctctttaaacggaaggga SEQ IDNO.14 Fragment 23 fabFup gtcgttcgaccgcctgagttttatctttttgtcccactagaatcattttttccctccctggaggacaaac SEQ IDNO.15 Fragment 24 fabFdown aacaagtcggaataaaagctaagaaaaaaggcccgcaagcggaccttttataagggtggaaaatgacaac SEQ IDNO.16 Fragment 25 fabHup tagcaggacgctgccagcgaactcgcagtttgcaagtgacggtatataaccgaaaagtgactgagcgtac SEQ IDNO.17 Fragment 26 fabHdown gcattccaacggtttgagaaccctgtccagggaacacaaatgcaaattgcgtcatgttttaatccttatc SEQ IDNO.18 Fragment 27 fadDup gtccgctgtttctgcattcttacggtaaagataaaaataaatagtgacgcgcttcgcaaccttttcgttg SEQ IDNO.19 Fragment 28 fadDdown attgataacggtcagggttgatctccgtcggaacgtccgcgggataacggttaagccaaaccttcttcaa SEQ IDNO.20 Fragment 29 fadLup gataagtgaccgaaatcacacttaaaaatgatctaaaacaaaattcacccgaatccatgagtgcgccacc SEQ IDNO.21 Fragment 30 fadLdown aggcctgggtggagataagtgccactgcgactgcgagagcagactttgtaaacagggttttctggctcat SEQ IDNO.22 Fragment 31 atoSCup tggttaaggtagcggtaaaagcgtgttaccgcaatgttctctcttctctggaatatgatacaccgccgag SEQ IDNO.23 Fragment 32 atoSCdown ccatcaggattgccatcaggatcatttgattgcgtaagcggcgtggataaatccacttcatataatgcat SEQ IDNO.24 Fragment 33 iclRup gacagtctcttttttctgtatcgtggaaatcattttcatttttattgttagctaatgcaatagttactga SEQ IDNO.25 Fragment 34 iclRdown aacagacacccttattctattgccactcaggtatgatgggcagaatattgcctctgcccgccagaaaaag SEQ IDNO.26 Fragment 35 frdAup cagaccgtaactttcaggtacttaccctgaagtacgtggctgtgggataaaaacaatctggaggaatgtc SEQ ID NO.27 Fragment 36 frdA down gaatgcgctatgcggtgcggtatcgacttccgggttatagcgcaccacctcaattttcaggtttttcatc SEQ ID NO.28 Fragment 37 sthA up caattggcttacccgcgataaaatgttaccattctgttgcttttatgtataagaacaggtaagccctacc SEQ ID NO.29 Fragment 38 sthA down gctgcgcagccgctatgagcagctggcagaggccatccgcgcaagaatggatggccatttcgataaagtt SEQ ID NO.30 Fragment 39 ilvE up cacgttgccatctgccagagcacaaccacatcacaacaaatccgcgcctgagcgcaaaaggaatataaaa SEQ ID NO.31 Fragment 40 ilvE down cgcgccacagcgcacgagcacccgccatattacgaccatgagtggtggtggcggaacggtacttaggcat SEQ ID NO.32 Fragment 41 leuA up agcggcatccagcattaagccagcacgcagtcaaacaaaaaacccgcgccattgcgcgggtttttttatg SEQ ID NO.33 Fragment 42 leuA down tcaagcttgcctgtaacgcctgttcaccgtcgcgcaatgtggtatcgaaaataatgacttgctggctcat SEQ ID NO.34 Fragment 43 ilvBN up tggtggtcgtcggcaatgcgccgtagggactggaacaacacacgattccaaaaccccgccggcgcaaacc SEQ ID NO.35 Fragment 44 ilvBN down ccaggaaatgaacgataaattctgcgccggtaaagcgcttacgcgtcgatgttgtgcccgaacttgccat SEQ ID NO.36 Fragment 45 ldhA up attaaatttgaaattttgtaaaatatttttagtagcttaaatgtgattcaacatcactggagaaagtctt SEQ ID NO.37 Fragment 46 ldhA down agaatagaggatgaaaggtcattggggattatctgaatcagctcccctggaatgcaggggagcggcaaga SEQ IDNO.38 Fragment 47 dldup actcgctgaattgttatacaaggcgctattctagtttgtgatattttttcgccaccacaaggagtggaaa SEQ IDNO.39 Fragment 48 dlddown gcggcggcggggcagacggcacagaacgattaagtgaattcggatggcgatactctgccatccgtaattt SEQ IDNO.40 Fragment 49 lldDup ggctcgccacgcacggattacccgcctgcccggtgagcataatgagcattcgagggagaaaaacgcatga SEQ IDNO.41 Fragment 50 lldDdown gggagtacatacagcgccgaacggtcccctctccctgagggagagggttagggtgagggggcgcaaacga SEQ IDNO.42 Fragment 51 poxBup tcccatcccttccccctccgtcagatgaactaaacttgttaccgttatcacattcaggagatggagaacc SEQ IDNO.43 Fragment 52 poxBdown gtcgggtaacggtatcactgcgtaaatcaatcatggcatgtccttattatgacgggaaatgccacccttt SEQ IDNO.44 Fragment 53 pflBup aaacgaccaccattaatggttgtcgaagtacgcagtaaataaaaaatccacttaagaaggtaggtgttac SEQ IDNO.45 Fragment 54 pflBdown ctaaaaaaggccccactttcgtggagcctttattgtacgctttttactgtacgatttcagtcaaatctaa

[0122] Table 4. Primers of Example 1

[0123] Primer Sequence (5'-3') fadR-1 gctatcagcgtagttagccctctgg fadR-2 aagaatgggaaatctgtaaaaacaa fadR-3 agccttgatccctttttcttctttttgtct fabF-1 gtcgttcgaccgcctgagttttatc fabF-2 aacaagtcggaataaaagctaagaa fabF-3 ccaccaggcgtaagtgaacatctccaggcg fabH-1 tagcaggacgctgccagcgaactcg fabH-2 gcattccaacggtttgagaaccctg fabH-3 ctggacggtggcaaaagcggaactctgcgg fadD-1 gtccgctgtttctgcattcttacgg fadD-2 attgataacggtcagggttgatctc fadD-3 ttgtttttaaagaaaaagaaacagcggctg fadL-1 gataagtgaccgaaatcacacttaa fadL-2 aggcctgggtggagataagtgccac fadL-3 gctgctccagttgttaattctgcaaaatcg atoSC-1 tggttaaggtagcggtaaaagcgtg atoSC-2 ccatcaggattgccatcaggatcat atoSC-3 gaagctccgcctcaggtgaccgatggagtg iclR-1 tcagtaactattgcattagctaaca iclR-2 aacagacacccttattctattgcca iclR-3 atttgttcaacattaactcatcggatcagt frdA-1 cagaccgtaactttcaggtacttac frdA-2 gaatgcgctatgcggtgcggtatcg frdA-3 acctataaaggagcagtggaatagcgttcg sthA-1 caattggcttacccgcgataaaatg sthA-2 gctgcgcagccgctatgagcagctg sthA-3 tcaggatatagccagataaatgacggggat ilvE-1 cacgttgccatctgccagagcacaa ilvE-2 cgcgccacagcgcacgagcacccgc ilvE-3 agtcagttaaataaactggtggacgtcgca leuA-1 agcggcatccagcattaagccagca leuA-2 tcaagcttgcctgtaacgcctgttc leuA-3 aacgcatcttctttgcgcggtagacgagtg ilvB-1 tggtggtcgtcggcaatgcgccgta ilvB-2 ccaggaaatgaacgataaattctgc ilvB-3 catccgccgcagtggtcgtcgtgcgtgtgg ldhA-1 attaaatttgaaattttgtaaaata ldhA-2 agaatagaggatgaaaggtcattgg ldhA-3 atgaatttttcaatatcgccatagctttca dld-1 actcgctgaattgttatacaaggcg dld-2 gcggcggcggggcagacggcacaga dld-3 cagtttattgtctgaattttcaaaatattc lldD-1 ggctcgccacgcacggattacccgc lldD-2 gggagtacatacagcgccgaacggt lldD-3 caccaccatgaaacgattcgatgaagatca poxB-1 tcccatcccttccccctccgtcaga poxB-2 gtcgggtaacggtatcactgcgtaa poxB-3 ggctatttaaccgttagtgcctcctttctc pflB-1 aaacgaccaccattaatggttgtcg pflB-2 ctaaaaaaggccccactttcgtgga pflB-3 gttgacatactgggtcatttacctgcgtga Kan-R tcgtcaagaaggcgatagaa

[0124] Example 2. Application of recombinant bacteria in the preparation of HMB

[0125] 1. Culture medium components

[0126] (1-a)The components and final concentrations of the growth medium are as follows:

[0127] The solvent is water, and the solutes and their concentrations are: 25 mM NaHPO4, 25 mM KH2PO4, 50 mM NH4Cl, 5 mM Na2SO4, 2 mM MgSO4, glycerol with a volume percentage concentration of 5%, yeast powder with a mass percentage concentration of 0.5%, 50 μM FeCl3, 20 μM CaCl2, 10 μM MnCl2, 10 μM ZnSO4, 2 μM CoCl2, 2 μM NiCl2, 2 μM Na2MO4, 2 μM Na2SeO3, and 2 μM H3BO3.

[0128] (1-b)The components and final concentrations of the transformation medium are as follows (the solvent is water):

[0129] Na2HPO4: 100 mM;

[0130] KH2PO4: 100 mM;

[0131] MgCl2: 5 mM;

[0132] FeSO4: 1 mM;

[0133] Palmitic acid: 5 g / 100 mL (2%);

[0134] Glucose: 5 g / 100 mL (8%);

[0135] Polyoxyethylene ether Brij58 emulsifier: 0.2 g / 100 mL.

[0136] 2. Cultivation of bacteria and induction of enzymes

[0137] The overnight cultured Escherichia coli wild-type strain BW25113, recombinant Escherichia coli FK08, FK12, and FK17 were inoculated into flasks containing 200 ml of the corresponding growth medium for the strain at an inoculation amount of 1% and cultured at 37°C for 16 h. The cells were collected by centrifugation at 8000 g for 10 min.

[0138] 3. Whole-cell catalytic synthesis of HMB

[0139] The cells collected above were resuspended in beakers containing 10 ml of the corresponding transformation medium for the strain. During the reaction process, the pH was regularly detected using pH test paper and adjusted with 0.1 M NaOH and HCl solutions to maintain the pH at 7.5. After reacting at 37°C for 24 h, the reaction product was centrifuged at 8000 g for 10 minutes, and the supernatant was filtered through a 0.22 μm filter membrane. The content of HMB in the supernatant was detected by HPLC.

[0140] The concentration of HMB was determined using an HPLC system (Dionex UltiMate 3000 Series, Thermo Scientific, USA). The system was equipped with an Aminex HPX-87H ion exchange column (7.8×300 mm, Bio-Rad Laboratories, USA), the column temperature was 35 °C, the flow rate was 0.6 mL / min, the mobile phase was 5 mM sulfuric acid solution, and the injection volume was 10 μL. The concentration of HMB in the sample was calculated from the HMB (standard product purchased from Jizhi Chemistry, product number: H68580) concentration standard curve.

[0141] The conversion rate was calculated as the ratio of the amount of HMB produced in the whole-cell catalysis stage (step 3) to the consumption of glucose and palmitic acid * 100%.

[0142] Table 10. HMB production and conversion rates of various engineered bacteria

[0143] Examples Bacterial strains HMB production (g / L) Conversion rate WT BW25113 0 0% 1 FK08 0 0 1 FK12 0.5 5% 1 FK17 3.2 33%

[0144] The present invention has been described in detail above. For those skilled in the art, without departing from the spirit and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any changes, uses, or improvements to the present invention, including those that depart from the scope disclosed in this application but are made using conventional techniques known in the art. Some basic features can be applied within the scope of the following appended claims.

[0145] The above-described embodiments merely represent several implementation manners of the present invention. Their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all fall within the protection scope of the present invention. Therefore, the protection scope of the invention patent should be subject to the appended claims, and the description can be used to explain the content of the claims.

Claims

1. A recombinant Escherichia coli for synthesizing β-hydroxy-β-methylbutyric acid (HMB), comprising deletion, knockout or inhibitory expression of the following gene clusters: fatty acid metabolism regulator gene fadR, β-ketoacyl-ACP synthase II gene fabF, β-ketoacyl-ACP synthase III gene fabH, glyoxylate pathway inhibitor gene iclR, and fumarate reductase flavoprotein A subunit gene frdA; And comprising enhancement or exogenous insertion of the following gene clusters: fatty acyl-CoA synthetase gene fadD, long-chain fatty acid transporter gene fadL, short-chain fatty acid degradation regulation gene cluster atoSC, isocitrate lyase gene aceA, malate synthase gene aceB, Escherichia coli malate dehydrogenase genes maeA and maeB.

2. The recombinant Escherichia coli according to claim 1, which further comprises the following modifications: Deletion, knockout or inhibitory expression of NAD(P) transhydrogenase sthA gene and branched-chain amino acid aminotransferase gene ilvE; and Enhancement or exogenous insertion of leucine dehydrogenase gene leuDH, α-ketoisocaproic acid dioxygenase gene kicd, keto acid reductoisomerase gene ilvC, dihydroxy acid dehydratase gene ilvD, 2-isopropylmalate synthase gene leuA, and acetolactate synthase genes ilvBN.

3. The recombinant Escherichia coli according to claim 2, which further comprises the following modifications: Deletion, knockout or inhibitory expression of NADH-dependent D-lactate dehydrogenase gene ldhA, quinone-dependent D-lactate dehydrogenase gene dld, L-lactate dehydrogenase gene lldD, pyruvate oxidase gene poxB, and pyruvate formate-lyase gene pflB.

4. A method for producing β-hydroxy-β-methylbutyric acid (HMB), comprising: Fermenting to produce HMB using the recombinant Escherichia coli according to any one of claims 1 to 3.

5. The method according to claim 4, wherein, The recombinant Escherichia coli ferments to produce HMB using fatty acids and glucose as substrates; Preferably, the fatty acids include saturated fatty acids such as stearic acid (C18), palmitic acid (C16), myristic acid (C14), lauric acid (C12), capric acid (C10), caprylic acid (C8) or hexanoic acid (C6); also include unsaturated fatty acids, such as oleic acid (C18), linoleic acid (C18) and linolenic acid (C18); or include triglycerides mainly composed of fatty acids, such as soybean oil, peanut oil, palm oil and olive oil, or include oil-containing waste such as gutter oil, etc.

6. The method according to claim 5, wherein A polyoxyethylene ether Brij58 emulsifier is also added during the fermentation of the recombinant Escherichia coli.

7. A method for preparing a recombinant Escherichia coli capable of synthesizing β-hydroxy-β-methylbutyric acid (HMB), comprising: (1) Deleting, knocking out or inhibiting the expression of: fatty acid metabolism regulator gene fadR, β-ketoacyl-ACP synthase II gene fabF, β-ketoacyl-ACP synthase III gene fabH, glyoxylate pathway inhibitor gene iclR, and fumarate reductase flavoprotein A subunit gene frdA; and (2) Enhancement or exogenous insertion: fatty acyl-CoA synthetase gene fadD, long-chain fatty acid transporter gene fadL, short-chain fatty acid degradation regulatory gene cluster atoSC, isocitrate lyase gene aceA, malate synthase gene aceB, Escherichia coli malate dehydrogenase genes maeA and maeB.

8. The method according to claim 7, further comprising: Deletion, knockout or inhibitory expression: NAD(P) transhydrogenase sthA gene and branched-chain amino acid aminotransferase gene ilvE; And Enhancement or exogenous insertion: leucine dehydrogenase gene leuDH, α-ketoisocaproic acid dioxygenase gene kicd, keto acid reductoisomerase gene ilvC, dihydroxy acid dehydratase gene ilvD, 2-isopropylmalate synthase gene leuA, acetolactate synthase genes ilvBN.

9. The method according to claim 8, further comprising: Deletion, knockout or inhibitory expression: NADH-dependent D-lactate dehydrogenase gene ldhA, quinone-dependent D-lactate dehydrogenase gene dld, L-lactate dehydrogenase gene lldD, pyruvate oxidase gene poxB, and pyruvate formate-lyase gene pflB.

10. Use of the strain according to claims 1 to 3 in the production of β-hydroxy-β-methylbutyric acid HMB.

Images