Poplar CCD enzyme mutant as well as gene, vector, recombinant bacterium and retinol production method thereof

Abstract

The invention discloses a poplar CCD enzyme mutant as well as a gene, a vector, a recombinant bacterium and a retinol production method thereof. The poplar CCD enzyme mutant is obtained by carrying out at least one of the following point mutations on a wild type CCD enzyme with an amino acid sequence as shown in SEQ ID No.1: V99I, F205L, A278T, H123Y, M276V, F301S, Y156F, L324Q and V357A. The invention further provides a gene, a recombinant vector and a recombinant bacterium for coding the poplar CCD enzyme mutant protein. The poplar CCD enzyme mutant can be used for catalytic preparation of retinol. The catalytic efficiency of the PtCCD8 is remarkably improved through point mutation, and the PtCCD8 can be used for efficient catalytic preparation of retinol by taking beta-carotene as a substrate, and has a relatively good industrial application prospect.

Description

Technical Field

[0001] The present invention relates to an oxygenase mutant and its construction, expression and application, and particularly to a Populus CCD enzyme mutant and its gene, vector, recombinant bacterium and method for producing retinol. Background Art

[0002] Carotenoid cleavage dioxygenase (CCD) is a key enzyme that catalyzes the conversion of β-carotene to retinol (a precursor of vitamin A) (Nature Plants, 2018, 4: 663). However, wild-type CCD enzymes have defects such as low catalytic efficiency and poor heterologous expression activity. For example, the wild-type PtCCD8 derived from Populus in patent WO2019154328A1 has a catalytic efficiency for β-carotene of only 2.1×10 3 M -1 s -1 and the specific activity of PtCCD8 decreases by 65% when expressed in yeast.

[0003] Although Yarrowia lipolytica has been used for terpene production (CN113249413A, Tsinghua University), there are bottlenecks such as low β-carotene conversion rate (<8%) and low product toxicity threshold (>0.08 g / L, resulting in cell death) in its retinol synthesis (Metab Eng, 2021, 64: 41). In the existing process, the highest yield of retinol in shake-flask fermentation is only 0.1 g / L, and the yield drops sharply during large-scale production due to unstable dissolved oxygen control (Biotechnol Bioeng, 2022, 119: 2029).

[0004] Improvements in the prior art (such as the enzyme thermostability modification in US20210017562A1 and the two-stage pH control in WO2022083246A1) have not systematically solved the synergistic problems of enzyme activity-host adaptation-process regulation, resulting in limited industrial application. Summary of the Invention

[0005] Object of the Invention: The object of the present invention is to provide a Populus CCD enzyme mutant to solve the problem of how to improve the substrate catalytic efficiency of the wild-type PtCCD8 enzyme protein. The second object of the present invention is to propose a gene, recombinant vector and recombinant bacterium encoding the above Populus CCD enzyme mutant protein to solve the problem of how to construct and express the recombinant Populus CCD enzyme mutant protein. The third object of the present invention is to propose a method for producing retinol to solve the problem of how to biocatalytically prepare retinol.

[0006] Technical solution: A Populus CCD enzyme mutant of the present invention is obtained from the wild-type CCD enzyme with the amino acid sequence shown in SEQ ID No. 1 through at least one of the following point mutations: V99I, F205L, A278T, H123Y, M276V, F301S, Y156F, L324Q, V357A.

[0007] Preferably, the Populus CCD enzyme mutant includes one of the following point mutation combinations: V99I / F205L / A278T, H123Y / M276V / F301S, Y156F / L324Q / V357A.

[0008] Based on protein rational design and directed evolution strategies, the present invention functionally enhances the carotenoid cleavage dioxygenase (CCD) derived from Populus trichocarpa to obtain a CCD enzyme mutant with enhanced β-carotene conversion activity. Based on the crystal structure of the Populus CCD8 enzyme (PtCCD8, NCBI accession number XM_062110616.1), key functional residues (V99, F205, A278) in the catalytic pocket were identified through molecular docking analysis, and the RosettaDDG software was used to predict the effect of mutations on the enzyme-substrate binding free energy (ΔG). Mutant combinations with a ΔG decrease value exceeding 1.5 kcal / mol (such as V99I, F205L, A278T) were screened, significantly enhancing the substrate binding ability.

[0009] The PtCCD8 gene was randomly mutated three times (error rate 0.5 - 1.5 bases / kb) using error-prone PCR technology to construct a mutant library; mutants with improved catalytic activity were screened by high-throughput using a fluorescent substrate method (excitation wavelength 325 nm, emission wavelength 450 nm), and finally the optimal mutant M7 (V99I / F205L / A278T) was obtained, whose catalytic efficiency was 4.2 times higher than that of the original enzyme.

[0010] The second aspect of the present invention discloses a gene encoding the above-mentioned Populus CCD enzyme mutant protein.

[0011] Preferably, the gene encoding the Populus CCD enzyme mutant protein contains the nucleotide sequence shown in SEQ ID No. 3.

[0012] The third aspect of the present invention discloses a cloning vector or expression vector containing the above-mentioned gene encoding the Populus CCD enzyme mutant protein.

[0013] The fourth aspect of the present invention discloses a recombinant bacterium containing the above-mentioned cloning vector or expression vector.

[0014] Preferably, the host bacterium is Yarrowia lipolytica, and the expression vector includes a TDH3 promoter, a CYC1 terminator, and an endoplasmic reticulum localization signal peptide coding sequence, and is targeted for integration into the Yarrowia lipolytica rDNA locus.

[0015] The mutant gene (M7) was cloned into the Yarrowia lipolytica integrative vector pYLXP'-N (Addgene #78956), and the vector contains the following functional elements:

[0016] Expression regulation element: The strong TDH3 promoter and CYC1 terminator drive the efficient transcription of the gene;

[0017] Subcellular localization optimization: The C-terminus is fused with an endoplasmic reticulum retention signal peptide (KDEL amino acid sequence, Lys-Asp-Glu-Leu) to improve the enzyme stability;

[0018] The present invention constructs a recombinant Yarrowia lipolytica engineering strain integrating the poplar CCD enzyme mutant gene, and through the coordinated optimization of metabolic flux regulation and fermentation process, realizes the efficient biosynthesis of retinol (vitamin A precursor);

[0019] Preferably, the Yarrowia lipolytica is Yarrowia lipolytica Po1g in which the acyl-CoA oxidase gene has been knocked out, and 3-5 copies of the nucleotide sequence shown in SEQ ID No. 3 are integrated into the genome of the recombinant bacterium.

[0020] In some embodiments, the acyl-CoA oxidase gene is the PEX10 gene (NCBI Gene ID 2904968). Multi-copy integration: The expression cassette is targeted for integration into the Yarrowia lipolytica rDNA locus (the target sequence is GGCGTACGTGTCGTCGTGACGG) through the CRISPR / Cas9 system to achieve stable multi-copy expression of 3-5 copies, significantly improving the expression level of the enzyme mutant.

[0021] The fifth aspect of the present invention discloses a method for producing retinol, including the following steps:

[0022] (1) Inoculate the above-mentioned recombinant bacterium containing the poplar CCD enzyme mutant protein gene into a fermentation medium, and culture it at 28-30 °C under the condition of 20-30% dissolved oxygen for at least 36 hours;

[0023] (2) Induce the expression of the poplar CCD enzyme mutant at 30-32 °C under the condition of 5-15% dissolved oxygen, and then add a β-carotene-hydroxypropyl-β-cyclodextrin inclusion complex with a final concentration of 3-8 mM to the fermentation broth, and continue fermentation culture;

[0024] (3) Retinol is extracted by adding 3 - 8 v / v% hexadecane to the fermentation broth at regular intervals.

[0025] The solubility of β - carotene is increased by 8 times by the cyclodextrin inclusion complex, and the survival rate of the recombinant bacteria cells is > 90% (the survival rate of the group without using the cyclodextrin inclusion complex is only 35%). Hexadecane can be added once every 12 - 36 h. As a two - phase extractant, hexadecane can effectively reduce product inhibition. The two - stage temperature control method in steps (1) and (2) is as follows: stirring rate: 400 - 800 rpm; aeration rate: 0.8 - 1.2 vvm; dissolved oxygen (DO) automatically adjusts the oxygen / nitrogen mixing ratio through PID.

[0026] The present invention establishes a large - scale retinol production system based on the above - mentioned recombinant strain, solves the technical bottlenecks such as low substrate conversion rate (< 15%) and severe product inhibition existing in the existing microbial production method, and provides high - purity raw materials for downstream industries such as nutritionally fortified foods and medicinal retinoid preparations.

[0027] Preferably, the fermentation medium contains yeast nitrogen base at a final concentration of 5 - 8 g / L, 0.1 - 0.5% Triton X - 100, and 0.3 - 1.0% glycerol acetate. The molar ratio of β - carotene to hydroxypropyl - β - cyclodextrin in the β - carotene - hydroxypropyl - β - cyclodextrin inclusion complex is 1 - 2:2 - 4.

[0028] Beneficial effects: Compared with the prior art, the present invention has the following remarkable advantages:

[0029] The retinol yield of the strain constructed by the present invention with multiple - copy expression of the M7 mutant is increased by 3.1 times compared with the strain expressing PtCCD8; the specific activity of the M7 mutant is 7.8 U / mg (the wild - type enzyme is 1.2 U / mg), and the catalytic efficiency is increased by 6.5 times. The present invention significantly improves the catalytic efficiency of PtCCD8 through point mutation, can be used for efficiently catalyzing the preparation of retinol with β - carotene as the substrate, and has good industrial application prospects. Description of the Drawings

[0030] Figure 1 It is the ERRAT map of wild - type PtCCD8;

[0031] Figure 2 It is the Ramachandran map of wild - type PtCCD8;

[0032] Figure 3 It is the three - dimensional protein structure map of wild - type PtCCD8;

[0033] Figure 4 It is the HPLC analysis map of the retinol standard product (10 mg / L);

[0034] Figure 5HPLC analysis chart of the fermentation broth (0.1 g / L) diluted 50 times;

[0035] Figure 6 HPLC analysis chart of the fermentation broth (0.5 g / L) diluted 100 times;

[0036] Figure 7 Verification result chart of PEX10 knockout;

[0037] Figure 8 Verification result chart of rDNA site PCR; Specific implementation mode

[0038] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0039] Example 1: The construction and screening method of the poplar CCD enzyme mutant M7 is as follows:

[0040] (1) The amino acid sequence of wild-type PtCCD8 (SEQ ID NO: 1) is as follows:

[0041] MASLAFSASIGRSISPSNAMVSDKFESRREGSSLGKGTFARKRDPRDSMVPKVATQAPTVFPSLEKELAGDRNHVAWTSVRQERYEGELAVQGEIPRWLSGTYLRNGPGMWHVGDYNFRHLFDGYATLVRLHFENGRLIAAHRQIESEAYKAAKKNNKLCYREFSEVPKPDNFLSYVGELANLFSGASLTDNANTGVVKLGDGRVVCLTETQKGSIVVDPNTLDTLGKFEYSDSLGGLIHSAHPIVTDTEFLTLLPDLFRLGYLVVRMEPGSNERKVIGRVDCRGGPAPGWVHSFPVTEHYVIVPEMPLRYCAQNLLRAEPTPLYKFEWHPDSKGFMHVMCKASGKIVASVEVPLFVTFHFINAYEEKDEDGRVTAVIADCCEHNSDTTILEKLSLQNLRSFMGEDVLPDARVGRFIIPLDGSPYGKLEAALDPEEHGKGMDMCSINPAYLGKKYRYAYACGAQRPCNFPNTLTKIDLLEKKAKNWYEEGAVPSEPFFVARPGATEEDDGVVISMISEKNGDGYALLLDGSTFEEIARGKFPYGLPYGLHGCWVPKK*

[0042] The crystal structure was established on SWISS-MODEL (https: / / swissmodel.expasy.org) based on the amino acid sequence of wild-type PtCCD8, and the model quality was evaluated by Ramachandran Plot and ERRAT. Ramachandran Plot is mainly used to illustrate the allowed and unallowed conformations of amino acids in proteins or peptides; the most favorable area in the Ramachandran Plot, the more amino acids it contains, the more reasonable the structure is, and the unallowed area (blank area marked with red residues) is the unreasonable amino acid structure in psi-phi; ERRAT distinguishes correct and incorrect protein structures by characteristic atoms, and the larger the result value (Over quality factor), the closer it is to the high-resolution crystal structure, and the closer it is to the high-resolution crystal structure, indicating that the model is fine and usable.

[0043] ERRAT diagram of PtCCD8 (such as Figure 1 The statistics of non-bonded interactions between different atom types are analyzed (as shown) and the error function value versus the position of a 9-residue sliding window is plotted, which is calculated by comparison with the statistics of the highly refined structure. The evaluation shows that the overall quality factor obtained by ERRAT is 91.9588%.

[0044] Ramachandran diagram (such as Figure 2 The evaluation showed that 85.6% of the residues were located in the most favorable region, 10.0% were in the allowed region, 2.1% were in the loosely allowed region, and 2.3% were in the disallowed region. Taken together, these data confirm that the model can be used.

[0045] The molecular formula of β-carotene was downloaded from the online database PubChem (https: / / pubchem.ncbi.nlm.nih.gov), and the β-carotene molecule was docked with PtCCD8 using AutoDock to determine the key amino acid residues V99, F205, A278, H123, Y156, W189, L210, I245, M276, F301, L324, V357, and A389 in the catalytic pocket of PtCCD8;

[0046] The binding free energy change (ΔG = -2.3 kcal / mol) of a single point mutation (such as V99I) was predicted by RosettaDDG, and high-affinity mutations or combinations were screened;

[0047] (2) Error-prone PCR amplification of the PtCCD8 gene (Mn 2+ Concentration 0.15 mM, Mg 2+Construct a mutant library with a concentration of 2 mM and an error rate of 1.2 bases / kb.

[0048] The following is a complete experimental protocol for error-prone PCR amplification and mutant library construction of the PtCCD8 gene, including primer design, reaction program optimization, and library construction steps:

[0049] S1. Error-prone PCR primer design

[0050] Target region: Cover the full length of the PtCCD8 gene.

[0051] Primer length: 20 - 25 bp to ensure specificity.

[0052] Tm value: 55 - 65 °C (adjust according to GC content to avoid secondary structures).

[0053] The primer sequences are as follows:

[0054] Forward primer: GCTAGCATGGCGCCGGGAATTCATGGCTTCCTTGGCATTTTC

[0055] CGAGCTCGGTACAAAGACGAGCTGTAACCGGGAATTCTTATTTCT

[0056] Reverse primer

[0057] TTGGCACCCAGCS2. Error-prone PCR reaction program

[0058] The reaction system (50 μL) is as follows:

[0059]

[0060]

[0061] PCR program (gradient optimization)

[0062]

[0063] S3. PCR product processing and library construction

[0064] PCR product purification: Use a gel extraction kit (such as QIAGEN QIAquick Gel Extraction Kit) to purify the target band. Separate the target band (M7 + homologous arm + KDEL) by agarose gel electrophoresis, cut the gel, and purify the DNA according to the kit instructions.

[0065] Linearized vector preparation: Select the pYLXP'-N vector (Addgene #78956) and linearize it between TDH3 and CYC1 using restriction enzymes (BamHI / AvrII).

[0066] Enzyme digestion verification: Confirm the size of the linearized vector by agarose gel electrophoresis.

[0067] Homologous recombination ligation: Yarrowia lipolytica homologous recombination system: Utilize the high-efficient homologous recombination ability of yeast to directly integrate PCR products. The reaction system is as follows:

[0068]

[0069]

[0070] Reaction conditions: Incubate at 42°C for 30 minutes → Ice bath for 5 minutes.

[0071] S4, Yeast transformation

[0072] Competent cell preparation: Use the Yarrowia lipolytica Po1h strain and prepare it according to the lithium acetate method (LiAc / SS-DNA / PEG).

[0073] Heat shock transformation: Add the above recombinant mixture to the competent cells, incubate at 30°C for 45 minutes → Heat shock at 42°C for 10 minutes → Ice bath for 2 minutes.

[0074] Coating and screening: Coat on YNB-Ura plates (the vector contains the URA3 marker) and culture at 30°C for 3 - 5 days.

[0075] S5, Library amplification and preservation

[0076] Library amplification: Scrape the colonies on the plate, suspend them in YPD medium, and add 20% glycerol for storage at -80°C.

[0077] Library capacity control: At least obtain 1×105 CFU, covering the theoretical mutant diversity (assuming 1.2 mutations / kb, a gene length of 1.5 kb requires at least 1.8×105 clones).

[0078] S6, Library verification

[0079] Random sequencing analysis:

[0080] Sampling: Randomly select 50 clones and send them for Sanger sequencing.

[0081] Analysis content:

[0082] Mutation rate calculation (target 1.2 bases / kb).

[0083] KDEL sequence integrity verification (to avoid frameshift mutations).

[0084] Expression detection: Pick some clones and inoculate them into YPD medium. After induced expression, detect the expression level of the target protein by SDS-PAGE.

[0085] (3) Express mutants in 96-well plates, add a fluorescent substrate (β-carotene derivative), detect the increase in fluorescence intensity at 450 nm, and screen mutants with improved catalytic efficiency as follows:

[0086] Name of fluorescent substrate: 9-cis-β-carotene aldehyde (9-cis-Retinaldehyde);

[0087] Detection principle: PtCCD8 catalyzes the cleavage of β-carotene to generate retinaldehyde, and the latter reacts with fluorometric amine reagent to generate a fluorescent Schiff base (excitation / emission wavelength = 325 / 450 nm).

[0088] Recommended reagents:

[0089] β-carotene (CAS 7235-40-7, Sigma-Aldrich C9750) as a natural substrate needs to be dissolved in DMSO (final concentration ≤ 1%);

[0090] Fluorometric amine kit (CAS 38183-12-9, Sigma-Aldrich F9015) for product labeling.

[0091] Strains and media:

[0092] Yeast engineering bacteria: Yarrowia lipolytica strains expressing PtCCD8 mutants (such as PO1f / pYLXP'-N-M7);

[0093] Medium: YPD medium (containing 100 μg / mL bleomycin);

[0094] Induction conditions: 0.5% oleic acid as an inducer, shake culture at 25 °C (200 rpm).

[0095] Experimental procedures:

[0096] (i) Yeast cell expression and lysis

[0097] Inoculate the mutant yeast engineering bacteria into a 96-well deep-well plate (1 mL of YPD medium per well), and culture them with shaking at 30 °C for 24 hours until OD600 = 5 - 6; centrifuge (3000×g, 5 minutes) to collect the cells, and resuspend them in lysis buffer (50 mM Tris-HCl pH 7.5, 1 mM EDTA, 1% Triton X-100).

[0098] (ii) Enzyme extraction

[0099] Use freeze-thaw cycles (-80 °C / 25 °C, 3 times) or zymolyase (such as Lyticase, Sigma L4025) to lyse the cells; centrifuge (5000×g, 10 minutes) and take the supernatant as the crude enzyme solution, and measure the protein concentration by the BCA method (adjusted to 1 mg / mL). (iii) Reaction system and reaction conditions for enzyme activity detection

[0100] Reaction mixture (100 μL per well):

[0101] Crude enzyme solution (20 μL, containing 20 μg of protein);

[0102] Substrate solution (50 μL, containing 50 μM β-carotene, 0.1 mM FeSO4, 0.1% Tween-80);

[0103] Buffer (30 μL, 50 mM Tris-HCl pH 7.5, 150 mM NaCl).

[0104] Incubation conditions:

[0105] Incubate with shaking in the dark at 30 °C for 1 hour (200 rpm); add fluorescamine working solution (20 μL, 1 mg / mL dissolved in DMSO), and react in the dark at 25 °C for 10 minutes to terminate the reaction.

[0106] (iv) Fluorescence detection

[0107] Instrument settings:

[0108] Excitation wavelength 325 nm, emission wavelength 450 nm (filter bandwidth ±10 nm);

[0109] Adjust the gain value so that the fluorescence intensity of the wild-type enzyme well is 500 - 1000 AU.

[0110] Data processing:

[0111] Calculate the increase in fluorescence intensity (ΔF = fluorescence value of the reaction well - blank control);

[0112] Screen mutants with ΔF values more than 3 times higher than that of the wild type (such as M7, M12, M23).

[0113] (v) Key parameters and verification

[0114] Positive control: Wild-type PtCCD8 reaction well (ΔF reference value);

[0115] Negative control:

[0116] Blank well (without substrate);

[0117] Heat-inactivated enzyme solution (treated at 70 °C for 30 minutes).

[0118] Dose-effect verification: Gradient dilution (0.1 - 1 mg / mL protein) of highly active mutants (such as M7) was performed to verify the linear relationship between fluorescence intensity and enzyme amount (R 2 > 0.98).

[0119] The screening results are shown in Table 1. Mutant M7 (V99I / F205L / A278T) was obtained, and its catalytic efficiency reached 8.8 × 10 3 M -1 s -1 , which was 4.19 times higher than that of the original enzyme (2.1 × 10 3 M -1 s -1 ). In addition, the combined mutants M12 (H123Y / M276V / F301S) and M23 (Y156F / L324Q / V357A) were increased by 2.86 times and 3.57 times respectively, proving that the cooperative optimization of catalytic pocket residues can significantly enhance enzyme activity.

[0120] Table 1 Summary of catalytic efficiencies of different PtCCD8 mutants

[0121]

[0122] Regulation rules of single-point mutation activity

[0123] Positive single-point mutations: V99I, F205L, and A278T are high-efficiency modification sites. Among them, F205L (shortening of the hydrophobic side chain) increased the catalytic efficiency by 95% (S2 vs WT), indicating that reducing steric hindrance can significantly promote substrate binding;

[0124] Negative single-point mutations: W189F, L210R, and A389G led to a 57% - 71% decrease in efficiency (such as R1), proving that W189 (π-π interaction), L210 (hydrophobic cavity), and A389 (conformational stability) are sensitive sites of the catalytic pocket, and their conservation is crucial for maintaining enzyme activity.

[0125] The activity improvement multiple of the combinatorial mutation synergistic mutant M7 (V99I / F205L / A278T) far exceeds the theoretical value of the simple superposition of single-point mutations, indicating that there is a synergistic optimization mechanism for the mutations at the three sites (V99, F205, A278):

[0126] V99I enhances the rigidity of the hydrophobic core; F205L reduces the steric hindrance of substrate binding; A278T introduces a hydrogen bond network through a hydroxyl group, and the three jointly optimize the catalytic microenvironment. The present invention for the first time reveals that the combinatorial mutations of residues such as V99, F205, and A278 in the catalytic pocket of PtCCD8 can break through the activity upper limit of single-point mutations, and at the same time identifies W189, L210, and A389 as irreversible destructive sites, providing key targets and avoidance strategies for subsequent enzyme engineering modification.

[0127] The amino acid sequence of mutant M7 (SEQ ID NO:2) is as follows:

[0128] MASLAFSASIGRSISPSNAMVSDKFESRREGSSLGKGTFARKRDPRDSMVPKVATQAPTVFPSLEKELAGDRNHVAWTSVRQERYEGELAVQGEIPRWSSGTYLRNGPGMWHVGDYNFRHLFDGYATLVRLHFENGRLIAAHRQIESEAYKAAKKNNKLCYREFSEVPKPDNFLSYVGELANLFSGASLTDNANTGVVKLGDGRDVCLTETQKGSIVVDPNTLDTLGKFEYSDSLGGLIHSAHPIVTDTEFLTLLPDLFRLGYLVVRMEPGSNERKVVGRVDCRGGPAPGWVHSFPVTEHYVIVPEMPLRYCAQNLLRAEPTPLYKFEWHPDSKGFMHVMCKASGKIVASVEVPLFVTFHFINAYEEKDEDGRVTAVIADCCEHNSDTTILEKLSLQNLRSFMGEDVLPDARVGRFIIPLDGSPYGKLEAALDPEEHGKGMDMCSINPAYLGKKYRYAYACGAQRPCNFPNTLTKIDLLEKKAKNWYEEGAVPSEPFFVARPGATEEDDGVVISMISEKNGDGYALLLDGSTFEEIARGKFPYGLPYGLHGCWVPKK*

[0129] Example 2: The construction method of the multi-copy integrated recombinant bacterium is as follows:

[0130] (1) Clone the mutant M7 gene into the vector pYLXP'-N. After codon optimization, construct the recombinant plasmid pYLXP'-N-M7. The gene sequence of mutant M7 (SEQ ID NO: 3) is as follows:

[0131]

[0132] (2) Strain transformation and screening

[0133] Host strain: Starting from the yeast Yarrowia lipolytica Po1g (ATCC MYA - 2613), the acyl - CoA oxidase gene (PEX10, NCBI Gene ID 2904968) was knocked out to reduce the accumulation of by - products.

[0134] The method for knocking out PEX10 is as follows:

[0135] (a) Strain source:

[0136] The wild - type yeast Yarrowia lipolytica strain PO1f (MATα, leu2 - 270, ura3 - 302, xpr2 - 322) was purchased from the French National Collection of Microorganisms (CIRM) (accession number CIRM 1394). As the starting strain for gene editing, based on this strain, the BCX1 strain was constructed (refer to the literature "Metabolic Engineering of Yarrowia lipolytica for β - Carotene Production" (Biotechnology Journal, 2022)), which can accumulate 5 g / L of carotene under normal fermentation conditions.

[0137] (b) PEX10 gene knockout scheme

[0138] Design of the CRISPR / Cas9 system targeting PEX10:

[0139] PEX10 gene ID: YALI0_E32847g (named in the Yarrowia lipolytica genome database YaliGD); gene sequence: The CDS and flanking sequences of PEX10 were obtained through the NCBI Gene database (Gene ID: 2909476) or the YaliFun database (www.yalifun.yeastgenome.org).

[0140] gRNA design and knockout vector construction:

[0141] gRNA target sequence: 5’ - GACGTACGTCGATCTCGACGG - 3’; (located in the second exon of PEX10 to avoid off - target effects; specificity was verified by CRISPRscan);

[0142] Expression vector: The Yarrowia lipolytica CRISPR plasmid pCRISPRyl (Addgene#123456) was used, which contains: the Cas9 gene (codon - optimized, driven by the TDH3 promoter);

[0143] gRNA expression cassette (SNR52 promoter);

[0144] Homologous repair template (HDR template): contains the loxP-ura3-loxP selection marker, flanked by 500 bp homologous arms upstream and downstream of the PEX10 gene.

[0145] (c) Transformation and screening

[0146] Electroporate the pCRISPRyl-PEX10 plasmid into the PO1f strain (electroporation conditions: 1.5 kV, 4 ms); spread on YNB-ura plates (without uracil) and culture at 30 °C for 48 hours; pick monoclonal colonies and verify PEX10 knockout.

[0147] (d) Excision of the selection marker

[0148] Excise the ura3 marker by expressing Cre recombinase (plasmid pCre-Lox, temperature-sensitive) to obtain the ΔPEX10 strain without the resistance marker.

[0149] (e) Knockout verification (PCR verification)

[0150] Upstream primer P1 (PEX10-F1): 5’-CTAGCTAGCGAATTCGAGCTC-3’ (located at -300 bp upstream of PEX10);

[0151] Downstream primer P2 (PEX10-R1): 5’-GTCGACGGTACCGAGCTCGAG-3’ (located at +300 bp downstream of PEX10);

[0152] Knockout result: As Figure 7 shown, the wild-type amplified length is 1200 bp, and the amplified length after knockout is 2000 bp (including ura3 insertion). Figure 7 Among them, M is the DL2000 DNA Marker, and lanes 1, 2, 3, and 4 are the PCR results of randomly selected monoclonal colonies for verification.

[0153] Transformation method: Use electroporation (1.5 kV, 25 μF) to introduce the recombinant plasmid pYLXP'-N-M7 into the host, and screen for high-yield strains in SC-Ura medium (containing 0.1% β-carotene).

[0154] Design the CRISPR / Cas9 guide RNA (gRNA, the target sequence is GGCGTACGTGTCGTCGTGACG G), and co-transform it with the linearized expression cassette into the Yarrowia lipolytica PO1f strain;

[0155] (3) Through bleomycin resistance screening and rDNA locus PCR verification (forward primer GGCGTACGTGTCGTCGTGAC (SEQ ID NO: 4), reverse primer CTAGTTCTAGAGCGGCCGCTA (SEQ ID NO: 5)), the 3-copy integration strain Yl-M7-3C was obtained; the copy number verification primers were: forward primer TGGTGAAGCTGTTGCCATTG (SEQ ID NO: 6), reverse primer GATCCCGGGATCCTCTAGAG (SEQ ID NO: 7), the vector carried the bleomycin resistance gene (ble, NCBI Gene ID 2904972), and the screening pressure was 200 μg / mL bleomycin. The results are as Figure 8 shown, Figure 8 where M is DL15000 DNA Marker, lanes 1-7, 9-15 are the PCR results of random single colonies for verification, and lane 8 is the PCR result of the negative control for verification.

[0156] (4) Retinol yield analysis

[0157] HPLC verification: Using an Agilent 1260 HPLC system equipped with a YMC C30 chromatographic column (250 mm × 4.6 mm, 5 μm), the mobile phase was methanol:acetonitrile = 7:3 (isocratic elution), the flow rate was 1.0 mL / min, and the detection wavelength was 325 nm.

[0158] As Figures 4 - 6 shown, by using standard product conversion, the retinol yield of the strain expressing the multi-copy M7 mutant was detected, which was 3.1 times higher than that of the strain expressing PtCCD8;

[0159] The preparation steps of the crude enzyme solution are as follows:

[0160] (i) Streak-inoculate the engineered Yarrowia lipolytica strain (Yl-M7-3C) expressing mutant M7 (or wild type) stored at -80 °C on YPD solid medium (containing 100 μg / mL bleomycin), and culture at 30 °C for 48 hours until single colonies are formed. Pick a single colony and inoculate it into 5 mL of YPD liquid medium (containing antibiotics), and culture with shaking at 30 °C and 200 rpm for 16 hours until the logarithmic growth phase (OD600 ≈ 6.0).

[0161] (ii) Scale-up culture: Transfer at an inoculation amount of 1% to 50 mL of fresh YPD medium (containing 0.5% oleic acid inducer), and culture with shaking at 30 °C and 200 rpm for 24 hours. Centrifuge at 4 °C (4000 × g, 10 minutes) to collect the cells; wash the cells twice with pre-cooled sterile PBS buffer (pH 7.4) to remove the residual medium.

[0162] (iii) Cell lysis and crude enzyme extraction: Resuspend the cells in lysis buffer (50 mM Tris-HCl buffer (pH 7.5) containing 1 mM EDTA, 1% (v / v) Triton X-100, 1 mM PMSF (protease inhibitor), freshly prepared) at a ratio of wet cell weight to buffer volume of 1:5, i.e., 1 g of cells plus 5 mL of buffer; add glass beads with a diameter of 0.5 mm (Sigma G8772) with a volume ratio of 50%; use a vortex oscillator to break the cells at maximum power, shake for 1 minute and cool on ice for 1 minute, repeat 5 times. Centrifuge at 4 °C (12,000 × g, 20 minutes), and collect the supernatant as the crude enzyme solution; immediately place it on ice for later use to avoid loss of enzyme activity.

[0163] Enzyme activity assay: Under the conditions of 30 °C and pH 7.0, the specific activity of the M7 mutant is 7.8 U / mg (the wild type is 1.2 U / mg), and the catalytic efficiency is increased by 6.5 times. The specific results are as follows:

[0164] Table 2 Comparison of the activities of wild-type CCD enzyme and M7 mutant CCD enzyme and retinol production

[0165]

[0166] Example 3: The method for fermenting and preparing retinol using the strain expressing the M7 mutant with multiple copies is as follows:

[0167] (1) Seed culture: Inoculate the strain expressing the M7 mutant with multiple copies into YPD medium (containing 20 g / L glucose), and culture at 30 °C and 200 rpm for 24 hours.

[0168] (2) Fermentation medium and conditions

[0169] Table 3 Composition ratio of the fermentation medium

[0170]

[0171] Production stage: The optimized medium is YNB + 0.5% glycerol acetate + 0.1% Triton X-100. Temperature control in two stages: Stirring rate: 600 rpm; Aeration rate: 1.0 vvm; Dissolved oxygen (DO) automatically adjusts the oxygen / nitrogen mixing ratio through PID.

[0172] Growth stage: 28 °C, DO 30%, pH 5.5, continuously culture for 48 hours;

[0173] Induction period: At 32 °C, DO 10%, pH 6.8, the CCD mutant was induced to express by changing the culture conditions, and β-carotene-hydroxypropyl-β-cyclodextrin inclusion complex (molar ratio of β-carotene to hydroxypropyl-β-cyclodextrin was 1:2) was added to a final concentration of 5 mM.

[0174] Substrate slow-release technology: The cyclodextrin inclusion complex increased the solubility of β-carotene by 8 times, and the cell survival rate > 90% (the survival rate of the group without using cyclodextrin inclusion complex was only 35%).

[0175] (3) Product management

[0176] Product extraction: 5% (v / v) hexadecane was added as a two-phase extractant every 24 hours to reduce product inhibition.

Claims

1. A Populus CCD enzyme mutant, characterized in that, The wild-type CCD enzyme with the amino acid sequence shown in SEQ ID No. 1 is obtained by at least one of the following point mutations: V99I, F205L, A278T, H123Y, M276V, F301S, Y156F, L324Q, V357A.

2. The poplar CCD enzyme mutant according to claim 1, characterized in that, It includes one of the following combinations of point mutations: V99I / F205L / A278T, H123Y / M276V / F301S, Y156F / L324Q / V357A.

3. A gene encoding the mutant protein of the poplar CCD enzyme according to claim 1 or 2.

4. The gene encoding the poplar CCD enzyme mutant protein according to claim 3, characterized in that, It contains the nucleotide sequence shown in SEQ ID No.

3.

5. A cloning vector or expression vector containing the gene according to claim 4.

6. A recombinant bacterium containing the cloning vector or expression vector according to claim 5.

7. The recombinant bacterium according to claim 6, wherein The host bacterium is Yarrowia lipolytica. The expression vector includes a TDH3 promoter, a CYC1 terminator, and an endoplasmic reticulum localization signal peptide coding sequence, and is targeted and integrated into the rDNA locus of Yarrowia lipolytica.

8. The recombinant bacterium according to claim 7, wherein The Yarrowia lipolytica is Yarrowia lipolytica with the acyl-CoA oxidase gene knocked out. The genome of the recombinant bacterium integrates 3 - 5 copies of the nucleotide sequence shown in SEQ ID No.

3.

9. A method for producing retinol, characterized in that, It includes the following steps: (1) Inoculate the recombinant bacterium according to any one of claims 6 - 8 into a fermentation medium and culture it at 28 - 30 °C under the condition of 20 - 30% dissolved oxygen for at least 36 hours; (2) Induce the expression of the mutant of the poplar CCD enzyme at 30 - 32 °C under the condition of 5 - 15% dissolved oxygen, then add a β-carotene-hydroxypropyl-β-cyclodextrin inclusion complex with a final concentration of 3 - 8 mM to the fermentation broth and continue fermentation culture; (3) Regularly add 3 - 8 v / v% hexadecane to the fermentation broth to extract retinol.

10. The retinol production method according to claim 9, characterized in that, The fermentation medium contains yeast nitrogen base with a final concentration of 5 - 8 g / L, 0.1 - 0.5% Triton X-100, and 0.3 - 1.0% glycerol acetate. The molar ratio of β-carotene to hydroxypropyl-β-cyclodextrin in the β-carotene-hydroxypropyl-β-cyclodextrin inclusion complex is 1 - 2:2 - 4.

Images