USP14 mutant and application thereof

By designing the highly active USP14 mutant R293D, the existing USP14 inhibitor toxicity and screening problems were solved, and efficient preparation and drug screening of tumor and neurodegenerative disease models were achieved, providing a new therapeutic strategy.

CN120290531APending Publication Date: 2025-07-11BEIJING INST OF TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510447750.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-10
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

The existing USP14 inhibitors have dose-limiting toxicity in clinical trials, and it is difficult to build an in vitro drug screening system, making it difficult to achieve high selectivity and high activity USP14 inhibition, affecting the therapeutic effect of tumors and neurodegenerative diseases.

Method used

Design and express a highly active USP14 mutant containing specific amino acid sequence mutations, such as R293D, for the preparation of tumor and neurodegenerative disease models as the only target for drug screening.

Benefits of technology

In vitro screening of highly active USP14 mutants is achieved, enabling efficient tumor and neurodegenerative disease models, providing new therapeutic strategies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290531A_ABST
    Figure CN120290531A_ABST
Patent Text Reader

Abstract

The invention discloses a USP14 mutant and application thereof, and belongs to the technical field of bioengineering, and the amino acid sequence of the USP14 mutant is as shown in SEQ ID No.2. The USP14 mutant is high in activity and has dose dependence, the mutant can be used as a unique target spot for drug screening, and tumor cell lines or tumor models and neurodegenerative disease models can be prepared by expressing the mutant in cells.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, and specifically relates to a USP14 mutant with high activity and its uses. Background Art

[0002] The ubiquitin-26S proteasome system (UPS) is crucial for maintaining intracellular protein homeostasis in eukaryotic cells. The 26S proteasome is a large macromolecular complex composed of a 19S regulatory particle (RP) and a 20S core particle (CP). Among them, the 19S regulatory particle provides energy through ATP hydrolysis, and is responsible for deubiquitinating the substrate protein, unfolding it into a linear polypeptide chain and transporting it into the 20S core particle; while the 20S core particle degrades the unfolded substrate through its proteolytic activity. Ubiquitination modification is a cascade reaction catalyzed sequentially by E1 activating enzyme, E2 conjugating enzyme and E3 ligase, and covalently links the ubiquitin chain to the substrate protein through an isopeptide bond. As the reverse process of ubiquitination, deubiquitination is catalyzed by deubiquitinase (DUB). DUBs can hydrolyze the ester bond, peptide bond or isopeptide bond at the carboxyl terminus of ubiquitin, and cleave the ubiquitin molecule from the ubiquitinated protein or precursor protein, thereby maintaining the dynamic balance of ubiquitin and protein in the cell. The synergistic effect of these two reversible processes of ubiquitination and deubiquitination can precisely regulate the type and degree of ubiquitination modification of proteins, and further affect the functional state and metabolic fate of target proteins, playing an important regulatory role in key biological processes such as cell division and differentiation, and signal transduction.

[0003] USP14 is a deubiquitinating enzyme that specifically binds to the 26S proteasome. When recruited to the 19S regulatory particle, USP14 can be activated and play a regulatory role by cleaving the ubiquitin chain on the substrate protein, preventing the proteasome from recognizing and degrading the target protein. Correspondingly, inhibiting USP14 can enhance the degradation activity of the proteasome. Recent studies have shown that USP14 exhibits amplification and overexpression characteristics in various malignant tumors: in liver cancer, the expression level of USP14 in patients' tumor tissues is significantly higher than that in adjacent tissues and normal liver tissues. By inhibiting USP14, the proliferation of liver cancer cells can be effectively inhibited, cell cycle arrest (mainly arrested in the G0 / G1 phase) can be induced, and apoptosis can be promoted; in breast cancer, the expression of USP14 in tumor tissues is significantly increased. Knocking down USP14 can inhibit the proliferation and metastasis ability of breast cancer cells and induce apoptosis; in non-small cell lung cancer (NSCLC), the mRNA expression level and protein expression level of USP14 in cancer tissues are significantly higher than those in normal lung cells. Downregulating USP14 can block the tumor cell cycle process and inhibit its proliferation activity. In addition, USP14 is also involved in the pathological process of neurodegenerative diseases: studies have shown that USP14 is a key regulatory factor for maintaining the local monomer ubiquitin level at synapses and the open state of neuromuscular junctions. Mice deficient in USP14 show movement disorders such as ataxia; in the hippocampal model of Alzheimer's disease (AD), the absence of USP14 leads to a significant decrease in ubiquitin levels and transient synaptic plasticity defects.

[0004] Based on the above findings, USP14 has been established as a novel target for cancer treatment and a potential intervention target for neurodegenerative diseases. Currently, a series of progress has been made in the development of USP14 inhibitors: b-AP15, as the first reported USP14 inhibitor, can selectively block its deubiquitinase activity without affecting proteasome function. In xenograft mouse models, b-AP15 showed definite anti-tumor activity and could overcome the resistance of tumor cells to proteasome inhibitors. The derivative VLX1570 obtained by structural optimization of b-AP15 not only had a significantly improved solubility but also enhanced inhibitory potency, and has now been approved by the US FDA to enter the Phase I / II clinical study for multiple myeloma. However, due to the dose-limiting toxicity (mainly manifested as grade 3 liver toxicity) shown by VLX1570 in clinical trials, the related research is temporarily on hold. In addition, the highly selective USP14 inhibitor IU1, first reported by the Daniel Finley team at Harvard Medical School in 2010, showed neuroprotective effects in disease models: IU1 treatment could significantly reduce neuronal damage caused by ischemic stroke, manifested as increased mouse survival rate, reduced cerebral infarction volume, and decreased neuronal loss; at the same time, IU1 could also promote the degradation of neurodegeneration-related pathological proteins such as tau protein, TDP-43, and abnormal prion protein through the UPS pathway. Current research is dedicated to optimizing the activity, selectivity, and druggability of USP14 inhibitors to provide new strategies for the treatment of tumors and neurodegenerative diseases.

[0005] It is worth noting that the enzyme activity of wild-type USP14 is extremely low in the free state, and this autoinhibition phenomenon is closely related to its unique structural characteristics. The human USP14 protein contains two functional domains: the ubiquitin-like domain (UBL) and the catalytic domain (CAT). Among them, the UBL domain can bind to the catalytic domain through intramolecular interactions to form a steric hindrance effect; in addition, two loops, BL1 and BL2, located near the catalytic center further hinder the entry of the substrate into the active pocket, jointly maintaining the basic low-activity state of USP14. The complete activation of USP14 requires two mechanisms: binding to the 26S proteasome or receiving phosphorylation modification by kinases such as Akt. However, these two activation methods that rely on the host regulatory system (such as conformational changes induced by proteasome binding, phosphorylation at the Ser432 site, etc.) make it difficult to construct an in vitro drug screening system. Existing studies mostly use truncated USP14 (Δ70-82) to relieve autoinhibition, but its catalytic activity is still lower than the fully activated form under physiological conditions, which poses a technical challenge to the functional verification of inhibitors. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide a USP14 mutant with high activity, which can be used as the only target for screening small molecule drugs and can be used to prepare tumor models or tumor cell lines and neurodegenerative disease models.

[0007] The technical solution of the present invention is: a USP14 mutant, the amino acid sequence of which is shown in SEQ ID No.2.

[0008] A gene encoding the above-mentioned mutant.

[0009] Further, the nucleotide sequence of the gene is shown in SEQ ID No.3.

[0010] An expression vector containing the above-mentioned gene.

[0011] A host cell containing the above-mentioned expression vector.

[0012] Use of the above-mentioned USP14 mutant in in vitro drug screening.

[0013] Use of the above-mentioned gene, expression vector or host cell in preparing a tumor model or tumor cell line or preparing a neurodegenerative disease model.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The mutant described in the present application has high activity and shows dose-dependence. The mutant can be used as the only target for drug screening in vitro, and expressing the mutant in cells can prepare tumor cell lines or tumor models and neurodegenerative disease models. Description of the Drawings

[0016] Figure 1 It is a sequencing schematic diagram of a plasmid made using the R293D point mutation gene;

[0017] Figure 2 It is a sequencing schematic diagram of a plasmid made using the V329A point mutation gene;

[0018] Figure 3 It is a sequencing schematic diagram of a plasmid made using the E264S point mutation gene;

[0019] Figure 4 It is a sequencing schematic diagram of a plasmid made using the R307S point mutation gene;

[0020] Figure 5 It is a sequencing schematic diagram of a plasmid made using the K300A point mutation gene;

[0021] Figure 6It is the sequencing schematic diagram of the plasmid prepared using the K300L point mutant gene;

[0022] Figure 7 It is the sequencing schematic diagram of the plasmid prepared using the R307E point mutant gene;

[0023] Figure 8 It is the sequencing schematic diagram of the plasmid prepared using the F278A point mutant gene;

[0024] Figure 9 It is the sequencing schematic diagram of the plasmid prepared using the S432E point mutant gene;

[0025] Figure 10 It is the SDS-PAGE result of the separation and purification of the USP14 protein R293D mutant by affinity chromatography column. The M lane is the protein Marker, the WC lane is the whole protein sample after the bacteria are ultrasonically disrupted, the S lane is the protein supernatant sample after ultra-low temperature centrifugation, the FT lane is the flow-through sample after the supernatant binds to the affinity chromatography column twice, the W lane is the sample of the affinity column material after washing the affinity column with Washbuffer, and the E lane is the elution sample of the Elution buffer;

[0026] Figure 11 It is the result of the USP14 protein R293D mutant on the Hirtrap Q ion exchange chromatography column and its SDS-PAGE results of tubes 5-10;

[0027] Figure 12 It is the result of the USP14 protein R293D mutant on the SD200 molecular sieve column and its SDS-PAGE results of tubes 5-10;

[0028] Figure 13 It is the schematic diagram of the in vitro deubiquitinating enzyme activities of the wild type and different mutants under the conditions of an enzyme concentration of 200 nM and a substrate concentration of 1 μM. Detailed implementation methods

[0029] Unless otherwise specified, the experimental methods in the following examples are all conventional methods. Unless otherwise specified, the test materials used in the following examples are all purchased from commercial channels.

[0030] Definition

[0031] Ubiquitin-specific protease 14 (USP14) is a deubiquitinating enzyme that ubiquitously exists in eukaryotes and plays an important role in editing the length of ubiquitin chains and maintaining the stability of the free ubiquitin pool. It can regulate the degradation of target proteins through deubiquitination and participate in the occurrence and development of tumors and the nervous system through multiple signaling pathways. Therefore, USP14 is expected to become a highly potential target for the treatment of related diseases.

[0032] As used herein, the terms "homology", "identity", and "similarity" refer to sequence similarity between two nucleic acid molecules. Positions within each sequence can be compared to determine "homology", "identity", or "similarity", and the sequences can be aligned for purposes of comparison. When the equivalent positions in the compared sequences are occupied by the same base, the molecules are identical at that position; when the equivalent sites are occupied by the same or similar amino acid (e.g., similar in spatial or charged properties) residues, the molecules can be said to be homologous (similar) at that position. The expression of the percentage of homology / similarity or identity refers to a function of the number of identical or similar amino acids at positions shared by the compared sequences. An "unrelated" or "non-homologous" sequence shares less than 40% identity, preferably less than 25% identity, with the sequences of the present application. When comparing two sequences, the presence of deletions or additional residues (amino acids or nucleic acids) also reduces identity and homology / similarity. In a specific embodiment, for two or more sequences or subsequences, determination is made using the BLAST or BLAST 2.0 sequence comparison algorithms with the default parameters described below or by manual alignment and visual inspection, for example, provided online by the National Center for Biotechnology Information (NCBI). When comparing and aligning for maximum correspondence over a comparison window or specified region, if their sequences have an identity of about 60%, or about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher over the defined region, they can be considered to be substantially or significantly homologous, similar, or identical. This definition also pertains to or can be used to test the complement of a sequence. Thus, to the extent permitted by the context herein, for example, if a nucleotide sequence can be predicted to occur naturally in a DNA duplex or can occur naturally in the form of one or both of the complementary strands, a nucleotide sequence complementary to a specified target sequence or its variant is itself considered to be "similar" to the target sequence, and when referring to "similar" nucleic acid sequences, includes single-stranded sequences, their complementary sequences, double-stranded strand complexes, sequences capable of encoding the same or similar polypeptide products, and any permissible variants of any of the foregoing. Circumstances where similarity must be restricted to analysis of a single nucleic acid strand sequence can include, for example, detection and quantification of the expression of a specific RNA sequence or coding sequence in a cell. This definition also includes sequences with deletions and / or additions, as well as sequences with substitutions.In embodiments, the identity or similarity can be over a region of at least about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleotides, or over a region of more than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or more than about 100 nucleotides.

[0033] As used herein, the term "nucleotide" refers to naturally occurring nucleotides, as well as synthetic nucleotide analogs that can be recognized by cellular enzymes.

[0034] As used herein, the term "expression vector" refers to any naturally occurring or artificially constructed expression vector containing a nucleic acid molecule, wherein the nucleic acid molecule can be catalyzed by cellular transcriptional and / or translational enzymes. Exemplary expression vectors include: plasmids, viruses (including bacteriophages), cosmids, artificial chromosomes or transposons, etc. In some embodiments, the expression vector is a plasmid.

[0035] As used herein, the term "host cell" refers to any biological cell that can be cultured in a medium and used for expressing a recombinant gene. These host cells can be eukaryotic or prokaryotic cells, or can be microorganisms such as bacterial cells, or can be cells derived from a cell line (such as a mammalian immortalized cell line), etc. In some embodiments, the host cell is a prokaryotic cell, such as Escherichia coli.

[0036] As used herein, the term "recombinant" refers to a nucleic acid molecule or polypeptide that is located in a non-naturally occurring environment and is prepared by artificial intervention.

[0037] USP14 Mutant

[0038] This application provides a USP14 mutant, which contains a mutation based on a reference sequence, and the amino acid sequence of the reference sequence is shown in SEQ ID No.1.

[0039] The amino acid sequence of SEQ ID No.1 is as follows:

[0040]

[0041] The above sequence is the amino acid sequence of wild-type USP14.

[0042] In some embodiments, the amino acid of the mutant contains an amino acid mutation corresponding to the R293 site of SEQ ID No.1, preferably contains an amino acid mutation corresponding to the R293 site of SEQ ID No.1.

[0043] In the present application, for the above-mentioned site, the counting starts from the N-terminus. For example, for R293, it refers to the amino acid mutation at the 293rd amino acid starting from the N-terminus of SEQ ID No.1.

[0044] The term "corresponding to" has the meaning commonly understood by those of ordinary skill in the art. Specifically, "corresponding to" means the position on one sequence that corresponds to a specified position on another sequence after sequence homology or sequence identity alignment.

[0045] In the present application, the mutant may be the mutation of R at the 293rd position in SEQ ID No.1 to aspartic acid D.

[0046] In the present application, there is no limitation on the method of mutation. It can be mutated by conventional methods in the art. For example, it can be mutated by site-directed mutagenesis, random mutagenesis, or the construction of synthetic oligonucleotides. Then, the mutated DNA sequence is expressed in a host cell to obtain a mutant with amino acid sequence substitution, insertion, and / or deletion. In the present application, a mutant with amino acid substitution obtained by single-site mutation through the construction of synthetic oligonucleotides is used.

[0047] The mutant described in the present application has high deubiquitinating enzyme activity.

[0048] In the present application, there is no limitation on the method for measuring the deubiquitinating enzyme activity. It can be measured by conventional methods. For example, it can be measured by the method disclosed by Dang et al. See Dang LC, Melandri FD, Stein RL. Kinetic and mechanistic studies on the hydrolysis of ubiquitin terminal 7-amido-4-methylcoumarin by deubiquitinating enzymes. Biochemistry, 1998, 37(7): 1868 - 1879.

[0049] In the present application, when R at the 293rd position is mutated to D, the amino acid sequence is as shown in SEQ ID No.2.

[0050] The amino acid sequence of SEQ ID No.2 is as follows:

[0051]

[0052] Those skilled in the art can also understand that the mutants are not limited to the specific sequences listed above. The sequences of the mutants should cover sequences that contain one or two or more than three nucleotide mutations compared with the sequence shown in SEQ ID No.2, but still substantially have the same essential functions as it, and also include sequences that have 95%, 96%, 97%, 98% or 99% sequence identity compared with the sequence shown in SEQ ID No.2.

[0053] The present application provides a USP14 mutant, which contains the amino acid sequence shown in SEQ ID No.2 or the amino acid sequence shown in SEQ ID No.2.

[0054] Nucleic Acid Molecule, Expression Vector and Host Cell

[0055] The present application provides a nucleic acid molecule, which contains a sequence encoding the USP14 mutant described in any one of the above. In some embodiments, the nucleic acid molecule contains the sequence shown in SEQ ID No.3 or the sequence shown in SEQ ID No.3.

[0056] In some embodiments, the nucleotide sequence encoding the above USP14 mutant is codon-optimized. Generally, codon optimization involves balancing the percentage of the selected codons with the abundance of the published human transfer RNAs so that none of them is overloaded or restricted. In some cases, this may be necessary because most amino acids are encoded by more than one codon, and codon usage varies among organisms. The difference in codon usage between the transfected gene and the host cell may affect the protein expression and immunogenicity of the nucleic acid construct. Generally, for codon optimization, codons are selected to select those that are balanced with the human usage frequency. Generally, the redundancy of amino acid codons allows different codons to encode an amino acid. In some embodiments, when selecting the codons for substitution, it may be necessary that the resulting mutation is a silent mutation so that the codon change does not affect the amino acid sequence. Generally, the last nucleotide of the codon can remain unchanged without affecting the amino acid sequence.

[0057] The sequence of SEQ ID No.3 is as follows:

[0058]

[0059]

[0060] The present application provides an expression vector, which contains the nucleic acid molecule described above. In some embodiments, the expression vector is a plasmid, cosmid, phage or viral vector, preferably a plasmid.

[0061] For example, the nucleic acid molecule encoding the above mutant can be cloned into a suitable expression vector, which can be any suitable recombinant expression vector and can be used to transform or transfect any suitable host. Suitable vectors include those designed for propagation and amplification or for expression or for both, such as plasmids and viruses. In some embodiments, the expression vector is a plasmid.

[0062] In the present application, the expression vector may contain regulatory sequences (such as transcription and translation start and stop codons), which are specific to the type of host to be introduced into the vector (e.g., bacteria, fungi, plants, or animals), taking into account as appropriate whether the vector is DNA-based or RNA-based. The vector may also contain a non-native promoter operably linked to the nucleotide sequence encoding the above mutant. The promoter may be a non-viral promoter or a viral promoter, such as the cytomegalovirus (CMV) promoter, SV40 promoter, RSV promoter, and the promoter found in the long terminal repeat of murine stem cell virus, and other promoters known to those skilled in the art are also contemplated. In the present application, the recombinant vector includes, in the 5' to 3' direction: a promoter, a GST tag, the gene of interest, and a terminator. In addition, the recombinant vector should also include a selection marker, such as an antibiotic resistance gene.

[0063] The present application provides a host cell comprising the above-described expression vector.

[0064] In the present application, the expression vector is transformed into a host cell for further expression or cloning in the host cell. In some embodiments, a method for preparing a USP14 mutant is provided, the method comprising culturing a host cell as provided above comprising a nucleic acid encoding a USP14 mutant under conditions suitable for expressing the USP14 mutant, and optionally inducing with an inducer and recovering the USP14 mutant from the host cell (or host cell culture medium). In some embodiments, the host cell is a eukaryotic cell, a prokaryotic cell, or a bacterial cell, preferably a prokaryotic cell, more preferably Escherichia coli.

[0065] The host cell refers to a cell into which exogenous nucleic acid has been introduced, including the progeny of such a cell. Host cells include transformants and transformed cells, which include primary transformed cells and their progeny, regardless of the number of passages. The progeny may not be identical to the parental cell in nucleic acid content but may contain mutations.

[0066] Use

[0067] The present application provides the use of the USP14 mutant described in any one of the above, the USP14 mutant encoded by the nucleic acid molecule described in any one of the above, the USP14 mutant expressed by the expression vector described in any one of the above, or the USP14 mutant produced by the host cell described in any one of the above in drug screening, preparing a tumor model or tumor cell line, and a neurodegenerative disease model.

[0068] The USP14 mutant provided by the present application can be used as the only target of USP14 for drug screening in vitro, and expressing the mutant intracellularly can prepare a tumor model or tumor cell line, and a neurodegenerative disease model.

[0069] Example

[0070] The present application generally and / or specifically describes the materials and test methods used in the experiments. In the following examples, unless otherwise specifically stated, % represents wt%, that is, weight percentage. Reagents or instruments without indicating the manufacturer can be obtained as conventional reagent products through commercial purchase.

[0071] Example 1 Construction of Recombinant Expression Plasmid of Wild-Type USP14

[0072] According to the DNA sequence SEQ ID No.1 of wild-type USP14, it was synthesized by BGI Tech Solutions Co., Ltd. (Beijing) and cloned into the pGEX-4T-2 plasmid vector to obtain the recombinant plasmid USP14-pGEX-4T-2.

[0073] Example 2 Construction of Expression Plasmid of High-Activity USP14 Mutant

[0074] Using the DNA sequence SEQ ID No.1 of wild-type USP14 as a template, R293D point mutation primers were designed:

[0075] Forward primer: CTTAAATTGGATCTTCAGGAAGAAATC (SEQ ID No.4)

[0076] Reverse primer: TTCCTGAAGATCCAATTTAAG (SEQ ID No.5)

[0077] Using the DNA sequence SEQ ID NO:1 of wild-type USP14 as a template, V329A point mutation primers were designed:

[0078] Forward primer: ATTCAGATGGCACGATTTTTTTATAAA (SEQ ID No.6)

[0079] Reverse primer: AAAAAATCGTGCCATCTGAAT (SEQ ID No.7)

[0080] Design E264S point mutation primers using the DNA sequence SEQ ID NO:1 of wild-type USP14 as a template:

[0081] Forward primer: GAAGAAGAAAGCGTCACCAAAGGAAAG (SEQ ID No.8)

[0082] Reverse primer: TTTGGTGACGCTTTCTTCTTC (SEQ ID No.9)

[0083] Design R307S point mutation primers using the DNA sequence SEQ ID NO:1 of wild-type USP14 as a template:

[0084] Forward primer: ACGTTGCAAAGCAATGCCTTGTATATC (SEQ ID No.10)

[0085] Reverse primer: CAAGGCATTGCTTTGCAACGT (SEQ ID No.11)

[0086] Design K300A point mutation primers using the DNA sequence SEQ ID NO:1 of wild-type USP14 as a template:

[0087] Forward primer: GAAATCACCGCACAGTCTCCAACGTTG (SEQ ID No.12)

[0088] Reverse primer: TGGAGACTGTGCGGTGATTTC (SEQ ID No.13)

[0089] Design K300L point mutation primers using the DNA sequence SEQ ID NO:1 of wild-type USP14 as a template:

[0090] Forward primer: GAAATCACCCTTCAGTCTCCAACGTTG (SEQ ID No.14)

[0091] Reverse primer: TGGAGACTGAAGGGTGATTTC (SEQ ID No.15)

[0092] Design R307E point mutation primers using the DNA sequence SEQ ID NO:1 of wild-type USP14 as a template:

[0093] Forward primer: ACGTTGCAAGAGAATGCCTTGTATATC (SEQ ID No.16)

[0094] Downstream primer: CAAGGCATTCTCTTGCAACGT (SEQ ID No.17)

[0095] Design the F278A point mutation primers using the DNA sequence SEQ ID NO:1 of wild-type USP14 as a template:

[0096] Upstream primer: CTTAGCTGTGCAATCAATCAGGAAGTC (SEQ ID No.18)

[0097] Downstream primer: CTGATTGATTGCACAGCTAAG (SEQ ID No.19)

[0098] Design the S432E point mutation primers using the DNA sequence SEQ ID NO:1 of wild-type USP14 as a template:

[0099] Upstream primer: AGGTCTAGTGAATCAGGTCATTATGTATC (SEQ ID No.20)

[0100] Downstream primer: ATGACCTGATTCACTAGACCTTC (SEQ ID No.21)

[0101] PCR reaction system:

[0102]

[0103] PCR program: 95°C for 30 seconds, (95°C for 15 seconds, 55°C for 15 seconds, 72°C for 3 minutes) × 30 cycles, 72°C for 3 minutes.

[0104] After purifying and recovering the PCR products using a DNA gel extraction kit, transform the DH5α expression host bacteria, inoculate them into a sterilized antibiotic-free LB medium, shake culture at 37°C for 40 minutes, and then spread them on plates (containing 100 μg / cm of ampicillin 2 ). After overnight culture, pick single colonies into 200 μl of sterilized medium (containing 100 μg / ml of ampicillin), shake culture at 37°C for 8 h, and then send them to Beijing Liuhe Huada Gene Technology Co., Ltd. for sequencing. The results are as Figures 1-9 shown to determine the plasmid containing the mutant. After correct sequencing, return the plasmid.

[0105] Example 3 Expression and purification of highly active USP14 mutants

[0106] Transform the BL21(DE3) expression host bacteria with the plasmid obtained in Example 2, inoculate them into a sterilized antibiotic-free LB medium, shake culture at 37°C for 40 minutes, and then spread them on plates (containing 100 μg / cm of ampicillin 2), After overnight cultivation, pick monoclonal colonies into 1000 ml of sterilized medium (containing 100 μg / ml ampicillin), and culture with shaking at 37 °C until the OD 600 value reaches about 0.6, then add IPTG (final concentration 0.5 mM), adjust the temperature to 22 °C, and induce expression for 12 hours. Harvest the bacteria (at 4 °C, 4000 rpm, centrifuge for 12 minutes), pour out the waste liquid, resuspend with lysis buffer (25 mM Tris, 150 mM NaCl, 2 mM DTT, pH 7.5), sonicate, and then centrifuge at 4 °C, 14000 rpm for 45 minutes to separate the supernatant and precipitate. Collect the supernatant and combine it with an affinity column (GE Healthcare: GS4B). Then use PPase enzyme (10 mg / ml, 50 μl) to digest at room temperature for two hours, and then elute with Lysis buffer.

[0107] Pass the eluted protein successively through an anion exchange column (GE pre-packed column Source 15Q) and a gel filtration chromatography column (GE pre-packed column Superdex 200 Increase 10 / 300GL) to obtain a highly pure and highly active USP14 mutant. ( Figures 10-12 )

[0108] Example 4 Identification of the deubiquitinating enzyme activity of the highly active USP14 mutant

[0109] Dang et al. developed a general assay method for the deubiquitinating enzyme activity based on the substrate ubiquitin C-terminal-7-amido-4-methylcoumarin (Ub-AMC) (Dang LC, Melandri FD, Stein RL. Kinetic and mechanistic studies on the hydrolysis of ubiquitin cterminal 7-amido-4-methylcoumarin by deubiquitinating enzymes. Biochemistry, 1998, 37(7):1868 - 1879). When the deubiquitinating enzyme reacts with the deubiquitinating enzyme fluorescent probe (Ub-AMC), AMC is hydrolyzed and released, and thus an increase in fluorescence can be measured. The activity of the deubiquitinating enzyme is measured by detecting the increase in fluorescence. Reaction system: 50 mM Tris pH = 7.5, 1 mM EDTA, 1 mM ATP, 5 mM MgCl2, 1 mM DTT. After adding the USP14 mutant, quickly add 1 μM Ub-AMC, and monitor the hydrolysis reaction of Ub-AMC at Emission Wavelength 380 nm and Emission Wavelength 460 nm.

[0110] From Figure 13 It can be seen that under the conditions of an enzyme concentration of 200 nM and a substrate concentration of 1 μM, amino acid mutations at different sites of SEQ ID NO: 1 and the amino acids used for substitution result in different mutants. Compared with the wild-type USP14 and the only reported active USP14 mutant carrying the S432E mutation (the last item in the figure), when D is used to replace R at position 293, the activity of the obtained mutant is significantly improved.

[0111] In addition, from Figure 13 it can be seen that the mutant (R293D) provided in the present application has significantly improved activity compared with other USP14 mutants, indicating that the highly active USP14 mutant can be used for drug screening targeting USP14 only in vitro. Expressing the highly active USP14 mutant in cells can prepare tumor cell lines or tumor models and neurodegenerative disease models.

Claims

1. USP14 mutant, characterized in that, Its amino acid sequence is as shown in SEQ ID No.

2.

2. A gene encoding the mutant according to claim 1.

3. The gene according to claim 2, wherein The nucleotide sequence of said gene is as shown in SEQ ID No.

3.

4. An expression vector containing the gene according to claim 2 or 3.

5. A host cell containing the expression vector according to claim 4.

6. Use of the USP14 mutant according to claim 1 in in vitro drug screening.

7. Use of the gene according to claim 2 or 3, or the expression vector according to claim 4, or the host cell according to claim 5 in preparing a tumor model or a tumor cell line or preparing a neurodegenerative disease model.