OsNRAMP5M235A mutant gene, protein and application
By mutating the OsNRAMP5 gene in rice, the 235th methionine encoded protein was mutated to alanine, which solved the problem of excessive cadmium content in rice in extremely cadmium-contaminated fields, and achieved a significant reduction in the cadmium content in rice and the provision of germplasm resources.
Patent Information
- Application Number
- CN202510277302.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-10
- Publication Date
- 2025-07-11
AI Technical Summary
In the cultivation of extremely cadmium-contaminated fields, the existing OsNRAMP5 mutant rice germplasm still has the risk of excessive rice cadmium content, and it is necessary to create rice germplasm with lower cadmium content in rice.
By mutating the OsNRAMP5 gene in a directional mutation, the 235th methionine encoded protein was mutated to alanine. The OsNRAMP5M235A mutant gene was introduced into rice using a guided editing method, and genotyping was performed in combination with KASP typing primers to screen out rice germplasm with extremely low cadmium accumulation.
It significantly reduces the absorption of cadmium by rice, and the cadmium content of rice is significantly reduced under extreme cadmium pollution conditions, providing a wider range of areas with low cadmium accumulation rice germplasm resources and technical means, and improving the accuracy and efficiency of germplasm screening and identification.
Smart Images
Figure CN120290587A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of rice molecular breeding, and particularly relates to an OsNRAMP5 M235A mutant gene, protein and their application in molecular breeding of rice with extremely low cadmium accumulation. Background Art
[0002] Excessive cadmium in rice grains is one of the most influential problems on the development of the rice industry in recent years. Cultivating and planting rice with low cadmium accumulation is the most economical and effective technical strategy to solve this problem. Among various methods for creating rice germplasms with low cadmium accumulation, the rice germplasms created by overexpression or OsHMA3 mutation can be planted in severely cadmium-polluted fields (soil cadmium content within 1.5 mg / kg), and the cadmium content in their rice grains can stably be lower than the national limit standard of 0.2 mg / kg. OsNRAMP5 is the major gene involved in cadmium uptake in rice, and its mutation can significantly reduce the cadmium uptake of rice, thereby reducing the cadmium content in grains. However, when planted in extremely cadmium-polluted fields (soil cadmium content exceeding 5 mg / kg),
[0003] OsNRAMP5 the mutated rice germplasms still have the risk of excessive cadmium in rice grains. Therefore, it is necessary to create rice germplasms with lower cadmium content in rice grains when planted in extremely cadmium-polluted fields than OsNRAMP5 mutants. osnramp5 Summary of the Invention
[0004] The technical problem to be solved by the present invention is to overcome the above-mentioned deficiencies and defects in the background art, and provide a method for creating a rice germplasm that can be planted in extremely cadmium-polluted fields and has a lower cadmium content in rice grains than osnramp5 mutants, and also provide an OsNRAMP5 M235A mutant gene, an OsNRAMP5 M235A mutant protein, KASP genotyping primers and their application in cultivating rice with extremely low cadmium accumulation.
[0005] To solve the above technical problem, the technical solution proposed by the present invention is as follows: In the first aspect, the present invention provides an OsNRAMP5 M235A mutant gene, the nucleotide sequence of which is as shown in SEQ ID NO.19.
[0006] In the second aspect, the present invention provides an OsNRAMP5 M235A mutant protein, the amino acid sequence of which is as shown in SEQ ID NO.20.
[0007] In the third aspect, the present invention provides a method for using the above-mentioned OsNRAMP5 M235A mutant gene or OsNRAMP5 M235A Application of mutant protein in cultivating rice with extremely low cadmium accumulation.
[0008] The above application preferably includes the following steps: using the replacement of bases AT at positions 703-704 in the sequence shown in SEQ ID NO.19 with GC as the site-directed mutation target to construct an OsNRAMP5 M235A site-directed mutagenesis-guided editing vector, transforming the guided editing vector into rice by Agrobacterium-mediated method to obtain transgenic plants; identifying OsNRAMP5 M235A homozygous mutants in the offspring of the transgenic plants, thereby obtaining rice with extremely low cadmium accumulation.
[0009] Preferably, the construction of the OsNRAMP5 M235A site-directed mutagenesis-guided editing vector specifically includes the following steps: homologous recombination of the RT+PBS sequence into the pegRNA expression cassette, then amplifying the pegRNA expression cassette by two rounds of nested PCR and adding the target sequence thereto, and obtaining a guided editing vector containing the M235A dual-pegRNA expression cassette by the Golden Gate method; The target sequence and its RT+PBS sequence are as follows: OsNRAMP5 The nucleotide sequence of the sense-strand target M235As is as shown in SEQ ID NO.3; OsNRAMP5 The nucleotide sequence of the sense-strand RT+PBS sequence M235AsRP is as shown in SEQ ID NO.4; OsNRAMP5 The nucleotide sequence of the sense-strand target M235Aa is as shown in SEQ ID NO.5; OsNRAMP5 The nucleotide sequence of the sense-strand RT+PBS sequence M235AaRP is as shown in SEQ ID NO.6; The primers used for the homologous recombination are as follows: The nucleotide sequence of the homologous recombination primer M235AsRP-F for M235AsRP is as shown in SEQ ID NO.7; The nucleotide sequence of the homologous recombination primer M235AsRP-R for M235AsRP is as shown in SEQ ID NO.8; The nucleotide sequence of the homologous recombination primer M235AaRP-F for M235AaRP is as shown in SEQ ID NO.9; The nucleotide sequence of the homologous recombination primer M235AaRP-R for M235AaRP is as shown in SEQ ID NO.10; The primers used for the two rounds of nested PCR are as follows: The nucleotide sequence of the first-round nested PCR primer gRT235s-F is shown in SEQ ID NO.11; The nucleotide sequence of the first-round nested PCR primer U6aT235s-R is shown in SEQ ID NO.12; The nucleotide sequence of the first-round nested PCR primer gRT235a-F is shown in SEQ ID NO.13; The nucleotide sequence of the first-round nested PCR primer U6bT235a-R is shown in SEQ ID NO.14; The nucleotide sequence of the second-round nested PCR primer p-GL is shown in SEQ ID NO.15; The nucleotide sequence of the second-round nested PCR primer g-g2 is shown in SEQ ID NO.16; The nucleotide sequence of the second-round nested PCR primer p-G2 is shown in SEQ ID NO.17; The nucleotide sequence of the second-round nested PCR primer g-gR is shown in SEQ ID NO.18.
[0010] Preferably, the KASP genotyping primers for identifying the OsNRAMP5 M235A homozygous mutant are as follows: The sequence of 235AT-FAM is shown in SEQ ID NO.21; The sequence of 235GC-HEX is shown in SEQ ID NO.22; The sequence of 235-Common is shown in SEQ ID NO.23.
[0011] Preferably, the guide editing vector containing the M235A dual pegRNA expression cassette is prepared by the following method: respectively use Bsa I to digest the pYLCRISPR / Cas9knm-NG vector and the dual pegRNA expression cassette, ligate the dual pegRNA expression cassette to the pYLCRISPR / Cas9knm-NG vector, transform it into Escherichia coli, extract the plasmid, and obtain the guide editing vector pYLCRISPR / Cas9knm-M235A-NG.
[0012] Preferably, when transforming the guide editing vector into rice by the Agrobacterium-mediated method, the rice callus after Agrobacterium infection should also be transferred to a selection medium containing hygromycin for screening culture, and the resistant callus should be selected for differentiation culture to obtain transgenic plants containing the hygromycin resistance gene and the OsNRAMP5 M235A mutant gene.
[0013] Fifth aspect, the present invention provides a method for identifying the OsNRAMP5 M235A KASP genotyping primers for mutant genes, the KASP genotyping primers include 235AT-FAM, 235GC-HEX and 235-Common; the sequence of 235AT-FAM is shown in SEQ ID NO.21, the sequence of 235GC-HEX is shown in SEQ ID NO.22, and the sequence of 235-Common is shown in SEQ ID NO.23.
[0014] Sixth aspect, the present invention provides an application of the KASP genotyping primers in identifying OsNRAMP5 M235A mutant genes or in molecular breeding of rice with extremely low cadmium accumulation.
[0015] For the above application, preferably, it includes the following steps: using the KASP genotyping primers to genotype the gene to be identified. If the genotype is AT, it indicates a homozygote without the OsNRAMP5 M235A mutant gene. If the genotype is GC, it indicates a homozygote containing the OsNRAMP5 M235A mutant gene. If the genotype is AT / GC, it indicates a heterozygote.
[0016] Compared with the prior art, the beneficial effects of the present invention are: 1) The present invention provides a method for creating rice with extremely low cadmium accumulation. For the first time, the guide editing method is used to mutate the endogenous OsNRAMP5 gene of rice, for example, mutating methionine at the 235th position of its encoded protein to alanine, which greatly reduces the cadmium absorption of rice, resulting in a significant decrease in the cadmium content in the above-ground parts and rice grains of the mutant plants compared with osnramp5 the mutants.
[0017] 2) For the first time, it is found that the cadmium content in the rice grains of mutant rice carrying the OsNRAMP5 M235A mutant gene is lower than that of the osnramp5 mutants under the planting conditions of extremely cadmium-polluted soil. When planted in the identification pool with a total cadmium content of 19.2 mg / kg (available cadmium content of 13.3 mg / kg) in the soil, osnramp5 the cadmium content in the brown rice of the OsNRAMP5 M235A mutants is 1.617 - 1.751 mg / kg, while the cadmium content in the brown rice of the
[0018] directionally mutated plants is only 0.211 - 0.389 mg / kg, providing a new germplasm resource and technical means for cultivating cadmium-low-accumulating rice with a wider adaptation area. OsNRAMP5 M235AThe KASP genotyping primers for mutant genes can accurately genotype SNPs found by sequencing for different individuals, and can further improve the accuracy and efficiency of screening and identification of existing innovative germplasms. Brief Description of the Drawings
[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the drawings in the following description are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.
[0020] Figure 1 Schematic diagrams of the dual epegRNA (A in the figure) and the guide editing vector (B in the figure) of OsNRAMP5 in Example 1 of the present invention M235A
[0021] Figure 2 Detection results of the targeted mutation of OsNRAMP5 in the T0 generation (A in the figure) and the T1 generation (B in the figure) transgenic plants in Example 1 of the present invention M235A
[0022] Figure 3 Under the hydroponic condition of cadmium treatment at the seedling stage in Example 2 of the present invention, the cadmium content in the roots (A in the figure) and the above-ground parts (B in the figure) of the OsNRAMP5 targeted mutation lines and their controls; different lowercase letters indicate significant differences at the 0.05 level. M235A
[0023] Figure 4 When planted in the identification pool with a soil cadmium content of 19.2 mg / kg in Example 3 of the present invention, the cadmium content in the brown rice of the OsNRAMP5 targeted mutation lines and their controls; different lowercase letters indicate significant differences at the 0.05 level. M235A
[0024] Figure 5 In Example 4 of the present invention, using the KASP genotyping primers to OsNRAMP5 WT [AT] wild type and OsNRAMP5 M235A [GC] mutation for genotyping scatter plot; the upper left scatter point is OsNRAMP5 WT [AT] wild type homozygous line, the middle scatter point is OsNRAMP5 WT [AT] wild type and OsNRAMP5 M235A [GC] mutation heterozygous line, the lower left scatter point is NTC, and the lower right scatter point is OsNRAMP5 M235A [GC] Homozygous mutant line.
[0025] Figure 6 This was planted in the identification pool with a soil cadmium content of 19.2 mg / kg in Example 4 of the present invention. The cadmium content in the brown rice of the segregating population of the hybrid offspring of Yuetai B and OsNRAMP5 M235A the mutant and its control; different lowercase letters indicate significant differences at the 0.05 level. Detailed implementation manners
[0026] To facilitate the understanding of the present invention, the following will describe the present invention more comprehensively and meticulously in conjunction with the accompanying drawings of the specification and preferred embodiments. However, the protection scope of the present invention is not limited to the following specific embodiments.
[0027] Unless otherwise defined, all professional terms used hereinafter have the same meaning as commonly understood by those skilled in the art. The professional terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the protection scope of the present invention.
[0028] Unless otherwise specifically stated, various raw materials, reagents, instruments, and equipment used in the present invention can be obtained through market purchases or can be prepared by existing methods.
[0029] Example 1: The present invention performs directed mutagenesis on OsNRAMP5 the gene, changing the methionine (M) at the 235th position of its encoded protein to alanine (A). Specifically, the bases at positions 703-704 in the sequence shown in SEQ ID NO.19 need to be replaced from the original AT to GC, thereby cultivating rice with extremely low cadmium accumulation, making the cadmium content in the stems, leaves, and rice of the plant osnramp lower than that of the 5 mutant. OsNRAMP5 M235A The DNA sequence of the mutant gene is as shown in SEQ I NO.19. OsNRAMP5 M235A The amino acid sequence of the encoded protein of the mutant gene is as shown in SEQ ID NO.20.
[0030] It includes the following steps: (1) Referring to the published article, on the basis of the gene editing backbone vector pYLCRISPR / Cas9Pubi-H (Ma et al. , 2015. http: / / dx.doi.org / 10.1016 / j.molp.2015.04.007), the guide editing backbone vector pYLCRISPR / Cas9knm-NG was obtained by transformation. In the sgRNA expression cassette backbone vector pYLsgRNA-mOsU6a / b (Hao etal. , 2020. (Based on https: / / doi.org / 10.1007 / s11427-019-1612-6), the esgRNA expression cassette backbone vector pYLesgRNA-mOsU6a / b was obtained by modification. The above basic vectors were all gifted by the team of Academician Liu Yaoguang from South China Agricultural University.)
[0031] The modification method of pYLCRISPR / Cas9knm-NG: ① Replace the sequence after Ubi promoter and Cas9 before the gene with bpNLS (Koblan et al. , 2018. https: / / doi.org / 10.1038 / nbt.4172); ② Mutate the amino acid sequence encoded by the Cas9 gene at 10 sites: R221K and N394K (Spencer et al. , 2017. https: / / doi.org / 10.1038 / s41598-017-17081-y), H840A (Anzalone et al. , 2019. https: / / doi.org / 10.1038 / s41586-019-1711-4), R1335V, L1111R, D1135V, G1218R, E1219F, A1322R and T1337R (Nishimasu et al. , 2018. https: / / doi.org / 10.1126 / science.aas9129); ③ Replace the nucleoplasmin NLS sequence after the Cas9 gene with XTEN-NC-bpNLS-32aa-M-MLVRT-ΔRNase H-bpNLS-c myc NLS (Zong et al. , 2022. https: / / doi.org / 10.1038 / s41587-022-01254-w); The nucleotide sequence of the modified bpNLS-nCas9(H840A)NG-XTEN-NC-bpNLS-32aa-M-MLV RT-ΔRNase H-bpNLS-c myc NLS is shown in SEQ ID NO.1, specifically:
[0032] pYLesgRNA-mOsU6a / b modification method: ① Replace the gRNA scaffold sequence with the egRNA scaffold (Chen et al. , 2013. http: / / dx.doi.org / 10.1016 / j.cell.2013.12.001); ② Insert tevopreQ1 after the gRNA scaffold sequence (Nelson et al. , 2022. https: / / doi.org / 10.1038 / s41587-021-01039-7); The nucleotide sequence of the modified egRNA scaffold - tevopreQ1 is shown in SEQ ID NO.2, specifically: GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCCGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAA.
[0033] (2)OsNRAMP5 M235A For amino acid site-directed mutagenesis, the bases at positions 703 - 704 in the sequence shown in SEQ ID NO.19 need to be replaced from the original AT to GC. According to the sequence characteristics upstream and downstream of this position in its coding gene (LOC_Os07g15370), use the guide editing sequence design tool PlantPegDesigner (http: / / www.plantgenomeediting.net / ) to design dual pegRNAs at this position, and construct the designed RT + PBS sequence onto the target esgRNA expression cassette backbone vector pYLesgRNA-mOsU6a / b through homologous recombination.
[0034] OsNRAMP5 The nucleotide sequence of the sense-strand target M235As is shown in SEQ ID NO.3, specifically: CCTCCTCGGAGCTCTTGTCA TGC; OsNRAMP5 The nucleotide sequence of the sense-strand RT + PBS sequence M235AsRP is shown in SEQ ID NO.4, specifically: aaagcgtacggcGCgacaagagctcc; OsNRAMP5The nucleotide sequence of the sense strand target M235Aa is shown in SEQ ID NO.5, specifically: GTATGTAAAAGCGTACGGCA TGA; OsNRAMP5 The nucleotide sequence of the sense strand RT+PBS sequence M235AaRP is shown in SEQ ID NO.6, specifically: agctcttgtcGCgccgtacgcttt; The nucleotide sequence of the homologous recombination primer M235AsRP-F of M235AsRP is shown in SEQ ID NO.7, specifically: aaagcgtacggcGCgacaagagctccCGCGGTTCTATCTAGTTACGCGT; The nucleotide sequence of the homologous recombination primer M235AsRP-R of M235AsRP is shown in SEQ ID NO.8, specifically: ggagctcttgtcGCgccgtacgctttGCACCGACTCGGTGCCA; The nucleotide sequence of the homologous recombination primer M235AaRP-F of M235AaRP is shown in SEQ ID NO.9, specifically: agctcttgtcGCgccgtacgctttCGCGGTTCTATCTAGTTACGCGT; The nucleotide sequence of the homologous recombination primer M235AaRP-R of M235AaRP is shown in SEQ ID NO.10, specifically: aaagcgtacggcGCgacaagagctGCACCGACTCGGTGCCA.
[0035] (3) Amplify the pegRNA expression cassettes pmOsU6a::M235As-pegRNA and pmOsU6b::M235Aa-pegRNA by 2 rounds of nested PCR, and then use the Golden Gate method to construct the dual pegRNA expression cassette of M235A ( Figure 1 A) onto the backbone vector pYLCRISPR / Cas9knm-NG modified in step (1), transform it into Escherichia coli DH5α, extract the plasmid, and form the final transformation vector pYLCRISPR / Cas9knm-M235A-NG ( Figure 1 B).
[0036] The nucleotide sequence of the first-round nested PCR primer gRT235s-F is shown in SEQ ID NO.11, specifically: CCTCCTCGGAGCTCTTGTCAgttttagagctagaaat; The nucleotide sequence of the first-round nested PCR primer U6aT235s-R is shown in SEQ ID NO.12, specifically: TGACAAGAGCTCCGAGGAGGCggcagccaagccag; The nucleotide sequence of the first-round nested PCR primer gRT235a-F is shown in SEQ ID NO.13, specifically: TGCCGTACGCTTTTACATACaacacaagcggcagc; The nucleotide sequence of the first-round nested PCR primer U6bT235a-R is shown in SEQ ID NO.14, specifically: TATGTAAAAGCGTACGGCAgttttagagctagaaat; The nucleotide sequence of the second-round nested PCR primer p-GL is shown in SEQ ID NO.15, specifically: TTCAGAggtctcTctcgACTAGTATGGAATCGGCAGCAAAGG; The nucleotide sequence of the second-round nested PCR primer g-g2 is shown in SEQ ID NO.16, specifically: AGCGTGggtctcGtcagggTCCATCCACTCCAAGCTC; The nucleotide sequence of the second-round nested PCR primer p-G2 is shown in SEQ ID NO.17, specifically: TTCAGAggtctcTctgacacTGGAATCGGCAGCAAAGG; The nucleotide sequence of the second-round nested PCR primer g-gR is shown in SEQ ID NO.18, specifically: AGCGTGggtctcGaccgACGCGTATCCATCCACTCCAAGCTC。
[0037] (4) Transfer the prime editing vector pYLCRISPR / Cas9knm-M235A-NG into the competent cells of Agrobacterium tumefaciens EHA105, and identify the positive transformants by colony PCR sequencing.
[0038] (5) Using rice 95-22 (Wuyunjing 7) as the transformation receptor, entrust Aidijing Biotechnology Co., Ltd. in Wuhan, Hubei to transform the pYLCRISPR / Cas9knm-M235A-NG vector into 95-22 by Agrobacterium-mediated transformation; The transformation method is specifically as follows: ① Select mature and plump 95-22 seeds. After dehulling, disinfect them with sodium hypochlorite and filter to dryness, then inoculate them onto the induction medium to induce callus; ② Infect the callus of 95-22 with the agrobacterium EHA105 bacterial solution containing the pYLCRISPR / Cas9knm-M235A-NG vector, and then transfer it to the co-culture medium for dark culture at 24 °C for 3 days; ③ Wash the callus and transfer it to the screening medium containing hygromycin for screening culture for 30 days; ④ Transfer the selected resistant callus to the rice pre-differentiation medium for culture for 7-10 days, and then transfer it to the rice differentiation medium for light culture; when the seedlings grow to 2-4 cm, transfer them to the rice rooting medium and grow for about 3 weeks.
[0039] (6) Obtain 185 T0 generation transgenic positive transformed seedlings, detect the mutation sites, and obtain 1 OsNRAMP5 M235A heterozygous mutant ( Figure 2 A), and transplant it into the soil.
[0040] OsNRAMP5 M235A The nucleotide sequence of the mutant gene is as shown in SEQ ID NO.19, specifically:
[0041] OsNRAMP5 M235A The amino acid sequence of the mutant protein is shown in SEQ ID NO.20, specifically: MEIERESSERGSISWRASAAHDQDAKKLDADDQLLMKEPAWKRFLAHVGPGFMVSLAYLDPGNLETDLQAGANHRYELLWVILIGLIFALIIQSLAANLGVVTGRHLAEICKSEYPKFVKIFLWLLAELAVIAADIPEVIGTAFAFNILFHIPVWVGVLITGTSTLLLLGLQKYGVRKLEFLISMLVFVMAACFFGELSIVKPPAKEVMKGLFIPRLNGDGATADAIALLGALVAPHNLFLHSALVLSRKTPASVRGIKDGCRFFLYESGFALFVALLINIAVVSVSGTACSSANLSQEDADKCANLSLDTSSFLLKNVLGKSSAIVYGVALLASGQSSTITGTYAGQYIMQGFLDIRMRKWLRNLMTRTIAIAPSLIVSIIGGSRGAGRLIIIASMILSFELPFALIPLLKFSSSKSKMGPHKNSIYIIVFSWFLGLLIIGINMYFLSTSFVGWLIHNDLPKYANVLVGAAVFPFMLVYIVAVVYLTIRKDSVVTFVADSSLAAVVDAEKADAGDLAVDDDEPLPYRDDLADIPLPR。
[0042] (7) Plant T1 generation plants, detect the exogenous insertion sequence and mutation sites, and screen 3 OsNRAMP5 homozygous mutants without exogenous insertion sequence from 87 T1 generation plants ( M235A B). Figure 2 B).
[0043] Experiment 1: Investigate the cadmium accumulation characteristics of the OsNRAMP5 M235A directed mutant lines: The OsNRAMP5 M235A directed mutant lines under the background of 95-22 and the controls 95-22, 95-22m ( osnramp5After soaking the seeds and germinating them, they were sown in a 96-well PCR plate with the bottom cut off, cultured with deionized water for 5 days, and then cultured with a standard rice nutrient solution for another 9 days. Then they were transferred to a rice nutrient solution supplemented with 0.25 μM and 0.5 μM CdCl2 respectively and continued to be cultured for 14 days. The nutrient solution was changed every 2 - 3 days. After the hydroponic culture ended, the plants were rinsed 3 times with tap water and deionized water respectively. The above-ground part and the root were cut open, dried to a constant weight at 80°C, ground and weighed, digested with a mixed solution of HNO3 - HClO4, and the cadmium content in the above-ground part and the root was measured with an inductively coupled plasma mass spectrometer (ICP-MS).
[0044] The results are shown in Figure 3 : The cadmium content in the roots and above-ground parts of 95 - 22m was reduced by 90.7% - 94.5% ( Figure 3 A) and 95.2% - 96.3% ( Figure 3 B) compared with 95 - 22; while the cadmium content in the roots and above-ground parts of the OsNRAMP5 M235A site-directed mutant plants under the background of 95 - 22 was further reduced by 65.1% - 66.4% ( Figure 3 A) and 50.1% - 63.3% ( Figure 3 B) compared with 95 - 22m, indicating that the site-directed mutation of OsNRAMP5 M235A can further reduce the cadmium absorption in rice roots, thereby reducing the cadmium accumulation in the above-ground part.
[0045] Experiment 2: Investigate the cadmium content in the rice grains of the OsNRAMP5 M235A site-directed mutant lines under the condition of planting in extremely cadmium-polluted soil: The soil collected from an extremely cadmium-polluted paddy field was fully mixed with the soil from a cadmium-free paddy field to form an identification pool with a total soil cadmium content of 19.2 mg / kg (available cadmium content of 13.3 mg / kg) and a pH of 5.6. The 95 - 22, 95 - 22m and the OsNRAMP5 M235A site-directed mutant lines with a seedling age of 25 days were transplanted into it, with 3 replicates and 8 seedlings in each replicate, and conventional water and fertilizer management was carried out. After the rice matured, the panicle part was harvested, threshed, dried to a constant weight at 80°C, hulled into brown rice with a rice huller, ground, and the cadmium content in the brown rice was detected with ICP-MS.
[0046] The results are shown in Figure 4 : The cadmium content in the brown rice of 95 - 22 was 3.052 - 4.160 mg / kg, the cadmium content in the brown rice of 95 - 22m was 1.617 - 1.751 mg / kg, while the OsNRAMP5 M235AThe cadmium content in the brown rice of the site-directed mutant plants was only 0.211 - 0.389 mg / kg, which was on average 91.8% lower than that of 95-22 and 82.2% lower than that of 95-22m. It was proved that OsNRAMP5 under the background of 95-22 M235A The site-directed mutant lines could further reduce the cadmium content in brown rice, providing important germplasm resources and technical strategies for the safe production of rice in extremely cadmium-polluted fields.
[0047] Example 2: A kind of KASP genotyping primer for the rice in Example 1 OsNRAMP5 M235A and its application in molecular breeding and identification of rice with extremely low cadmium accumulation.
[0048] (1) Design KASP genotyping primers according to the [AT / GC] variation between the wild type OsNRAMP5 WT / mutant OsNRAMP5 M235A and use these KASP genotyping primers to genotype the wild type and OsNRAMP5 M235A mutant. The 10 μL KASP PCR amplification system: 5 μL of KASP Master mix (LGC, KBS-1016-016), 0.15 μL of 235AT-FAM (10 μM), 0.15 μL of 235GC-HEX (10 μM), 0.3 μL of 235-Common (10 μM), 1 μL of template DNA (50 ng / μL - 100 ng / μL), 2.4 μL of ddH2O. Put the prepared KASP reaction system into Roche LightCycler480 for PCR. The specific procedure is as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 65°C for 1 min, with a decrease of 0.8°C per cycle for a total of 10 cycles; denaturation at 94°C for 20 s, annealing at 57°C for 1 min, for a total of 30 cycles; signal collection at 37°C for 1 min. The results showed that the wild type OsNRAMP5 WT [AT] and the mutant OsNRAMP5 M235A [GC] could be clearly separated ( Figure 5 ).
[0049] The nucleotide sequence of the KASP genotyping primer 235AT-FAM is shown in SEQ ID NO.21, specifically: GAAGGTGACCAAGTTCATGCTCCCTCCTCGGAGCTCTTGTCA; The nucleotide sequence of the KASP genotyping primer 235GC-HEX is shown in SEQ ID NO.22, specifically as follows: GAAGGTCGGAGTCAACGGATTCCCTCCTCGGAGCTCTTGTCG; The nucleotide sequence of the KASP genotyping primer 235-Common is shown in SEQ ID NO.23, specifically as follows: GATTGATTGTTGCGTATGTATGTAT.
[0050] (2)Hybridize the OsNRAMP5 M235A homozygous mutant in Example 1 with Yuetai B to obtain F1, and continue to self-cross the F1 generation to obtain an F2 segregation population; plant the segregation population and the control Luohong 3B ( OsNRAMP5 gene deletion mutant) in the identification pool described in Experiment 2, genotype different individual plants in the segregation population with the KASP marker in (1), and detect the Cd content of their brown rice with reference to Experiment 2.
[0051] The results are shown in Figure 6 : OsNRAMP5 WT [AT] The Cd content of brown rice in homozygous genotype plants is 4.816 - 6.311 mg / kg, OsNRAMP5 WT / OsNRAMP5 M235A [AT / GC] The Cd content of brown rice in heterozygous genotype plants is 4.513 - 6.277 mg / kg, the Cd content of brown rice in Luohong 3B (LH3B) is 0.981 - 1.565 mg / kg, while OsNRAMP5 M235A [GC] The Cd content of brown rice in homozygous genotype plants is only 0.258 - 0.511 mg / kg, on average, compared with OsNRAMP5 WT [AT] homozygous genotype and OsNRAMP5 WT / OsNRAMP5 M235A [AT / GC] heterozygous genotype plants, it is reduced by 93.4% and 93.2% respectively, and is reduced by 71.1% compared with Luohong 3B. It shows that OsNRAMP5 M235A [GC] homozygous genotype is completely linked to the extremely low Cd accumulation phenotype in the segregation population, and this KASP marker can be used for subsequent molecular breeding and identification of extremely low Cd accumulation rice.
Claims
1. An OsNRAMP5 M235A mutant gene, characterized in that The nucleotide sequence is as shown in SEQ ID NO.
19.
2. An OsNRAMP5 M235A mutant protein, characterized in that The amino acid sequence is as shown in SEQ ID NO.
20.
3. An OsNRAMP5 M235A mutant gene as claimed in claim 1 or an OsNRAMP5 M235A mutant protein for use in cultivating rice with extremely low cadmium accumulation.
4. The application according to claim 3, wherein It includes the following steps: taking the replacement of the base pair AT at positions 703-704 in the sequence shown in SEQ ID NO.19 with GC as the target of site-directed mutagenesis, and constructing OsNRAMP5 M235A a guide editing vector for site-directed mutagenesis, transforming the guide editing vector into rice by Agrobacterium-mediated method to obtain transgenic plants; identifying OsNRAMP5 M235A homozygous mutants, thus obtaining rice with extremely low cadmium accumulation.
5. The application according to claim 4, characterized in that The construction of OsNRAMP5 M235A The guide editing vector for site-directed mutagenesis specifically includes the following steps: homologous recombination of the RT + PBS sequence into the pegRNA expression cassette, followed by amplification of the pegRNA expression cassette using two rounds of nested PCR and addition of the target sequence thereto, and obtaining a guide editing vector containing the M235A dual-pegRNA expression cassette using the Golden Gate method; The target sequence and its RT+PBS sequence are as follows: OsNRAMP5 The nucleotide sequence of the sense strand target M235As is shown in SEQ ID NO.3; OsNRAMP5 The nucleotide sequence of the sense-strand RT + PBS sequence M235AsRP is shown in SEQ ID NO.4; OsNRAMP5 The nucleotide sequence of the sense strand target M235Aa is shown in SEQ ID NO.5; OsNRAMP5 The nucleotide sequence of the sense strand RT + PBS sequence M235AaRP is shown in SEQ ID NO.6; The primers used for homologous recombination are as follows: The nucleotide sequence of the homologous recombination primer M235AsRP-F of M235AsRP is as shown in SEQ ID NO.7; The nucleotide sequence of the homologous recombination primer M235AsRP-R of M235AsRP is as shown in SEQ ID NO.8; The nucleotide sequence of the homologous recombination primer M235AaRP-F of M235AaRP is as shown in SEQ ID NO.9; The nucleotide sequence of the homologous recombination primer M235AaRP-R of M235AaRP is as shown in SEQ ID NO.10; The primers used for the two-round nested PCR method are as follows: The nucleotide sequence of the first-round nested PCR primer gRT235s-F is as shown in SEQ ID NO.11; The nucleotide sequence of the first-round nested PCR primer U6aT235s-R is as shown in SEQ ID NO.12; The nucleotide sequence of the first-round nested PCR primer gRT235a-F is as shown in SEQ ID NO.13; The nucleotide sequence of the first-round nested PCR primer U6bT235a-R is as shown in SEQ ID NO.14; The nucleotide sequence of the second-round nested PCR primer p-GL is as shown in SEQ ID NO.15; The nucleotide sequence of the second-round nested PCR primer g-g2 is as shown in SEQ ID NO.16; The nucleotide sequence of the second-round nested PCR primer p-G2 is as shown in SEQ ID NO.17; The nucleotide sequence of the second-round nested PCR primer g-gR is as shown in SEQ ID NO.
18.
6. The application according to claim 4, characterized in that The identification of OsNRAMP5 M235A The KASP genotyping primers for the homozygous mutants are as follows: The sequence of 235AT-FAM is as shown in SEQ ID NO.21; The sequence of 235GC-HEX is as shown in SEQ ID NO.22; The sequence of 235-Common is as shown in SEQ ID NO.
23.
7. The application according to claim 4, characterized in that, The guide editing vector containing the M235A dual pegRNA expression cassette was prepared by the following method: respectively using Bsa Enzyme I to digest the pYLCRISPR / Cas9knm-NG vector and the dual pegRNA expression cassette, ligating the dual pegRNA expression cassette to the pYLCRISPR / Cas9knm-NG vector, transforming into Escherichia coli, extracting the plasmid, and obtaining the guide editing vector pYLCRISPR / Cas9knm-M235A-NG.
8. The application according to claim 4, characterized in that When transforming the guide editing vector into rice by the Agrobacterium-mediated method, the rice callus after Agrobacterium infection should also be transferred to a selection medium containing hygromycin for screening culture, and the resistant callus should be selected for differentiation culture to obtain transgenic plants containing the hygromycin resistance gene and the OsNRAMP5 M235A mutant gene.
9. A KASP genotyping primer for identifying the mutant gene of OsNRAMP5 described in claim 1, characterized in that, M235A The KASP genotyping primers include 235AT-FAM, 235GC-HEX and 235-Common; the sequence of 235AT-FAM is as shown in SEQ ID NO.21, the sequence of 235GC-HEX is as shown in SEQ ID NO.22, and the sequence of 235-Common is as shown in SEQ ID NO.
23. 10. Use of the KASP genotyping primer as described in claim 9 in identifying the OsNRAMP5 M235A mutant gene or in molecular breeding of rice with extremely low cadmium accumulation.